Dataset for CDS Unclassified of organism Clytia hemisphaerica

[Download (right click)]

9 sequence(s)

>gnl|bcl2dbcds|A0A7M5VAR7_uncBCL2L1-01 Putative BCL2-like 1 gene OS=[Eukaryota] Clytia hemisphaerica (length=696 residues).
atgatgctgcgtttgatttgcttgacctggtgtctagtgttgacatcgggtaagccagcaacaaaatatcaccaggagga
cctcttggatatggtgaaacgtgcgttagaaggtggtctacaccaatctcttgatgttgcaaaacagttggtctcctctg
acttggatgccttggaaggtgatatcaagaaaaatggattcaagtcaggaaatgtcatgaaaacccccaacgctgtacaa
atcaagaagaacttacacagcgacatcaaagtcggaaaatacgaacaaaaaattttcaaatcagtcaaagctgccgtatg
ttctaaaggtgaaggtcatcttgaagaggcagttgattccttcatggacttcttggctaccattcgaaacaacatcttga
ccaaagccgctggcaaatacttggattccgttgaggattttgttggaacaactagtattgattttgatgatgaagaacga
aagatcgtgaaagagatggatttggatggagatgtgacaatcgaaaatttccatgacgaaatcaaaaatgctgtcgctat
ctgcaaaaaagattatgtaggatgcaaggacgatgattcagacgttggagaatacgtcgatgttaaagatcaagtcgatg
acattattgatacccttcaaaagaaattggaaaatgttcgaaaggctgccagctaa
>gnl|bcl2dbcds|A0A7M5VAR7_uncBCL2L1-02 Putative BCL2-like 1 gene OS=[Eukaryota] Clytia hemisphaerica (length=591 residues).
atggctggtgctcaaccaccaaacgaaaatgaagaggagaaaattcgtagactaatccaagattttgttggtgaaagact
tcggaggaaaggtatttctgtacctggctatgatcaagaagaacttatcaacgaaaatagtagcatttccgaaattgcat
taactttacgaagagttggtgatgaatttgaaatggcagcagatacacaatttgttgcaaacatgtgtacgagactttca
attactccaaatactgcttatcctatgttccaagcaatatcagataaaatttttgcctcagggaaaaactgggggcgagt
tgtagcttttctgacatttggtagttctttggcagttcattgtgctgagaaacctgacatgggtgttacatttgttgata
caatagtcagttggatccatcagtacgttgtctcgcgcttgggggaatggatcaaagaacaaggtggattgaaaggattc
atggactttttcaaacgcgaccaagctcaaaatacgactcaaaatggattcttaatgtccgccctagcgggtgtaggatt
gggcgctttcctaatgatgaccttcaaatag
>gnl|bcl2dbcds|A0A7M5VGN0_uncBCL2L1-01 Putative BCL2-like 1 gene OS=[Eukaryota] Clytia hemisphaerica (length=834 residues).
atgtcaaatattgaagagaatgagagcctgaacggagcagaagaaatggttgccacaaagaaatcacaaactacactctg
gatttatttgtatcgttgttcgaaactcgggcctcgttctttatggatcaaacaatcgaattgtgtcttagaagaactaa
ccagaacgatatgcgataaagcgattcgtcatcgaatgacaaaagcctctatcgatcattctccgatcaaaagtccgaaa
ctttacgaaacgccgtccgagaaaacaatgcaatgcgtaaaagatatgattgatttgatagtctcttcacatccggaact
ctatacggaaatcacattcaagttaaacataccggttcaagacgagcggactgtatgtagaacgtatagtgagtttgctg
agaatctgttcaagcgaggagtttcatggccgctcatcatttcactgttgtcgttttccggaagtctagcagcggagtgt
acgcggaacgggcggagtattttagtacgacgtatttgcgattgggcaacgttatttatcgtgatgagactgaaagattg
gatacaagataatggcggatgggatggaatgtacgaattcttttaccagcctacactcaacaataatagtgtgtttcctt
cagataaactccaacaattaaatgagtggaaaatcgccatttccaatgcagtgaaacctgaaaaggctgctcgttttgca
ctgggatttttcatattcttagctttgttactaataacattctttaaaagcacatcaacagagtgcaaatctggaggcgt
tagaagcaagtttagtatttatagagactgttaa
>gnl|bcl2dbcds|A0A7M5VGN0_uncBCL2L1-02 Putative BCL2-like 1 gene OS=[Eukaryota] Clytia hemisphaerica (length=903 residues).
