Dataset for CDS BCL-2-like of organism Maylandia zebra

[Download (right click)] [Edit] [Sequences] [Repertoires]

5 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A3P9BVM3_MCL1-01      atggccaa---------------------ctatatgatgttgaaaaggaa
A0A3P9D632_BCL2L1-      atgtctcaaaacagagaacttgtgcttttctacataaggt------ataa
A0A3P9D632_BCL2L1-      atgtctcaaaacagagaacttgtgcttttctacataaggt------ataa
A0A3P9BLI0_BCL2L10      atgatttatggattatttgtcacccttttttgtaccataccaaaccatga
A0A3P9DIG5_BCL2-01      atggagaacgagt---------------------------------ataa
                        ***    *                                         *

A0A3P9BVM3_MCL1-01      cc------------agtgtaccctaatggaatatcttattcctcaaaat-
A0A3P9D632_BCL2L1-      ac----------------tctcccagagaaactatcctctcaaccacata
A0A3P9D632_BCL2L1-      ac----------------tctcccagagaaactatcctctcaaccacata
A0A3P9BLI0_BCL2L10      ccacacttccgctggttattccgtggcggtg-gtgtcttctttccacagt
A0A3P9DIG5_BCL2-01      tcgca------------atattgtggaaaagtatatctgccataaactct
                         *                *                          *    

A0A3P9BVM3_MCL1-01      ----------------------ggagtcttggaggg----------acca
A0A3P9D632_BCL2L1-      gtactcaacgagccttcgaacaggactgatgggggg--------------
A0A3P9D632_BCL2L1-      gtactcaacgagccttcgaacaggactgatgggggg--------------
A0A3P9BLI0_BCL2L10      ccacacgacg-ttcccagcacaaaaatcatgtcgagaggcggagtcacgc
A0A3P9DIG5_BCL2-01      ccaagcgggg-gt-------------tcgtgtgggg--------------
                                                  *  **  * *              

A0A3P9BVM3_MCL1-01      atgcacta----cggatctggaaattcctct--ccgcagaacgccacagg
A0A3P9D632_BCL2L1-      --gcagcggggttggatgaggaacagcgaatagacacaca-cgccaatgg
A0A3P9D632_BCL2L1-      --gcagcggggttggatgaggaacagcgaatagacacaca-cgccaatgg
A0A3P9BLI0_BCL2L10      attctgcatcagctgaagggaagactcaact------gtaccgac-gctc
A0A3P9DIG5_BCL2-01      atttcgcgttgtccaagaagaagatgctgctaataacggatcgataactg
                                       *   * *    *   *        * **       

A0A3P9BVM3_MCL1-01      ctcctctaaagactcta--------gcaatgggattgtgtccaatggtac
A0A3P9D632_BCL2L1-      gacttttaatggc--------acgagtcccggga----ccccaccggcat
A0A3P9D632_BCL2L1-      gacttttaatggc--------acgagtcccggga----ccccaccggcat
A0A3P9BLI0_BCL2L10      tccttccgccgtctgta-------tgtgcagaga----gcagtctgatat
A0A3P9DIG5_BCL2-01      accctccaccgactttggtccaccggtgccgaga----a------gccag
                          * *     * *            *    * **           *  * 

A0A3P9BVM3_MCL1-01      ccccaaa------------------cggc--cggacaacctcgaggtaac
A0A3P9D632_BCL2L1-      ccccgca-----------------gcggc----ggcagcagc--agccgc
A0A3P9D632_BCL2L1-      ccccgca-----------------gcggc----ggcagcagc--agccgc
A0A3P9BLI0_BCL2L10      cgctgggaggaaaatgaaattctgtgggctgtggaaagagac--cctggt
A0A3P9DIG5_BCL2-01      caccggg-------------cctgacggc----gagagcaac--acccac
                        * *                       ***    *  *    *        

A0A3P9BVM3_MCL1-01      ctcaacaaacgggtata-aaacaaaagctatccgggaccgggaggaagac
A0A3P9D632_BCL2L1-      catcaacgacggacctc----------------gacgcagtgaaggaggc
A0A3P9D632_BCL2L1-      catcaacgacggacctc----------------gacgcagtgaaggaggc
A0A3P9BLI0_BCL2L10      tttggccgaggactacctgtccttttgctgcacgagtccacat-caagcc
A0A3P9DIG5_BCL2-01      ctctgcagacggctccc---------acagtccga-cccacacgcaggca
                                * *                      *   *         *  

