Dataset for CDS BCL2L1 of organism Pan paniscus

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A2R8Z9D7_BCL2L1-      atgtctcagagcaaccgggagctggtggttgactttctctcctacaagct
A0A2R8Z9D7_BCL2L1-      --------------------------------------------------
                                                                          

A0A2R8Z9D7_BCL2L1-      ttcccagaaaggatacagctggagtcagtttagtgatgtggaagagaaca
A0A2R8Z9D7_BCL2L1-      -----------------------------------atgtggaagagaaca
                                                           ***************

A0A2R8Z9D7_BCL2L1-      ggactgaggccccagaagggactgaatcggagatggagacccccagtgcc
A0A2R8Z9D7_BCL2L1-      ggactgaggccccagaagggactgaatcggagatggagacccccagtgcc
                        **************************************************

A0A2R8Z9D7_BCL2L1-      atcaatggcaacccatcctggcacctggcggacagccccgcggtgaatgg
A0A2R8Z9D7_BCL2L1-      atcaatggcaacccatcct-------------------------------
                        *******************                               

A0A2R8Z9D7_BCL2L1-      agccactggccacagcagcagtttggatgcccgggaggtgatccccatgg
A0A2R8Z9D7_BCL2L1-      --------------------------------------------------
                                                                          

A0A2R8Z9D7_BCL2L1-      cagcagtaaagcaagcgctgagggaggcaggcgacgagtttgaactgcgg
A0A2R8Z9D7_BCL2L1-      --------------------------------------------------
                                                                          

A0A2R8Z9D7_BCL2L1-      taccggcgggcattcagtgacctgacatcccagctccacatcaccccagg
A0A2R8Z9D7_BCL2L1-      ------------------------------------------------gg
                                                                        **

A0A2R8Z9D7_BCL2L1-      gacagcatatcagagctttgaacaggtagtgaatgaactcttccgggatg
A0A2R8Z9D7_BCL2L1-      gacagcatatcagagctttgaacaggtagtgaatgaactcttccgggatg
                        **************************************************

A0A2R8Z9D7_BCL2L1-      gggtaaactggggtcgcattgtggcctttttctccttcggcggggcactg
A0A2R8Z9D7_BCL2L1-      gggtaaactggggtcgcattgtggcctttttctccttcggcggggcactg
                        **************************************************

A0A2R8Z9D7_BCL2L1-      tgcgtggaaagcgtagacaaggagatgcaggtattggtgagtcggatcgc
A0A2R8Z9D7_BCL2L1-      tgcgtggaaagcgtagacaaggagatgcaggtattggtgagtcggatcgc
                        **************************************************

A0A2R8Z9D7_BCL2L1-      agcttggatggccacttacctgaatgaccacctagagccttggatccagg
A0A2R8Z9D7_BCL2L1-      agcttggatggccacttacctgaatgaccacctagagccttggatccagg
                        **************************************************

A0A2R8Z9D7_BCL2L1-      agaacggcggctgggatacttttgtggaactctatgggaacaatgcagca
A0A2R8Z9D7_BCL2L1-      agaacggcggctgggatacttttgtggaactctatgggaacaatgcagca
                        **************************************************

A0A2R8Z9D7_BCL2L1-      gccgagagccgaaagggccaggaacgcttcaaccgctggttcctgacggg
A0A2R8Z9D7_BCL2L1-      gccgagagccgaaagggccaggaacgcttcaaccgctggttcctgacggg
                        **************************************************

A0A2R8Z9D7_BCL2L1-      catgactgtggccggcgtggttctgctgggctcactcttcagtcggaaat
A0A2R8Z9D7_BCL2L1-      catgactgtggccggcgtggttctgctgggctcactcttcagtcggaaat
                        **************************************************

A0A2R8Z9D7_BCL2L1-      ga
A0A2R8Z9D7_BCL2L1-      ga
                        **

© 1998-2022Legal notice