Dataset for CDS BCL2L2 of organism all

[Download (right click)] [Edit] [Sequences] [Repertoires]

191 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


H3AAS7_BCL2L2-02        --------------------------------------------------
H3AAS7_BCL2L2-01        --------------------------------------------------
Q6GP82_BCL2L2-01        --------------------------------------------------
A0A8C5PJB3_BCL2L2-      --------------------------------------------------
A0A4X2LP96_BCL2L2-      --------------------------------------------------
A0A5F8HG85_BCL2L2-      --------------------------------------------------
A0A5F8HG85_BCL2L2-      --------------------------------------------------
A0A5F8HG85_BCL2L2-      --------------------------------------------------
F7G6M3_BCL2L2-01        --------------------------------------------------
G1Q051_BCL2L2-01        --------------------------------------------------
G1TV33_BCL2L2-01        --------------------------------------------------
D3Z5F7_BCL2L2-01        --------------------------------------------------
G3V4B7_BCL2L2-10        --------------------------------------------------
A0A6I9LUT0_BCL2L2-      --------------------------------------------------
A0A8C3X592_BCL2L2-      --------------------------------------------------
A0A3Q9B4M8_BCL2L2-      --------------------------------------------------
A0A7T8CLX7_BCL2L2-      --------------------------------------------------
A0A8D0TJQ9_BCL2L2-      --------------------------------------------------
A0A4X1SF60_BCL2L2-      --------------------------------------------------
A0A4X1SF63_BCL2L2-      --------------------------------------------------
A0A8C0Q5E6_BCL2L2-      --------------------------------------------------
A0A8I3MNK9_BCL2L2-      --------------------------------------------------
A0A8I3RSU6_BCL2L2-      --------------------------------------------------
A0A673VAY7_BCL2L2-      --------------------------------------------------
A0A2I2UAE3_BCL2L2-      --------------------------------------------------
A0A8C8XCR9_BCL2L2-      --------------------------------------------------
A0A8C9J3S1_BCL2L2-      --------------------------------------------------
M3Y5X5_BCL2L2-01        --------------------------------------------------
A0A8C7EW82_BCL2L2-      --------------------------------------------------
A0A452SHI1_BCL2L2-      --------------------------------------------------
A0A384DPS8_BCL2L2-      --------------------------------------------------
A0A8C4LWK5_BCL2L2-      --------------------------------------------------
A0A8C6BK57_BCL2L2-      --------------------------------------------------
A0A8C9CXQ5_BCL2L2-      --------------------------------------------------
A0A8B8WSS7_BCL2L2-      --------------------------------------------------
W5QDH4_BCL2L2-02        --------------------------------------------------
A0A8C6CUC2_BCL2L2-      --------------------------------------------------
A0A452ECF0_BCL2L2-      --------------------------------------------------
A0A4W2D6A3_BCL2L2-      --------------------------------------------------
A0A4W2D6A3_BCL2L2-      --------------------------------------------------
A0A4W2GUJ7_BCL2L2-      atgggaacggttctcttttctgggcacccactccagggctggaagagttc
A0A4W2GUJ7_BCL2L2-      --------------------------------------------------
A0A8B9WT05_BCL2L2-      --------------------------------------------------
A0A4W2D6A3_BCL2L2-      --------------------------------------------------
A0A4W2D6A3_BCL2L2-      --------------------------------------------------
A0A4W2GUJ7_BCL2L2-      atgggaacggttctcttttctgggcacccactccagggctggaagagttc
A0A4W2GUJ7_BCL2L2-      --------------------------------------------------
Q05KI8_BCL2L2-01        --------------------------------------------------
A0A8C2VJ88_BCL2L2-      --------------------------------------------------
A0A286XQQ9_BCL2L2-      --------------------------------------------------
A0A8C2VJ88_BCL2L2-      --------------------------------------------------
A0A8D2APK0_BCL2L2-      --------------------------------------------------
A0A287D9B3_BCL2L2-      --------------------------------------------------
A0A8D2HGM1_BCL2L2-      --------------------------------------------------
A0A287D9B3_BCL2L2-      --------------------------------------------------
A0A8C9PGU3_BCL2L2-      --------------------------------------------------
W5QDH4_BCL2L2-01        --------------------------------------------------
A0A4W2GUJ7_BCL2L2-      --------------------------------------------------
A0A4W2GUJ7_BCL2L2-      --------------------------------------------------
A0A4W2D6A3_BCL2L2-      --------------------------------------------------
A0A4W2GUJ7_BCL2L2-      --------------------------------------------------
A0A4W2D6A3_BCL2L2-      --------------------------------------------------
A0A4W2GUJ7_BCL2L2-      --------------------------------------------------
A0A4W2GUJ7_BCL2L2-      --------------------------------------------------
A0A4W2GUJ7_BCL2L2-      --------------------------------------------------
A0A5F5PML6_BCL2L2-      --------------------------------------------------
A0A5F5PML6_BCL2L2-      --------------------------------------------------
A0A8C5L5C6_BCL2L2-      --------------------------------------------------
A0A8C0Q5E6_BCL2L2-      --------------------------------------------------
A0A8I3MNK9_BCL2L2-      --------------------------------------------------
A0A8I3RSU6_BCL2L2-      --------------------------------------------------
A0A8I3MNK9_BCL2L2-      --------------------------------------------------
A0A667I624_BCL2L2-      --------------------------------------------------
