Dataset for CDS Unclassified of Organism Cyprinus carpio

[Download (right click)]

9 sequence(s)

>gnl|bcl2dbcds|A0A8C1JIJ5_uncBAX-01 Putative BCL2-associated X gene OS=[Eukaryota] Cyprinus carpio (length=780 residues).
atggcttgcgaagcctcgctggatgaccagattggagaagcactcttaatcggggtggtaagacacaaggtgatgagcgc
agcagccaaagtgcattcagccccaccagcccttcctgaagctcgaccaataagcaactgccaggaccaaaagcttgttg
aacagttggcggagaccatcaaagtgattggtgataggctcaatcaggataaatcattcaatgacatgattgatggctta
gtaaaagtggctgataaaagaagtttctgggaacttgtggaaaaggttttcacagatggccagatcaactgggggagaat
tatagtgctgttctattcagttggaaaactgtctgcaaagatggtccttgcatgcttacccacaattgtttcagatattt
tgatcttaagtctggattacttcaggaggaatctgttggaatggatttgcaaaatgggaggatgggtaagaaacaatgaa
gacacatttttacatcatctcagatactggaatatgaagcagtatctgagttttgttttaatctcgtcagaagatgtgtt
gagcagtattgatcacaatgtcatatctatgacatctccttcgtttttttaccccttaacacagatgcacagtatccctg
cgctggcctgtttctcctttgagcaattttccagttcttcacttagtaaatattcttcctatttcggagccacattggcc
ttcactggtggcctactgctaggtggcttcatcgtcttgaaatttccaagaaaaagctaa
>gnl|bcl2dbcds|A0A8C1JIJ5_uncBAX-02 Putative BCL2-associated X gene OS=[Eukaryota] Cyprinus carpio (length=621 residues).
atggcttgcgaagcctcgctggatgaccagattggagaagcactcttaatcggggtggtaagacacaaggtgatgagcgc
agcagccaaagtgcattcagccccaccagcccttcctgaagctcgaccaataagcaactgccaggaccaaaagcttgttg
aacagttggcggagaccatcaaagtgattggtgataggctcaatcaggataaatcattcaatgacatgattgatggctta
gtaaaagtggctgataaaagaagtttctgggaacttgtggaaaaggttttcacagatggccagatcaactgggggagaat
tatagtgctgttctattcagttggaaaactgtctgcaaagatggtccttgcatgcttacccacaattgtttcagatattt
tgatcttaagtctggattacttcaggaggaatctgttggaatggatttgcaaaatgggaggatggatgcacagtatccct
gcgctggcctgtttctcctttgagcaattttccagttcttcacttagtaaatattcttcctatttcggagccacattggc
cttcactggtggcctactgctaggtggcttcatcgtcttgaaatttccaagaaaaagctaa
>gnl|bcl2dbcds|A0A8C1JIJ5_uncBAX-03 Putative BCL2-associated X gene OS=[Eukaryota] Cyprinus carpio (length=573 residues).
gatttggtggtaagacacaaggtgatgagcgcagcagccaaagtgcattcagccccaccagcccttcctgaagctcgacc
aataagcaactgccaggaccaaaagcttgttgaacagttggcggagaccatcaaagtgattggtgataggctcaatcagg
ataaatcattcaatgacatgattgatggcttagtaaaagtggctgataaaagaagtttctgggaacttgtggaaaaggtt
ttcacagatggccagatcaactgggggagaattatagtgctgttctattcagttggaaaactgtctgcaaagatggtcct
tgcatgcttacccacaattgtttcagatattttgatcttaagtctggattacttcaggaggaatctgttggaatggattt
gcaaaatgggaggatggatgcacagtatccctgcgctggcctgtttctcctttgagcaattttccagttcttcacttagt
aaatattcttcctatttcggagccacattggccttcactggtggcctactgctaggtggcttcatcgtcttgaaatttcc
aagaaaaagctaa
>gnl|bcl2dbcds|A0A8C1KS78_uncBAX-01 Putative BCL2-associated X gene OS=[Eukaryota] Cyprinus carpio (length=615 residues).
atggcttgcgaagtctcgcaggatgaccagattggagaagcactcttaatcaggctggtaagagatgaggtgatgaacgt
agcagatgaggatgcagccccaccagcccttcccgaagttcgtccaataaacaacagccaagaccagaagcttgttgaac
agctggcagagaccatcaaagtgattggtgatagactcaataaggataaagcattcaatgacatgattgatggcttagta
aaagtggctgataagagaagtttctgggaacttgtgaaaaaagttttcacaaatggccagatcaactgggggagaattat
agtgctgttctattcagttggaaaactgtctgcaaagatggtccttgcacacttacccaaaattgtttcagacattttga
ccttatgtctggattacttcaggaggactctgttggaatggattcgcaaaatgggaggatggatgcacagtattcctgcg
ctggcctgtttctcctttgagcaattttctggttcttcacttagtaaatattcttcctattttgtagccttattggcctt
cactggtggcctactgctaggtggcttcatcgtctcaaaattagctaagaaatag
>gnl|bcl2dbcds|A0A8C1KS78_uncBAX-02 Putative BCL2-associated X gene OS=[Eukaryota] Cyprinus carpio (length=696 residues).
atgtcatttgaggaaagtcataatgaaattattaatgttaaaattttcatgtttattggaggtaattgtgaatctgttct
agtatctctaagaacatttgactcatatgcagttaacaaaaaaatgtctttcaggctggtaagagatgaggtgatgaacg
