Dataset for CDS Unclassified of organism Pavo cristatus

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|A0A8C9LEK7_uncBCL2A1-01 Putative BCL2-related protein A1 gene OS=[Eukaryota] Pavo cristatus (length=510 residues).
atggaaactgctgagttctattacgtttattatttagctcaagattatctgcaatatgtgcttcaggaatcacatctcgg
accagcccaaaccagagttgctcacgtcttgcgaaacattgcatcttcactccaagatcagacagaggaggctctcagac
ccttcttggacaggatcgatattacctccgtagaagttgccaagagaattttcaatggagtcatggaagaaaaatttgct
gatggaaatactaactggggacgaattacgaccatatttacttttggaggtcttctcaccaagaagcttcaagagcatgg
angcttcattgctaagttttcctccaaagaagtacaaattattctaatttttttacagtgtagctacactaatatttttg
gaaaaaaaaccattaaaatatgtattttcaaatcttatggtgggcctcatctctttcagaaaaaaaattgtaggatggga
gaagggggaagatctacctggttaaggtaa
© 1998-2022Legal notice