Dataset for CDS BCL2L2 of organism Oryctolagus cuniculus

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|G1TV33_BCL2L2-01 BCL2-like 2 gene OS=[Eukaryota] Oryctolagus cuniculus GN=BCL2L2 (length=582 residues).
atggcgaccccagcctcagccccagacacacgggctctggtggccgactttgtaggctacaagctgaggcagaagggtta
tgtctgtggggctggccctggagagggcccggcagctaacccgctgcaccaagccatgcgggcagccggagatgagttcg
agacccgcttccggcaaaacttctccgacctggccgctcagttgcatgtgaccccaggctcagcacagcagagcttcacc
caggtctgcgatgaacttttccaaaggggtcccaactggggccgcgtggtggccttctttgcctttggggccgcactgtg
tgctgagagcgtcaacaaggagatggagcccctggtgggacaagtgcaggagtggatggtgacctacctggagacgcagc
tggccggctggatccacagcaccgggggctgggcggagttcacagctctgtacggggatcgggccctggaggaggcgcgg
cgtctgcgggaggggacctgggcgtcagtgaggacagtgctgacgggggccgtggcactgggggccctggtaactgtagg
ggccttttttgctagcaaatga
© 1998-2020Legal notice