Dataset for CDS BCL-2-like of organism Oryzias sinensis

[Download (right click)] [Edit] [Sequences] [Repertoires]

6 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A8C7XSQ2_BCL2L1-      atgtcccactgtaacagagagctggttcggttctatttagcctataagat
A0A8C7XSQ2_BCL2L1-      atgactaagtggaagaaatcatgg---------catctgacctataagat
A0A8C7X109_MCL1-01      atgtttcctttgcaaaaacagatggttaacagctacatcacgtct-aact
A0A8C7XY96_BCL2L10      atgt---c---------------------------------ttgtgggct
A0A8C7YJI1_BCL2L1-      atgt---cccggaacagagaactggttgttttctacgtgaagtataaact
A0A8C7ZK61_BCL2-01      atgg---c---gaacg-------------tgtctaatcgcagtat----t
                        ***                                       * *    *

A0A8C7XSQ2_BCL2L1-      gtcat---gcagggactatcct---------------------gtgtc--
A0A8C7XSQ2_BCL2L1-      gtcat---gcagggactatcct---------------------gtgtc--
A0A8C7X109_MCL1-01      gtggatttacggga-----cacatcctcggcagagcgggagagatgtccg
A0A8C7XY96_BCL2L10      gagga---aagaga-------ccctagctgt------------ggccc--
A0A8C7YJI1_BCL2L1-      gtctc---agaggaactaccccctcaaccacatagtgctcaatgagtc--
A0A8C7ZK61_BCL2-01      gtaga---aaagta-------catttgccaca-----------aactc--
                        *                                              *  

A0A8C7XSQ2_BCL2L1-      -----------------cctgctgaagcccac------------------
A0A8C7XSQ2_BCL2L1-      -----------------cctgctgaagcccac------------------
A0A8C7X109_MCL1-01      cgcgcgtgcctctgccgtccacattggcctctcgcgtggcaaaccccgac
A0A8C7XY96_BCL2L10      -----------------t-------ggattac------------------
A0A8C7YJI1_BCL2L1-      -----------------tccgaacaggactgctgcggggga---------
A0A8C7ZK61_BCL2-01      -----------------tccaagaggggctac-gtgtgtgg---------
                                                  *                       

A0A8C7XSQ2_BCL2L1-      -------------------------agacgatgggggagaaactgaag--
A0A8C7XSQ2_BCL2L1-      -------------------------agacgatgggggagaaactgaag--
A0A8C7X109_MCL1-01      ccgtccgatccgatcaaaagaccgcaggacctcgagtattccacgaggag
A0A8C7XY96_BCL2L10      -------------------------------------ctgtccctgag--
A0A8C7YJI1_BCL2L1-      -----------------------ggtgggcgaggagcacagcacggag--
A0A8C7ZK61_BCL2-01      -----------------------gctgaac--ggcggccagcccgaga--
                                                                          

A0A8C7XSQ2_BCL2L1-      -------------------------------aggaccactccactgcccg
A0A8C7XSQ2_BCL2L1-      -------------------------------aggaccactccactgcccg
A0A8C7X109_MCL1-01      gtttcacgacgtcgacgacga----------tggctctctcccgaacacc
A0A8C7XY96_BCL2L10      -----ctgcag--------------------gagcccactcca-------
A0A8C7YJI1_BCL2L1-      -----acgc--acgccaacgggacgtttaacgggacaactcccgggaccc
A0A8C7ZK61_BCL2-01      -----atgctgccaataacggctcggttg--gggaccattccc-cgactc
                                                         *     ***        

A0A8C7XSQ2_BCL2L1-      -----------------gaacggcaggccggtcagcag--tgaggacggc
A0A8C7XSQ2_BCL2L1-      -----------------gaacggcaggccggtcagcag--tgaggacggc
A0A8C7X109_MCL1-01      ccggagctggagtgcgaggccagcgtttccggcgacaactcgggaatcga
A0A8C7XY96_BCL2L10      -----------------ggcccccccacctcccagcga------gtcagc
A0A8C7YJI1_BCL2L1-      c----------------g--ccgctctccccgctgcga--gagcaacagt
A0A8C7ZK61_BCL2-01      c----------------ggtccgc---cgccgctgcgacgcaggaacggg
                                         *  *  *        *  *            * 

A0A8C7XSQ2_BCL2L1-      --cagctgagga--------------------------------------
A0A8C7XSQ2_BCL2L1-      --cagctgagga--------------------------------------
A0A8C7X109_MCL1-01      cgctttaaacgagaacaccagggaattcctcaccaatttctttaggaact
A0A8C7XY96_BCL2L10      tgctgccatgag--------------------------------------
A0A8C7YJI1_BCL2L1-      tgccgtcgacga---caaacatggacgcagtgaa----------------
A0A8C7ZK61_BCL2-01      gcctgacgaggagagcagcccccgcctcatcagagcgctctcccggg---
                          *                                               