A0A3P9BVM3_MCL1-01      ggttcgttgccgagcaccccagagtttcattcggacagtgaatccgacg-
A0A3P9D632_BCL2L1-      gctccgggaca------------------------cggccaat-------
A0A3P9D632_BCL2L1-      gctccgggaca------------------------cggccaat-------
A0A3P9BLI0_BCL2L10      cctccacctcc------------------------cagcgaatcagccgc
A0A3P9DIG5_BCL2-01      tccacagagtc------------------------ctgcg----------
                            *                              * *            

A0A3P9BVM3_MCL1-01      -------------agcagctggagagagaaacgaaactccttattcacag
A0A3P9D632_BCL2L1-      --------------------------gagttcgagctgcgatacgctcgt
A0A3P9D632_BCL2L1-      --------------------------gagttcgagctgcgatacgctcgt
A0A3P9BLI0_BCL2L10      tgccatgaggcgtctaggctgg----gacatcgaaagacagcaccaagct
A0A3P9DIG5_BCL2-01      -------------cgaggctggagatgaacttgaaagactgtaccagccg
                                                        **    *   *       

A0A3P9BVM3_MCL1-01      ttttttgggtgactttattggactttctcagcctcaacgaaaagaaacca
A0A3P9D632_BCL2L1-      gccttcagcgaccttcacagc-------cagctgcacatcacgccggcca
A0A3P9D632_BCL2L1-      gccttcagcgaccttcacagc-------cagctgcacatcacgccggcca
A0A3P9BLI0_BCL2L10      cgctt-------------cga-------caacctcg-ctcagaccttcc-
A0A3P9DIG5_BCL2-01      gacttcacggagatgtcgcgg-------cagctgcatctcacctcctcca
                           **              *        ** *  *     *      ** 

A0A3P9BVM3_MCL1-01      aagcactaaagacgatgaaaagagttgttgcggacgtattagaaaagcac
A0A3P9D632_BCL2L1-      cggc-----------------------ctaccaaagcttcgagaacgt--
A0A3P9D632_BCL2L1-      cggc-----------------------ctaccaaagcttcgagaacgt--
A0A3P9BLI0_BCL2L10      tggtgc-----agtgtggaccggaccactgcctcagcctcagaaaggt--
A0A3P9DIG5_BCL2-01      cggcgc-----agagg------------------aggttcgccgaggt--
                          *                                *  *     * *   

A0A3P9BVM3_MCL1-01      agatacgcttacaacggaatgattaataaattgtcattggatgaaagaga
A0A3P9D632_BCL2L1-      ---------------------------------------gatggacgag-
A0A3P9D632_BCL2L1-      ---------------------------------------gatggacgag-
A0A3P9BLI0_BCL2L10      ---------------------------------------gatgaaggag-
A0A3P9DIG5_BCL2-01      ---------------------------------------gatagacgaa-
                                                               ***  * **  

A0A3P9BVM3_MCL1-01      cgaggatatgtcttttgtcggtgctgtagcgaagagcctctttggagacc
A0A3P9D632_BCL2L1-      -------------------------------------gtgttccgggacg
A0A3P9D632_BCL2L1-      -------------------------------------gtgttccgggacg
A0A3P9BLI0_BCL2L10      -------------------------------------ctggttggagatg
A0A3P9DIG5_BCL2-01      -------------------------------------ctgttccgggacg
                                                              *  *  * **  

A0A3P9BVM3_MCL1-01      acacgaccaactggggtcgtattgtcagctttatggccttc---ggggca
A0A3P9D632_BCL2L1-      gc---gttaactggggccgcatcgtagggcttttcgcgttcggcggggca
A0A3P9D632_BCL2L1-      gc---gttaactggggccgcatcgtagggcttttcgcgttcggcggggca
A0A3P9BLI0_BCL2L10      gacacttgaactgggggagggttgtttctcttttcgcctttactggagtg
A0A3P9DIG5_BCL2-01      gg---gtgaactggggccggattattgctttcttcgagtttg--ggggca
                                ********  *  *  *     *  * *  **    ** *  

