Dataset for CDS MCL-1 of organism Salmo salar

[Download (right click)] [Edit] [Sequences] [Repertoires]

3 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


Q0KFR9_MCL1-01          ------atgagtctgtcgaactcgattacacgagccacaactacgatgtt
A0A1S3NR66_MCL1-01      ------atgagtctg------tcgtttacacgagccacaactacgatttt
A0A1S3NR66_MCL1-02      gtcaagatgagtctg------tcgtttacacgagccacaactacgatttt
                              *********      *** ********************** **

Q0KFR9_MCL1-01          gcattttcaaaat---------ggaggatcttcgtacctagctgatgatg
A0A1S3NR66_MCL1-01      gaattttcaaaatggagtcgtcggaggctcttcgtaccctgctgg-----
A0A1S3NR66_MCL1-02      gaattttcaaaatggagtcgtcggaggctcttcgtaccctgctgg-----
                        * ***********         ***** **********  ****      

Q0KFR9_MCL1-01          ctaggccgttgtactatttccagggggctggggccatatgtgctggggcg
A0A1S3NR66_MCL1-01      -tacccctttgtgctatttcggcgagactg------tatgtgctggggcg
A0A1S3NR66_MCL1-02      -tacccctttgtgctatttcggcgagactg------tatgtgctggggcg
                         **  ** **** *******   * * ***      **************

Q0KFR9_MCL1-01          tcaccgaagtctaaagtg------gacttgggaaatgggactggcgatac
A0A1S3NR66_MCL1-01      tcacctaagtcaaaagtggatactgacttgggtaatgggactggcgacac
A0A1S3NR66_MCL1-02      tcacctaagtcaaaagtggatactgacttgggtaatgggactggcgacac
                        ***** ***** ******      ******** ************** **

Q0KFR9_MCL1-01          tccaccacgacccacgacgttaggagtgaatgtcgtgaaaagcaacggcc
A0A1S3NR66_MCL1-01      tccaccacgacccacgaagttaggagtgaatgtcgtgaaaagcaacgtcc
A0A1S3NR66_MCL1-02      tccaccacgacccacgaagttaggagtgaatgtcgtgaaaagcaacgtcc
                        ***************** ***************************** **

Q0KFR9_MCL1-01          tcgataatcatttgtcagaccgaagcaacaatgacgac---------tct
A0A1S3NR66_MCL1-01      tgggtaatcatatgtcagaccgaagcaacgatgacgactctgacggttct
A0A1S3NR66_MCL1-02      tgggtaatcatatgtcagaccgaagcaacgatgacgactctgacggttct
                        * * ******* ***************** ********         ***

Q0KFR9_MCL1-01          ttgccgtgcactccccagatggcgtcagaatgtgggcctgaactatcgaa
A0A1S3NR66_MCL1-01      ttgccgtgcactccacagatggcttcagaatgtgggcctgaactatcgaa
A0A1S3NR66_MCL1-02      ttgccgtgcactccacagatggcttcagaatgtgggcctgaactatcgaa
                        ************** ******** **************************

Q0KFR9_MCL1-01          ttgtccatcgggcgatgaagtattggaacatgataccagacaactcattg
A0A1S3NR66_MCL1-01      ttgtccatcgggcgatgaagtattagaacatgatacaagacaactaattg
A0A1S3NR66_MCL1-02      ttgtccatcgggcgatgaagtattagaacatgatacaagacaactaattg
                        ************************ *********** ******** ****

Q0KFR9_MCL1-01          agaattttttgggggactacacaggactgtctcagcctcgatggacgcaa
A0A1S3NR66_MCL1-01      aaaacttattgggggactatataggactgtctccgcctcgttggaagcaa
A0A1S3NR66_MCL1-02      aaaacttattgggggactatataggactgtctccgcctcgttggaagcaa
                        * ** ** *********** * *********** ****** **** ****

Q0KFR9_MCL1-01          agcaagcctcttacgacgatgaagcgagtggtggaggacgtaatagcaaa
A0A1S3NR66_MCL1-01      agcaaggctcttacgacgatgacgcgagtggtgaaggatataatagcgaa
A0A1S3NR66_MCL1-02      agcaaggctcttacgacgatgacgcgagtggtgaaggatataatagcgaa
                        ****** *************** ********** ****  ******* **

Q0KFR9_MCL1-01          gcaccgatacgcatacaatggtatggtcgccaaacttgacttggatgacc
A0A1S3NR66_MCL1-01      gcaccaatacgcatacaatggtatgatcgccaaacttgaactcgatgacc
A0A1S3NR66_MCL1-02      gcaccaatacgcatacaatg-------------actt-------------
                        ***** **************             ****             

Q0KFR9_MCL1-01          gatgcgatgacatgggcgtcatcaattctgtggccaagaccatgttcagt
A0A1S3NR66_MCL1-01      gaagcgacgacatgagtttcatcaattctgtggccaagaccctgttcagt
A0A1S3NR66_MCL1-02      --------------attttttttaggtatg-----atcaccctgttcagt
                                          *  * *  * **     *  *** ********

Q0KFR9_MCL1-01          gacgggatcacaaactggggtcgcatcgccagcctggtggcatttggagc
A0A1S3NR66_MCL1-01      gatgggaccacgaactggggtcgcatcgccagcctggtggcatttggagc
A0A1S3NR66_MCL1-02      gatgggaccacgaactggggtcgcatcgccagcctggtggcatttggagc
                        ** **** *** **************************************

Q0KFR9_MCL1-01          agtggtgagccagcacctgaaggagaggggcaggggacactgcgttgagt
A0A1S3NR66_MCL1-01      agtggtgagccagcgcttgaaggagatgggcaggggacactgcattgagt
A0A1S3NR66_MCL1-02      agtggtgagccagcgcttgaaggagatgggcaggggacactgcattgagt
                        ************** * ********* **************** ******

Q0KFR9_MCL1-01          tggtgggccaagagattgccaaatacctcctctctgaccaaagtgactgg
A0A1S3NR66_MCL1-01      tggtgggccaaaacatcgccacatacctcctctctgaccaaagggactgg
A0A1S3NR66_MCL1-02      tggtgggccaaaacatcgccacatacctcctctctgaccaaagggactgg
                        *********** * ** **** ********************* ******

Q0KFR9_MCL1-01          ctgatcaaaaacaatgcttggaatggatttgtagagttctttcatgtaca
A0A1S3NR66_MCL1-01      ctggtcaaaaacaatgcttggaatggatttgttgagttctttcatgtgca
A0A1S3NR66_MCL1-02      ctggtcaaaaacaatgcttggaatggatttgttgagttctttcatgtgca
                        *** **************************** ************** **

Q0KFR9_MCL1-01          agatcctgagtcctcagtaaggaacaccctcctagcctttgctggagttg
A0A1S3NR66_MCL1-01      agatccagagtcctcagtaaggaacgccctcatagcctttgctggatttg
A0A1S3NR66_MCL1-02      agatccagagtcctcagtaaggaacgccctcatagcctttgctggatttg
                        ****** ****************** ***** ************** ***

Q0KFR9_MCL1-01          ctggaattggggcaacactcgccatgttcatcaggtga
A0A1S3NR66_MCL1-01      ctgggcttggggcaacgctcgccatgttgatcaggtga
A0A1S3NR66_MCL1-02      ctgggcttggggcaacgctcgccatgttgatcaggtga
                        ****  ********** *********** *********

© 1998-2020Legal notice