A0A8C7XSQ2_BCL2L1-      ----------------ggtcctgtccctgttgtgctagcatggacgccat
A0A8C7XSQ2_BCL2L1-      ----------------ggtcctgtccctgttgtgctagcatggacgccat
A0A8C7X109_MCL1-01      ttgttggaatttctcagtatccaaaccgggataataaata-------cat
A0A8C7XY96_BCL2L10      ----------------gcgcctggcccagg---------a-------ca-
A0A8C7YJI1_BCL2L1-      ----------------ggaggcgctccggg---------a-------ca-
A0A8C7ZK61_BCL2-01      ---------------cggacccgctcgcgg---------a-------cat
                                        *        *  *          *       ** 

A0A8C7XSQ2_BCL2L1-      caaatcaactctcaaagattcggccgatgagtttgaacgtcgtttc----
A0A8C7XSQ2_BCL2L1-      caaatcaactctcaaagattcggccgatgagtttgaacgtcgtttc----
A0A8C7X109_MCL1-01      gtcgaccgcgaaaagagtggtgaacgacgtgttaga--------------
A0A8C7XY96_BCL2L10      --------------------tggaggcgcagtaccagccccgcttctcca
A0A8C7YJI1_BCL2L1-      --------------------cggccaacgagttcgagctccggtac----
A0A8C7ZK61_BCL2-01      ccacagggtcctgcgcgaggcgggagacgagctggagcgcctgtac----
                                             *        *    *              

A0A8C7XSQ2_BCL2L1-      -----catcaaggttttagtgatctctccgtgcagcttcatatcactccg
A0A8C7XSQ2_BCL2L1-      -----catcaaggttttagtgatctctccgtgcagcttcatatcactccg
A0A8C7X109_MCL1-01      ----------gaaacacaagattacttacaacggtatgatcgtcagactg
A0A8C7XY96_BCL2L10      ccttagcacagaacttcaggaa---gcacagcgggccggacctgtgctcc
A0A8C7YJI1_BCL2L1-      -----gccctggccttcaacaacctgcacagccagctgcacatcacgccc
A0A8C7ZK61_BCL2-01      -----cagcgggacttcacggagatgtcgcggcagctgtacctcacctcc
                                         *                        *       

A0A8C7XSQ2_BCL2L1-      gacacggcctaccaaaac---------------ttcaaaagggtgttgga
A0A8C7XSQ2_BCL2L1-      gacacggcctaccaaaac---------------ttcaaaagggtgttgga
A0A8C7X109_MCL1-01      tcgttggacgaccagggggatgatatgtcatttgtcagcagcgtagcgaa
A0A8C7XY96_BCL2L10      ---------------agc---------------ctcaggaaggtgatgga
A0A8C7YJI1_BCL2L1-      gccacggcctaccagagc---------------ttcgagaacgtgatgaa
A0A8C7ZK61_BCL2-01      accacggcgaagacgagg---------------ttcgccgaggtgattga
                                                          **      **     *

A0A8C7XSQ2_BCL2L1-      tgagctgttcaaggatg---ggatcaactgggggcgcgttgtgggtttgt
A0A8C7XSQ2_BCL2L1-      tgagctgttcaaggatg---ggatcaactgggggcgcgttgtgggtttgt
A0A8C7X109_MCL1-01      gagcctttttgcggatgggaccaccaactggggccgcatcgtcagcctgc
A0A8C7XY96_BCL2L10      ggagctggtgggagatgaacgcttgaactgggggagggtcgtttcccttt
A0A8C7YJI1_BCL2L1-      cgagctgttccgcgaca---acatcaactggggccgcatcgtggggctct
A0A8C7ZK61_BCL2-01      cgaactgttccgggacg---gcgtgaactggggccggattatcgcgttct
                            **  *    **          ********  *  *  *     *  

A0A8C7XSQ2_BCL2L1-      ttgtctttggtggggcgct-gtgtgtcgagtgtgta---gagaggaatat
A0A8C7XSQ2_BCL2L1-      ttgtctttggtggggcgct-gtgtgtcgagtgtgta---gagaggaatat
A0A8C7X109_MCL1-01      tggccttcggggcggcggt-gtgtcaggacttgaag---gaaaagggcag
A0A8C7XY96_BCL2L10      ttgcatttgtgggagtgctagcgcggcagctgagggagcaaaca-gacat
A0A8C7YJI1_BCL2L1-      tcgcattcggcggggcgct-gtgcgtggagtgcg---ttgagaaggagat
A0A8C7ZK61_BCL2-01      tcgagttcgggggcacggt-gtgcgtggagtgcgcgtccaacgaggagat
                        * *  ** *  *    * * * *       *         *       * 