A0A3P9BVM3_MCL1-01      gtggtctctcagcacctgaaggaaaag----------------------g
A0A3P9D632_BCL2L1-      ctgtgtgtcgagtgcgtcgagaag--------------------------
A0A3P9D632_BCL2L1-      ctgtgtgtcgagtgcgtcgagaag--------------------------
A0A3P9BLI0_BCL2L10      ctggccagaaagatcctggagcagaagccggggctggaccctcgtcaaca
A0A3P9DIG5_BCL2-01      ctgt-------gtgcgtggagtg-------------------cgcttcca
                         **        *  * *  **                             

A0A3P9BVM3_MCL1-01      gcagggacaattacgtggcgctagtgagccaaga--gatttctgc-----
A0A3P9D632_BCL2L1-      ---------gagatgagccccttggtgggcaggatcgtagagtgg-----
A0A3P9D632_BCL2L1-      ---------gagatgagccccttggtgggcaggatcgtagagtgg-----
A0A3P9BLI0_BCL2L10      gcaggaactgggacaggagccca--tgagctgca--gaaggctggcagag
A0A3P9DIG5_BCL2-01      acgag----gggatgtcatcccaggtggacaacatcgcagactgg-----
                                    *       *        *   *  *     **      

A0A3P9BVM3_MCL1-01      ---atacctg-ctgtctgaacagcgaga-------ctggattgtaaaaaa
A0A3P9D632_BCL2L1-      ---atgacggtctacctagacaaccacattcagccctggatccagagcca
A0A3P9D632_BCL2L1-      ---atgacggtctacctagacaaccacattcagccctggatccagagcca
A0A3P9BLI0_BCL2L10      accatagctgattacctgggagaagagaagaaagactggctgttggataa
A0A3P9DIG5_BCL2-01      ---atgacggagtatttaaatggacctcttaacagctggatacaagataa
                           **  * *  *   *                  **** *        *

A0A3P9BVM3_MCL1-01      caatgcatgggatggctttgtggagttctttcg-----------------
A0A3P9D632_BCL2L1-      aggaggatgggagcgcttcgctgaaatcttcgg-------gcaggatgcg
A0A3P9D632_BCL2L1-      aggaggatgggagcgcttcgctgaaatcttcgg-------gcaggatgcg
A0A3P9BLI0_BCL2L10      tgatggatgggaaggcttctgtaagttctcccgcagtgccagaga-----
A0A3P9DIG5_BCL2-01      cgggggatgggatgcatttgtggagctgtacgacagacagagggactccg
                            * ******    **     *  * *                     

A0A3P9BVM3_MCL1-01      --agtagcagaccctgagtcgatagtcaggcacacact----catggcct
A0A3P9D632_BCL2L1-      gcggctgaaagccggaggtc-----tcaggagagtttcaagaagtggctg
A0A3P9D632_BCL2L1-      gcggctgaaagccggaggtc-----tcaggagagtttcaagaagtggctg
A0A3P9BLI0_BCL2L10      -----agtgagccaggactcatccatgaagaaagcgct----gtttgctg
A0A3P9DIG5_BCL2-01      tcttcagttgctcctggccc-tccatcaagacagtttt-cggcttggctg
                              *     *      *     * * *              * **  

A0A3P9BVM3_MCL1-01      ttgctggatttgctggtattgg--ggcaacactggccctgttgatcagtt
A0A3P9D632_BCL2L1-      ctggtggggatgacggtggtgacaggcgttgtggcgggtgcgcttatcgc
A0A3P9D632_BCL2L1-      ctggtggggatgacggtggtgacaggcgttgtggcgggtgcgcttatcgc
A0A3P9BLI0_BCL2L10      ccgccgg---tgtc----------ggccttgct----gggcttaccttcc
A0A3P9DIG5_BCL2-01      cgctcggagcggcc----------agcctcaccatcggagcataccttac
                             **    *             **            *          

A0A3P9BVM3_MCL1-01      gctgggatgcattattgtga
A0A3P9D632_BCL2L1-      gcaaaaacgc----ctgtga
A0A3P9D632_BCL2L1-      gcaaaaacgc----ctgtga
A0A3P9BLI0_BCL2L10      tc-ttggtgc----gctag-
A0A3P9DIG5_BCL2-01      acaaaagtga----------
                         *      *           

© 1998-2022Legal notice