Dataset for CDS Unclassified of organism Sphaeramia orbicularis

[Download (right click)]

7 sequence(s)

>gnl|bcl2dbcds|A0A672Z148_uncBCL2L1-01 Putative BCL2-like 1 gene OS=[Eukaryota] Sphaeramia orbicularis (length=414 residues).
atgaccattgttgcaaaatcattcgcaatttatatgttaaatgttcaggttctgtatgtaacaccagtggacacgatgct
cgacatcactcctgacactgcctaccaaagctttaaaagtgtcatggatgaggtgttcaaggacggggtcaactgggggc
tcctttgtgtggaatgtgctgagaagggacatgatgagctggttcctcggatcgccgactggatgaccacgtacctggat
gagcacatcagcccatggttgagagcgcaggaggacagcttcgttgagattttggacaaaagcgcagctgccgaagcacg
gaggtctggggagacgctgaagcgatggctgctggtcggagtggtgttgttaactggagtgctgatcggtgtgctcgttg
ctaaaaaacagtaa
>gnl|bcl2dbcds|A0A673BH98_uncBCL2-01 Putative B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Sphaeramia orbicularis (length=669 residues).
atgtctgcctcctacaacagccgccacatggtggaggattacctccgatacaagctgctgcagaagggcgtggcctggag
actcccatcaccacggcgaccggccgaggccttatcgcttgagcggacgagcgtgttgcatcgcggaggtgccacggcaa
ccacagaagaagaagaaggtgaagaagaacgtgtccggcgagatccccatttggctccgcccaggctgcaggtcgtcctg
cgttgtgccggtgatgagctggagcgttgttaccgtgacgacctgtcggcccaggtttcggcgctgatgccgcacgacgg
cggctcagtgcgcaggaacctggcggcggttcgggaggaggtgttcagggacggcgtcaactggggacgcatcgtggccc
tgatggaactgggcggagctgtgagcgccgagctggccagaaggggcggggccagtcaggtggatgacgtcgcaggttgg
atggaggagagtctggactcgccgacgctgcggggatggatcgaagacaacggaggatggaatgcctttgtggacctgta
cggggactccagacctgaggctggcctctggtctctgaggaccgtctgtggactggttttactgggagcagctgggatca
cactgggagctctgttcacccaccagtaa
>gnl|bcl2dbcds|A0A673CRQ7_uncBCL2-01 Putative B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Sphaeramia orbicularis (length=684 residues).
atggagtataatcgcaatattgtggaaaagtatatctgccataaactctccaaacggggttacgcgtggggttttcacga
cgtccgggatgaagatgctgctaataatgggtcaatagttgccccttctccgactttggtgcgccggtgccgtgaagcca
acaccgggcctgacaccgacagcatccccccactcctgtgcaagcggctcccccagtctgacccccacgcagacatccac
agagtcctgcgtgaggctggggatgaacttgaaagactgtatcaaccagacttcacggagatgtctcgtcagctgtatct
gagctccaccacggcgcagaggagattcgccgaggtgatagacgaactgttccgggacggggtgaactgggggcgcatta
tcgcttttttcgagttcgggggcaccgtgtgcgtggaatgcgcagccaaggaggatatgacatcgcaggtagacaacatc
gcggagtggatgacggagtatttaaatggacctcttaacagctggatacaagacaacgggggatgggatgcctttgtgga
gctgtatgacagacagagggactccgtcttctcttgctcctggccttccatcaagacggtcttcggtctggcagcgctcg
gagccgcgagcctcaccatcggagcgtaccttacacagaagtga
>gnl|bcl2dbcds|A0A673CRQ7_uncBCL2-02 Putative B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Sphaeramia orbicularis (length=1017 residues).
atgctccttgtagttgctgccttcattgttgcctttgtgttgctgttatacatgatatcacctcttattagccccaagcc
tctgaaactgaacggggcccatgtcgtggtgacaggaggatcaagtgggattggaaaatgcattgctattgagtgctatc
ggcaaggagctttcatcactttagttgcacgagatgaggctaaattgcttcaagcaaagaaagaagtggagaagtttgcc
atcaatgacaaacaggtggtgctctgcatatcagtggatgtttccagtgattacagtcaagtggaaagtgtgataaaaca
ggctcaagagaaattggggcctgttgatatgctcgtgaactgtgctggaacatccatttctgggaagtttgaggaagtag
aggtggatcgttttaaaaaattgatggaagtgaactatctgggcagtgtttatcctaccagggctgtcataaccacaatg
aaggaacgaagaatgggccgcatcatgttcgtgtcctctcaagcaggtcagatcggcctgtttggatacactgcttactc
cccttccaagtttgccctgcgtggtctagcagaatcactgcagatggagataaagccatacaatatctacgtgactgtcg
cctacccccctgacacagacaccccaggactggctgaggagaacaagacaaagcctctggaaaccaaattaatctctgag
acctctggagtttgtcaaccggaccaagtggctaaaattattgttcgggatgcagtgcaggggaactttaacagctctgt