A0A8C7XSQ2_BCL2L1-      gggtgagctggtctccc--------gcattgctgaatgg-----------
A0A8C7XSQ2_BCL2L1-      gggtgagctggtctccc--------gcattgctgaatgg-----------
A0A8C7X109_MCL1-01      aggtcactgcgtggacc--------tggtcagtcaggag-----------
A0A8C7XY96_BCL2L10      gaacccggggctggaccccgggcgggaagtggcgggcgggcctgtgagct
A0A8C7YJI1_BCL2L1-      gagccccctggtggacc--------ggattgtggagtgg-----------
A0A8C7ZK61_BCL2-01      gagcacgcaggtggcca--------gcatcgccgagtgg-----------
                                   *   *                      *           

A0A8C7XSQ2_BCL2L1-      --------------------atgacccagtacctggatgagcaaataagt
A0A8C7XSQ2_BCL2L1-      --------------------atgacccagtacctggatgagcaaataagt
A0A8C7X109_MCL1-01      --------------------atctgcacgtacctgctgagtgagcagcga
A0A8C7XY96_BCL2L10      gccaggcgctggcagaaactgtagctgatttcctgggaggagacaagaaa
A0A8C7YJI1_BCL2L1-      --------------------atgaccgtctacctggacaaccacatccag
A0A8C7ZK61_BCL2-01      --------------------atgacggagtatttaaacggacctctcaac
                                             *       *   *                

A0A8C7XSQ2_BCL2L1-      ccatggatccacagtcatggaggatgggattgctttgcacggctgta---
A0A8C7XSQ2_BCL2L1-      ccatggatccacagtcatggaggatgggattgctttgcacggctgta---
A0A8C7X109_MCL1-01      aactggctggtcaacaacaactcctgggatggtttcgtagagttctttcg
A0A8C7XY96_BCL2L10      gagtggatgctagaaaatgatggatgggaaggcttctgtaagttctc---
A0A8C7YJI1_BCL2L1-      ccctggatccagagccaaggcggatgggagcgttttgctgaaatctt---
A0A8C7ZK61_BCL2-01      agctggattgaagaaaacgggggatgggatgcctttgtggagctgta---
                           *** *        *       *****    **        * *    

A0A8C7XSQ2_BCL2L1-      tg------gccagaacggcg----ccgcagaagcga-------ggcgatt
A0A8C7XSQ2_BCL2L1-      tg------gccagaacggcg----ccgcagaagcga-------ggcgatt
A0A8C7X109_MCL1-01      cgtttcagacccagaaacta----cagtcaggaacactttggtggccttc
A0A8C7XY96_BCL2L10      cagaaca-gccagagaggtg-----agtcaggact----------cgtcc
A0A8C7YJI1_BCL2L1-      tg------ggcaggaagccg----cggctgagagca-------gaaggtc
A0A8C7ZK61_BCL2-01      cgacagacagaaggaaaccgtcttcagctgctactg-------gccgtcc
                                                  *                       

A0A8C7XSQ2_BCL2L1-      tcaagagacgctg--aagaagtggatgctggtcacagtggcccttttaac
A0A8C7XSQ2_BCL2L1-      tcaagagacgctg--aagaagtggatgctggtcacagtggcccttttaac
A0A8C7X109_MCL1-01      cttggaattgctggcgttggggctttactggcccagcttaatatgatggc
A0A8C7XY96_BCL2L10      atgaagactg---------------cgctcttcg---------cggcggc
A0A8C7YJI1_BCL2L1-      -tcaggagag-cttcaagaagtggctgctggtggggatgacggtggcgac
A0A8C7ZK61_BCL2-01      atcaagactgtcttc--ggcctggctgctctcgg----------ggcggc
                                 *                 **                    *

A0A8C7XSQ2_BCL2L1-      cggact---gctgctgggt--gtgctcatcaccaaga----aacg---gt
A0A8C7XSQ2_BCL2L1-      cggact---gctgctgggt--gtgctcatcaccaaga----aacg---gt
A0A8C7X109_MCL1-01      ---ctt---ttttaaaggacttcctgcttctgccagacttcacaactcga
A0A8C7XY96_BCL2L10      cagcgtcggcctggctgga--ctcaccttcctcctgg----tgcgctag-
A0A8C7YJI1_BCL2L1-      cggcgt---cctggtggga--tccttcctcgcccaga----aacgcctgt
A0A8C7ZK61_BCL2-01      gagcct---gaccattgga--gcataccttgcacaaa----a------gt
                             *          **        * *                   * 

A0A8C7XSQ2_BCL2L1-      ga---
A0A8C7XSQ2_BCL2L1-      ga---
A0A8C7X109_MCL1-01      gatag
A0A8C7XY96_BCL2L10      -----
A0A8C7YJI1_BCL2L1-      ga---
A0A8C7ZK61_BCL2-01      ga---
                             

© 1998-2023Legal notice