Dataset for CDS BAK1 of Organism Macaca fascicularis

[Download (right click)] [Alignment] [Repertoires]

5 sequence(s)

>gnl|bcl2dbcds|A0A2K5UMM2_BAK1-01 BCL2-antagonist/killer 1 gene OS=[Eukaryota] Macaca fascicularis GN=BAK1 (length=885 residues).
atggcttcgggacaaggcccaggtcctcccaggcaggaatgcggagagcctgccctgccctctgcttctgaggagcaggt
agcccgggacacagaggaggttttccgcagctacgttttttaccgccatcagcaggaacaggaggctgaaggggcggctg
cccctgccgacccagagatggacaccttgcccctgcaacctagcagcaccatggggcaggtgggacggcagctggccatc
atcggggacgacatcaacagacgctatgactcagagttccagaccatgctgcagcacctgcagcccacggcagagaacgc
ctatgagtacttcaccaagattgcctccagcctgtttgagagtggcatcaactggggccgtgtggtggctcttctgggct
tcggctaccgtctggccctacacgtctaccagcacggcctgactggcttcctgggccaggtgacccgcttcgtggtcgac
ttcatgctgcatcactgcattgcccggtggattgcacagaggggtggcagccctgaacttgggcaatggtcccatcctga
acgtgctggtggttctgggtgtggttctgttgggccagtttgtggtacgaagattcttcaaatcatgactcccaagggtg
ccctttggggtcccagctcagactcctgcctggacttaagccaagtttttgccttctccgctcccttgcaggggtccccc
ctcaagagtacagaagctttagcaagtgtgcactccagcttcggaggtcccctgtgtgggggccagtcaggctgcagagg
cgcctcaacgttgcatggtgctagtgggccctctctgggcccaggggccgtggcctcctccctcggctctctgggacctc
cttag
>gnl|bcl2dbcds|A0A2K5UMM2_BAK1-02 BCL2-antagonist/killer 1 gene OS=[Eukaryota] Macaca fascicularis GN=BAK1 (length=786 residues).
atggcttcgggacaaggcccaggtcctcccaggcaggaatgcggagagcctgccctgccctctgcttctgaggagcaggt
agcccgggacacagaggaggttttccgcagctacgttttttaccgccatcagcaggaacaggaggctgaaggggcggctg
cccctgccgacccagagatggacaccttgcccctgcaacctagcagcaccatggggcaggtgggacggcagctggccatc
atcggggacgacatcaacagacgctatgactcagagttccagaccatgctgcagcacctgcagcccacggcagagaacgc
ctatgagtacttcaccaagattgcctccagcctgtttgagagtggcatcaactggggccgtgtggtggctcttctgggct
tcggctaccgtctggccctacacgtctaccagcacggcctgactggcttcctgggccaggtgacccgcttcgtggtcgac
ttcatgctgcatcactgcattgcccggtggattgcacagaggggtggctgggtggcagccctgaacttgggcaatggtcc
catcctgaacgtgctggtggttctgggtgtggttctgttgggccagtttgtggggtcccccctcaagagtacagaagctt
tagcaagtgtgcactccagcttcggaggtcccctgtgtgggggccagtcaggctgcagaggcgcctcaacgttgcatggt
gctagtgggccctctctgggcccaggggccgtggcctcctccctcggctctctgggacctccttag
>gnl|bcl2dbcds|A0A2K5UMM2_BAK1-03 BCL2-antagonist/killer 1 gene OS=[Eukaryota] Macaca fascicularis GN=BAK1 (length=462 residues).
atggcttcgggacaaggcccaggtcctcccaggcaggaatgcggagagcctgccctgccctctgcttctgaggagcaggt
agcccgggacacagaggaggttttccgcagctacgttttttaccgccatcagcaggaacaggaggctgaaggggcggctg
cccctgccgacccagagatggacaccttgcccctgcaacctagcagcaccatggggcaggtgggacggcagctggccatc
atcggggacgacatcaacagacgctatgactcagagttccagaccatgctgcagcacctgcagcccacggcagagaacgc
ctatgagtacttcaccaagattgcctccaggccagcagcaacacccacagcctgtttgagagtggcatcaactggggccg
tgtggtggctcttctgggcttcggctaccgtctggccctacacgtctaccagcacggcctga
>gnl|bcl2dbcds|A0A2K5UMM2_BAK1-04 BCL2-antagonist/killer 1 gene OS=[Eukaryota] Macaca fascicularis GN=BAK1 (length=468 residues).
atggcttcgggacaaggcccaggtcctcccaggcaggaatgcggagagcctgccctgccctctgcttctgaggagcaggt
agcccgggacacagaggaggttttccgcagctacgttttttaccgccatcagcaggaacaggaggctgaaggggcggctg
cccctgccgacccagagatggacaccttgcccctgcaacctagcagcaccatggggcaggtgggacggcagctggccatc
atcggggacgacatcaacagacgctatgactcagagttccagaccatgctgcagcacctgcagcccacggcagagaacgc
ctatgagtacttcaccaagattgcctccaggtacccctgccggctccagtcactcctctgtcctgtcacaaccacaccat
accctgcctgcatgatgcgctcctggcatggggagatgccttctgtcagtgtccagtgtctgctgtga
>gnl|bcl2dbcds|A0A2K5UMM2_BAK1-05 BCL2-antagonist/killer 1 gene OS=[Eukaryota] Macaca fascicularis GN=BAK1 (length=897 residues).
atggcttcgggacaaggcccaggtcctcccaggcaggaatgcggagagcctgccctgccctctgcttctgaggagcaggt
agcccgggacacagaggaggttttccgcagctacgttttttaccgccatcagcaggaacaggaggctgaaggggcggctg
cccctgccgacccagagatggacaccttgcccctgcaacctagcagcaccatggggcaggtgggacggcagctggccatc
atcggggacgacatcaacagacgctatgactcagagttccagaccatgctgcagcacctgcagcccacggcagagaacgc
ctatgagtacttcaccaagattgcctccagcctgtttgagagtggcatcaactggggccgtgtggtggctcttctgggct
tcggctaccgtctggccctacacgtctaccagcacggcctgactggcttcctgggccaggtgacccgcttcgtggtcgac
ttcatgctgcatcactgcattgcccggtggattgcacagaggggtggctgggtgagtggcagccctgaacttgggcaatg
gtcccatcctgaacgtgctggtggttctgggtgtggttctgttgggccagtttgtggtacgaagattcttcaaatcatga
ctcccaagggtgccctttggggtcccagctcagactcctgcctggacttaagccaagtttttgccttctccgctcccttg
caggggtcccccctcaagagtacagaagctttagcaagtgtgcactccagcttcggaggtcccctgtgtgggggccagtc
aggctgcagaggcgcctcaacgttgcatggtgctagtgggccctctctgggcccaggggccgtggcctcctccctcggct
ctctgggacctccttag
© 1998-2023Legal notice