tagcagatgaggatgcagccccaccagcccttcccgaagttcgtccaataaacaacagccaagaccagaagcttgttgaa
cagctggcagagaccatcaaagtgattggtgatagactcaataaggataaagcattcaatgacatgattgatggcttagt
aaaagtggctgataagagaagtttctgggaacttgtgaaaaaagttttcacaaatggccagatcaactgggggagaatta
tagtgctgttctattcagttggaaaactgtctgcaaagatggtccttgcacacttacccaaaattgtttcagacattttg
accttatgtctggattacttcaggaggactctgttggaatggattcgcaaaatgggaggatggatgcacagtattcctgc
gctggcctgtttctcctttgagcaattttctggttcttcacttagtaaatattcttcctattttgtagccttattggcct
tcactggtggcctactgctaggtggcttcatcgtctcaaaattagctaagaaatag
>gnl|bcl2dbcds|A0A8C1KS88_uncBAX-01 Putative BCL2-associated X gene OS=[Eukaryota] Cyprinus carpio (length=669 residues).
atggcttgcaaaggctcccgggatgatctgattggagaaaaacttttaatcgacatggtaacaagcaaggtgaaatatgt
gacagacaaagtaaaggcaatccttccagcccttcctgagtctccgctaataagcaaaggtcaggaccagatgcttgttc
agcagttgtcggagatcatcaaagtttatggcgacaacattgatcaggataaagaatttaatgacataattgatgacttg
gcaaaggtagctgatacaagcagttttttaaaacttgtgaaaaaggttttcacagacgaccagatcacctgggggagaat
tatagtactgttctattcggttggaaagctgtctgcaaagatggttctcatacacacacacagtgttgtttcagctcttc
tgaacgcaagtttggattactttaggaagcatctgttagaatggatttgcaaaaagggaggatgggtaagaaacattttt
tcattattgtctcaaaaactggaatatgaaaaagctttgggcatttttatgttgttcttatatgttttgaacggtactga
tcatatcacatctgtaacacatttgtttgtaccctctgatacagatgagcagtatccctgcactggcctgtttctccata
gggatattttctggttctataaaaagtaa
>gnl|bcl2dbcds|A0A8C1KS88_uncBAX-02 Putative BCL2-associated X gene OS=[Eukaryota] Cyprinus carpio (length=699 residues).
atgatggctgtagtcagaatctgcaagctctttcatatcatgagtacctctataaacatttttaatatttgtctgtcttt
tagcatggtaacaagcaaggtgaaatatgtgacagacaaagtaaaggcaatccttccagcccttcctgagtctccgctaa
taagcaaaggtcaggaccagatgcttgttcagcagttgtcggagatcatcaaagtttatggcgacaacattgatcaggat
aaagaatttaatgacataattgatgacttggcaaaggtagctgatacaagcagttttttaaaacttgtgaaaaaggtttt
cacagacgaccagatcacctgggggagaattatagtactgttctattcggttggaaagctgtctgcaaagatggttctca
tacacacacacagtgttgtttcagctcttctgaacgcaagtttggattactttaggaagcatctgttagaatggatttgc
aaaaagggaggatgggtaagaaacattttttcattattgtctcaaaaactggaatatgaaaaagctttgggcatttttat
gttgttcttatatgttttgaacggtactgatcatatcacatctgtaacacatttgtttgtaccctctgatacagatgagc
agtatccctgcactggcctgtttctccatagggatattttctggttctataaaaagtaa
>gnl|bcl2dbcds|A0A8C1PXL4_uncBCLWAV-01 Putative BCL2 homolog found in water-living anamniote vertebrates gene OS=[Eukaryota] Cyprinus carpio (length=447 residues).
atgggactgtcagataaagctgtgattgcctatctgatgctaactagcttccccatcttctttcgccgctggctgcgtgt
tttccaggacgtgacggaccgaatggcctgctcgaccttcgtttccattctggatgaacactttgcacccacacgacata
gagagctagcctggagcgcagtgctgtctgtgtttgttctttctggacaactagcactgcactgccaggaaagtggcatg
tctgatatcctgccccagattcaggagtgcatgggcagctacgtagagagggtcatctgcccagagatcagggacagagg
aggatgggtaatcaggttttatcagtcgtttcggcgagaagatcatgtgatgagggtgtgctgctggtctctgctcctgc
tgagtgctgggatcttttacttggtgtggaagagaggaaaatcatag
>gnl|bcl2dbcds|A0A8C1QMS4_uncBAX-01 Putative BCL2-associated X gene OS=[Eukaryota] Cyprinus carpio (length=573 residues).
atggaatcagattaccagttttcagagaaacttgtacttcggtcagtgatggaccaggtacagagagcaggagcatgtgc
accgtctcttcctgaaccgcagacactgagtgctgagcgggagcagctcctggaccaggtggccaacgtgatcagagtca
tcggcgactctctcgatcgagagccgagattcaacgacatggttgatgggtttgcacgtgtggcggatagacagagtttc
cagatgcttgtagacaaagtgtttgttgatgacaccacctgggggaaaattgttactctgatctgtgttatttggaaatc
cattgcaaagattcttgctgattttgtctcaggcgttgtgtcttggacactggattacttcagggataacctacagaact
ggatctgcagtaggggaggatggatcaacagtatctcttccttggctcgttactcctttgagcaagattttggttcctcg
tccagcctgaactccctctcctgtggagtcttcttcatcagtggagtactgctgggtggcctcatcgtctggagactaaa
cagatgttcctga
© 1998-2023Legal notice