Dataset for CDS BCL2L1 of organism Sarcophilus harrisii

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A7N4P3X2_BCL2L1-      atgtc-----------------------tcacagtaaccgggagctggtg
A0A7N4P3X2_BCL2L1-      atgccagaaccagcatttttgcccaggatttcagaa---gagagctgtca
                        *** *                       *  *** *   * ******   

A0A7N4P3X2_BCL2L1-      gttgactttctttcttaca----agctttcacagaagggatacaattgga
A0A7N4P3X2_BCL2L1-      agcagatcccagactcagagagcagctttcacagaagggatacaattgga
                              *  *   ** * *    ***************************

A0A7N4P3X2_BCL2L1-      gtcagtttgaagatgagaacaggactgaggcctcagaagggacagagata
A0A7N4P3X2_BCL2L1-      gtcagtttgaagatgagaacaggactgaggcctcagaagggacagagata

A0A7N4P3X2_BCL2L1-      cctagtactgtgaatggcagcccctcttggcaccctgctgacagccgtgc
A0A7N4P3X2_BCL2L1-      cctagtactgtgaatggcagcccctcttggcaccctgctgacagccgtgc

A0A7N4P3X2_BCL2L1-      agtgagtggggccacaggacacagcagcagcctggatgcccatgagacaa
A0A7N4P3X2_BCL2L1-      agtgagtggggccacaggacacagcagcagcctggatgcccatgagacaa

A0A7N4P3X2_BCL2L1-      ttcctgtagctgctgtgaagcaagctttgagggaggcaggagatgaattt
A0A7N4P3X2_BCL2L1-      ttcctgtagctgctgtgaagcaagctttgagggaggcaggagatgaattt

A0A7N4P3X2_BCL2L1-      gaactccggtaccggcgggcattcagtgatctgacatcccagctccacat
A0A7N4P3X2_BCL2L1-      gaactccggtaccggcgggcattcagtgatctgacatcccagctccacat

A0A7N4P3X2_BCL2L1-      cactccagggacggcttatcagagttttgagcaggtagtgaatgaactct
A0A7N4P3X2_BCL2L1-      cactccagggacggcttatcagagttttgagcaggtagtgaatgaactct

A0A7N4P3X2_BCL2L1-      tccgggatggggtgaactggggccgaattgtggcattcttctccttcgga
A0A7N4P3X2_BCL2L1-      tccgggatggggtgaactggggccgaattgtggcattcttctccttcgga

A0A7N4P3X2_BCL2L1-      ggggcattgtgtgtggaaagcgtggataaagagatggaagtcttggtagc
A0A7N4P3X2_BCL2L1-      ggggcattgtgtgtggaaagcgtggataaagagatggaagtcttggtagc

A0A7N4P3X2_BCL2L1-      acgcatcacctcctggatggccacttacttggatgagcacctagacccat
A0A7N4P3X2_BCL2L1-      acgcatcacctcctggatggccacttacttggatgagcacctagacccat

A0A7N4P3X2_BCL2L1-      ggatccaagaaaatggcggttgggacaccttcgtggagctttatgggaat
A0A7N4P3X2_BCL2L1-      ggatccaagaaaatggcggttgggacaccttcgtggagctttatgggaat

A0A7N4P3X2_BCL2L1-      gatgcagcagcagagagccggaagggccaggaacgcttcaacagatggct
A0A7N4P3X2_BCL2L1-      gatgcagcagcagagagccggaagggccaggaacgcttcaacagatggct

A0A7N4P3X2_BCL2L1-      gctgactggcatgacagtggctggtgtagtcctgctggggtccctgttca
A0A7N4P3X2_BCL2L1-      gctgactggcatgacagtggctggtgtagtcctgctggggtccctgttca

A0A7N4P3X2_BCL2L1-      gccggaagtga
A0A7N4P3X2_BCL2L1-      gccggaagtga

© 1998-2022Legal notice