cggtcctgatggctacatgttatcagccctcacttgtgggatgtcacctgtcacttccatcacagaaggtctccagcagg
atgcctttgtggagctgtatgacagacagagggactccgtcttctcttgctcctggccttccatcaagacggtcttcggt
ctggcagcgctcggagccgcgagcctcaccatcggagcgtaccttacacagaagtga
>gnl|bcl2dbcds|A0A673CRQ7_uncBCL2-03 Putative B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Sphaeramia orbicularis (length=1080 residues).
atgtcctctgaagaagcgttgagttcaacgattacggattggctctttatcaattcctggtggcttcttttgccattcat
catgctccttgtagttgctgccttcattgttgcctttgtgttgctgttatacatgatatcacctcttattagccccaagc
ctctgaaactgaacggggcccatgtcgtggtgacaggaggatcaagtgggattggaaaatgcattgctattgagtgctat
cggcaaggagctttcatcactttagttgcacgagatgaggctaaattgcttcaagcaaagaaagaagtggagaagtttgc
catcaatgacaaacaggtggtgctctgcatatcagtggatgtttccagtgattacagtcaagtggaaagtgtgataaaac
aggctcaagagaaattggggcctgttgatatgctcgtgaactgtgctggaacatccatttctgggaagtttgaggaagta
gaggtggatcgttttaaaaaattgatggaagtgaactatctgggcagtgtttatcctaccagggctgtcataaccacaat
gaaggaacgaagaatgggccgcatcatgttcgtgtcctctcaagcaggtcagatcggcctgtttggatacactgcttact
ccccttccaagtttgccctgcgtggtctagcagaatcactgcagatggagataaagccatacaatatctacgtgactgtc
gcctacccccctgacacagacaccccaggactggctgaggagaacaagacaaagcctctggaaaccaaattaatctctga
gacctctggagtttgtcaaccggaccaagtggctaaaattattgttcgggatgcagtgcaggggaactttaacagctctg
tcggtcctgatggctacatgttatcagccctcacttgtgggatgtcacctgtcacttccatcacagaaggtctccagcag
attgttacaatgggtttattccgaaccattgccctcttctacctggggagtttcgacagcatcgtgcggcgctgcatgat
tcaaagagagcagtcaaaagcagcagacaagagggagtaa
>gnl|bcl2dbcds|A0A673CRQ7_uncBCL2-04 Putative B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Sphaeramia orbicularis (length=894 residues).
atgctccttgtagttgctgccttcattgttgcctttgtgttgctgttatacatgatatcacctcttattagccccaagcc
tctgaaactgaacggggcccatgtcgtggtgacaggaggatcaagtgggattggaaaatgcattgctattgagtgctatc
ggcaaggagctttcatcactttagttgcacgagatgaggctaaattgcttcaagcaaagaaagaagtggagaagtttgcc
atcaatgacaaacaggtggtgctctgcatatcagtggatgtttccagtgattacagtcaagtggaaagtgtgataaaaca
ggctcaagagaaattggggcctgttgatatgctcgtgaactgtgctggaacatccatttctgggaagtttgaggaagtag
aggtggatcgttttaaaaaattgatggaagtgaactatctgggcagtgtttatcctaccagggctgtcataaccacaatg
aaggaacgaagaatgggccgcatcatgttcgtgtcctctcaagcaggtcagatcggcctgtttggatacactgcttactc
cccttccaagtttgccctgcgtggtctagcagaatcactgcagatggagataaagccatacaatatctacgtgactgtcg
cctacccccctgacacagacaccccaggactggctgaggagaacaagacaaagcctctggaaaccaaattaatctctgag
acctctggagtttgtcaaccggaccaagtggctaaaattattgttcgggatgcaattgttacaatgggtttattccgaac
cattgccctcttctacctggggagtttcgacagcatcgtgcggcgctgcatgattcaaagagagcagtcaaaagcagcag
acaagagggagtaa
>gnl|bcl2dbcds|A0A673CRQ7_uncBCL2-05 Putative B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Sphaeramia orbicularis (length=561 residues).
atgtcctctgaagaagcgttgagttcaacgattacggattggctctttatcaattcctggtggcttcttttgccattcat
catgctccttgtagttgctgccttcattgttgcctttgtgttgctgttatacatgatatcacctcttattagccccaagc
ctctgaaactgaacggggcccatgtcgtggtgacaggaggatcaagtgggattggaaaatgcattgctattgagtgctat
cggcaaggagctttcatcactttagttgcacgagatgaggtggtgctctgcatatcagtggatgtttccagtgattacag
tcaagtggaaagtgtgataaaacaggctcaagagaaattggggcctgttgatatgctcgtgaactgtgctggaacatcca
tttctgggaagtttgaggaagtagaggtggatcgttttaaaattgttacaatgggtttattccgaaccattgccctcttc
tacctggggagtttcgacagcatcgtgcggcgctgcatgattcaaagagagcagtcaaaagcagcagacaagagggagta
a
© 1998-2020Legal notice