atgcttcgaagttttgaacaaatacgcaacacacgtaagattggaagtctggatataaaggatgttcactcgtcaaattc
agatgaggacgatttaggttcaggagcagaagaaatggttgccacaaagaaatcacaaactacactctggatttatttgt
atcgttgttcgaaactcgggcctcgttctttatggatcaaacaatcgaattgtgtcttagaagaactaaccagaacgata
tgcgataaagcgattcgtcatcgaatgacaaaagcctctatcgatcattctccgatcaaaagtccgaaactttacgaaac
gccgtccgagaaaacaatgcaatgcgtaaaagatatgattgatttgatagtctcttcacatccggaactctatacggaaa
tcacattcaagttaaacataccggttcaagacgagcggactgtatgtagaacgtatagtgagtttgctgagaatctgttc
aagcgaggagtttcatggccgctcatcatttcactgttgtcgttttccggaagtctagcagcggagtgtacgcggaacgg
gcggagtattttagtacgacgtatttgcgattgggcaacgttatttatcgtgatgagactgaaagattggatacaagata
atggcggatgggatggaatgtacgaattcttttaccagcctacactcaacaataatagtgtgtttccttcagataaactc
caacaattaaatgagtggaaaatcgccatttccaatgcagtgaaacctgaaaaggctgctcgttttgcactgggattttt
catattcttagctttgttactaataacattctttaaaagcacatcaacagagtgcaaatctggaggcgttagaagcaagt
ttagtatttatagagactgttaa
>gnl|bcl2dbcds|A0A7M5WJ94_uncBCL2L1-01 Putative BCL2-like 1 gene OS=[Eukaryota] Clytia hemisphaerica (length=837 residues).
atgccgctgacaatagaagatgaaggagcgcctttaacaccgcccacttcaatcacgcccgaaccaccctctccatcacc
atcgattcgggagcgacgtctgcaagataggaataataaagagttcattcgtaggttagcaaacgattacatacatttca
aaatacacggacccaatagtcacactcaagatatggaagtatttcaagattcgaaccaaagcttattatcaccgagatct
ccacgagttaatcgttttcaaagtactagtacaggagcctattcggagcggagtagcgtgagtgattcaaacaataacat
ggtacatagtccaacattatccgaaccttcagatgacgtcattgatgatcaaatatccaatcaggagccatttcgaaagg
cgtctagagtattacggaaagttagtgtcgagttagaacgttcgaattcagcatttttcgaaaatgtgtgcgaagactta
agtttgaataatacagacgcgaggactgcttttcgtaatgtatcagaccgcgttttagatcgtgattcactgaactgggg
acgagttgttagtgtgtttacttttggcgggaaattggccgaatggttttggaattcacatcaagaagagaggattgatg
aagttgaagaatggctggctgaaagtttatcaagtaaagagagttggatcgaagaaaatggaggctgggaatatttcgcc
gaaaaatttgaaaaggatcgtgaaaaagatgacacaaatttcaactggttgaaacccggactattgatgtgcgttggagt
gtcattagctgctatctttagtatgaaaatgcaatga
>gnl|bcl2dbcds|A0A7M5WRB5_uncBCL2L1-01 Putative BCL2-like 1 gene OS=[Eukaryota] Clytia hemisphaerica (length=687 residues).
atggctcccaatatgtcacctataacaattaggaacactaatgctaaacaactttgtaatcaaaaagataaaattgaacc
tccaattgaaattcaaattgaacatgaaattgatacaaaattattatcgatcataaataatggatacaacattgctaaat
attacatcccatatcatttacggtgtagttgtaaacatgaattacttcaaggactcccaaaaagttttgtggtgccccca
gcacaaccaccagaactttacttacgagtagcaactttttcatatggaatggagaaaaaatttgaagcatttttcgaaca
gatccctactcacatgaaactgaaaaatgaaaatgctaaagagatttttatttcactatgtagacgagttgtaagttcag
acgttaattggggacgagtaatatcaatttttacagttggaggtgcttttgcagtgcattttgtaaataaaggacagcta
gatattgtaaaaagtataccaggatgggttcaagaagtattggaaacaactgaaggtctcccagaatggattcaagagca
aggaggatgggagaaattatcattacgctccaaagatgacctgaacaatgcatcatggtctagttacgtcactgtcggct
tcggagttgccgccgctggaatgcttctcttcggcttgagtaaatag
>gnl|bcl2dbcds|A0A7M5WRB5_uncBCL2L1-02 Putative BCL2-like 1 gene OS=[Eukaryota] Clytia hemisphaerica (length=687 residues).
