Dataset for CDS BCL2L1 of organism Sarcophilus harrisii

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


G3WKX6_BCL2L1-01      atgtc-----------------------tcacagtaaccgggagctggtg
G3WKX6_BCL2L1-02      atgccagaaccagcatttttgcccaggatttcagaa---gagagctgtca
                      *** *                       *  *** *   * ******   

G3WKX6_BCL2L1-01      gttgactttctttcttaca----agctttcacagaagggatacaattgga
G3WKX6_BCL2L1-02      agcagatcccagactcagagagcagctttcacagaagggatacaattgga
                            *  *   ** * *    ***************************

G3WKX6_BCL2L1-01      gtcagtttgaagatgagaacaggactgaggcctcagaagggacagagata
G3WKX6_BCL2L1-02      gtcagtttgaagatgagaacaggactgaggcctcagaagggacagagata
                      **************************************************

G3WKX6_BCL2L1-01      cctagtactgtgaatggcagcccctcttggcaccctgctgacagccgtgc
G3WKX6_BCL2L1-02      cctagtactgtgaatggcagcccctcttggcaccctgctgacagccgtgc
                      **************************************************

G3WKX6_BCL2L1-01      agtgagtggggccacaggacacagcagcagcctggatgcccatgagacaa
G3WKX6_BCL2L1-02      agtgagtggggccacaggacacagcagcagcctggatgcccatgagacaa
                      **************************************************

G3WKX6_BCL2L1-01      ttcctgtagctgctgtgaagcaagctttgagggaggcaggagatgaattt
G3WKX6_BCL2L1-02      ttcctgtagctgctgtgaagcaagctttgagggaggcaggagatgaattt
                      **************************************************

G3WKX6_BCL2L1-01      gaactccggtaccggcgggcattcagtgatctgacatcccagctccacat
G3WKX6_BCL2L1-02      gaactccggtaccggcgggcattcagtgatctgacatcccagctccacat
                      **************************************************

G3WKX6_BCL2L1-01      cactccagggacggcttatcagagttttgagcaggtagtgaatgaactct
G3WKX6_BCL2L1-02      cactccagggacggcttatcagagttttgagcaggtagtgaatgaactct
                      **************************************************

G3WKX6_BCL2L1-01      tccgggatggggtgaactggggccgaattgtggcattcttctccttcgga
G3WKX6_BCL2L1-02      tccgggatggggtgaactggggccgaattgtggcattcttctccttcgga
                      **************************************************

G3WKX6_BCL2L1-01      ggggcattgtgtgtggaaagcgtggataaagagatggaagtcttggtagc
G3WKX6_BCL2L1-02      ggggcattgtgtgtggaaagcgtggataaagagatggaagtcttggtagc
                      **************************************************

G3WKX6_BCL2L1-01      acgcatcacctcctggatggccacttacttggatgagcacctagacccat
G3WKX6_BCL2L1-02      acgcatcacctcctggatggccacttacttggatgagcacctagacccat
                      **************************************************

G3WKX6_BCL2L1-01      ggatccaagaaaatggcggttgggacaccttcgtggagctttatgggaat
G3WKX6_BCL2L1-02      ggatccaagaaaatggcggttgggacaccttcgtggagctttatgggaat
                      **************************************************

G3WKX6_BCL2L1-01      gatgcagcagcagagagccggaagggccaggaacgcttcaacagatggct
G3WKX6_BCL2L1-02      gatgcagcagcagagagccggaagggccaggaacgcttcaacagatggct
                      **************************************************

G3WKX6_BCL2L1-01      gctgactggcatgacagtggctggtgtagtcctgctggggtccctgttca
G3WKX6_BCL2L1-02      gctgactggcatgacagtggctggtgtagtcctgctggggtccctgttca
                      **************************************************

G3WKX6_BCL2L1-01      gccggaagtga
G3WKX6_BCL2L1-02      gccggaagtga
                      ***********

© 1998-2021Legal notice