atggctcccaatatgtcacctataacaattaggaacactaatgctaaacaactttgtaatcaaaaagataaaattgaacc
tccaattgaaattcaaattgaacatgaaattgatacaaaattattatcgatcataaataatggatacaacattgctaaat
attacatcccatatcatttacggtgtagttgtaaacatgaattacttcaaggactcccaaaaagttttgtggtgccccca
gcacaaccaccagaactttacttacgagtagcaactttttcatatggaatggagaaaaaatttgaagcatttttcgaaca
gatccctactcacatgaaactgaaaaatgaaaatgctaaagagatttttatttcactatgtagacgagttgtaagttcag
acgttaattggggacgagtaatatcaatttttacagttggaggtgcttttgcagtgcattttgtaaataaaggacagcta
gatattgtaaaaagtataccaggatgggttcaagaagtattggaaacaactgaaggtctcccagaatggattcaagagca
aggaggatgggagaaattatcattacgctccaaagatgacctgaacaatgcatcatggtctagttacgtcactgtcggct
tcggagttgccgccgctggaatgcttctcttcggcttgagtaaatag
>gnl|bcl2dbcds|A0A7M5WUV8_uncBCL2L1-01 Putative BCL2-like 1 gene OS=[Eukaryota] Clytia hemisphaerica (length=672 residues).
atgtcaaatattgaagagaatgagagcctgaacggagcagaagaaatggttgccacaaagaaatcacaaactacactctg
gatttatttgtatcgttgttcgaaactcgggcctcgttctttatggatcaaacaatcgaattgtgtcttagaagaactaa
ccagaacgatatgcgataaagcgattcgtcatcgaatgacaaaagcctctatcgatcattctccgatcaaaagtccgaaa
ctttacgaaacgccgtccgagaaaacaatgcaatgcgtgaaagatatgattgatttgatagtctcttcacatccggaact
ctatacggaaatcacattcaagttaaacataccggttcaagacgaacggactgtatgcaggacgtatagtgagtttgctg
agaatctgttcaagcgaggagtttcatggccgctcatcatttcattgttgtcgttttctggaagtctagcagcggagtgt
acgcggaacgggcggagtattttagtacggcgtatttgtgattgggcaacgttatttatcgtgatgagactgaaagattg
gatacaagataatggcggatgggatggaatgtacgaattcttttaccagcctacactcaacaataatagtgtgtttcctt
cagataaactccaaactccaacaattaaatga
>gnl|bcl2dbcds|A0A7M5WUV8_uncBCL2L1-02 Putative BCL2-like 1 gene OS=[Eukaryota] Clytia hemisphaerica (length=741 residues).
atgcttcgaagttttgaacaaatacgaaacacacgtaagattggaagtctggatataaaggatgttcactcgtcaaattc
agatgaggacgatttaggttcaggagcagaagaaatggttgccacaaagaaatcacaaactacactctggatttatttgt
atcgttgttcgaaactcgggcctcgttctttatggatcaaacaatcgaattgtgtcttagaagaactaaccagaacgata
tgcgataaagcgattcgtcatcgaatgacaaaagcctctatcgatcattctccgatcaaaagtccgaaactttacgaaac
gccgtccgagaaaacaatgcaatgcgtgaaagatatgattgatttgatagtctcttcacatccggaactctatacggaaa
tcacattcaagttaaacataccggttcaagacgaacggactgtatgcaggacgtatagtgagtttgctgagaatctgttc
aagcgaggagtttcatggccgctcatcatttcattgttgtcgttttctggaagtctagcagcggagtgtacgcggaacgg
gcggagtattttagtacggcgtatttgtgattgggcaacgttatttatcgtgatgagactgaaagattggatacaagata
atggcggatgggatggaatgtacgaattcttttaccagcctacactcaacaataatagtgtgtttccttcagataaactc
caaactccaacaattaaatga
© 1998-2022Legal notice