G1LKF5_BCL2L2-01        --------------------------------------------------
G1LKF5_BCL2L2-02        --------------------------------------------------
A0A384DPS8_BCL2L2-      --------------------------------------------------
A0A384DPS8_BCL2L2-      --------------------------------------------------
A0A8C6RJE0_BCL2L2-      --------------------------------------------------
A0A671DWB3_BCL2L2-      --------------------------------------------------
A0A250YBR2_BCL2L2-      --------------------------------------------------
A0A250YBR2_BCL2L2-      --------------------------------------------------
O88996_BCL2L2-01        --------------------------------------------------
Q7TS60_BCL2L2-01        --------------------------------------------------
A0A671DWB3_BCL2L2-      --------------------------------------------------
A0A8C6RJE0_BCL2L2-      --------------------------------------------------
A0A4W2D6A3_BCL2L2-      --------------------------------------------------
A0A4W2GUJ7_BCL2L2-      --------------------------------------------------
A0A4W2D6A3_BCL2L2-      --------------------------------------------------
A0A4W2GUJ7_BCL2L2-      --------------------------------------------------
A0A8C8YZD8_BCL2L2-      --------------------------------------------------
A0A8B7FJ73_BCL2L2-      --------------------------------------------------
A0A2K6GWM6_BCL2L2-      --------------------------------------------------
A0A8D0TJQ9_BCL2L2-      --------------------------------------------------
A0A482LX62_BCL2L2-      --------------------------------------------------
A0A4X1SF63_BCL2L2-      --------------------------------------------------
A0A4D6NWN1_BCL2L2-      --------------------------------------------------
A0A4X1SF60_BCL2L2-      --------------------------------------------------
A0A4X1SF63_BCL2L2-      --------------------------------------------------
A0A8D0TJQ9_BCL2L2-      --------------------------------------------------
A0A4X1SF60_BCL2L2-      --------------------------------------------------
A0A8D0TJQ9_BCL2L2-      --------------------------------------------------
H0XR82_BCL2L2-01        --------------------------------------------------
A0A4X1SF63_BCL2L2-      --------------------------------------------------
A0A4X1SF63_BCL2L2-      --------------------------------------------------
A0A8D0TJQ9_BCL2L2-      --------------------------------------------------
A0A8B7FJ73_BCL2L2-      --------------------------------------------------
A0A2K6GWM6_BCL2L2-      --------------------------------------------------
A0A5F5PML6_BCL2L2-      --------------------------------------------------
A0A8C8YZD8_BCL2L2-      --------------------------------------------------
A0A8B7FJ73_BCL2L2-      --------------------------------------------------
A0A8B7FJ73_BCL2L2-      --------------------------------------------------
A0A2K6GWM6_BCL2L2-      --------------------------------------------------
A0A2K6GWM6_BCL2L2-      --------------------------------------------------
A0A8C0Q5E6_BCL2L2-      --------------------------------------------------
A0A8I3MNK9_BCL2L2-      --------------------------------------------------
A0A8I3RSU6_BCL2L2-      --------------------------------------------------
A0A667I624_BCL2L2-      --------------------------------------------------
G1P3J2_BCL2L2-01        --------------------------------------------------
G3TMU7_BCL2L2-01        --------------------------------------------------
A0A2K6TM77_BCL2L2-      --------------------------------------------------
A0A2K6TM77_BCL2L2-      --------------------------------------------------
A0A2K5CWY6_BCL2L2-      --------------------------------------------------
A0A2K5CWY6_BCL2L2-      --------------------------------------------------
A0A2K5CWY6_BCL2L2-      --------------------------------------------------
U3CRF8_BCL2L2-02        --------------------------------------------------
U3CRF8_BCL2L2-03        --------------------------------------------------
A0A2I3GEA7_BCL2L2-      --------------------------------------------------
A0A8I5U2F2_BCL2L2-      --------------------------------------------------
A0A2I2YPX6_BCL2L2-      --------------------------------------------------
A0A2I2YPX6_BCL2L2-      --------------------------------------------------
U3CRF8_BCL2L2-01        --------------------------------------------------
A0A2K6TM77_BCL2L2-      --------------------------------------------------
A0A2K6TM77_BCL2L2-      --------------------------------------------------
A0A2K5V0Q3_BCL2L2-      --------------------------------------------------
A0A2K6EA59_BCL2L2-      --------------------------------------------------
A0A2K6EA59_BCL2L2-      --------------------------------------------------
A0A2K5MZX9_BCL2L2-      --------------------------------------------------
A0A2K5MZX9_BCL2L2-      --------------------------------------------------
A0A2K5MZX9_BCL2L2-      --------------------------------------------------
A0A2K5V0Q3_BCL2L2-      --------------------------------------------------
F7G4L5_BCL2L2-03        --------------------------------------------------
A0A2K6EA59_BCL2L2-      --------------------------------------------------
A0A2K6AI25_BCL2L2-      --------------------------------------------------
A0A8D2FJU1_BCL2L2-      --------------------------------------------------
A0A2R9A2Q3_BCL2L2-      --------------------------------------------------
A0A2R9A2Q3_BCL2L2-      --------------------------------------------------
A0A2K6RW35_BCL2L2-      --------------------------------------------------
A0A2K5HEJ9_BCL2L2-      --------------------------------------------------
A0A2K5HEJ9_BCL2L2-      --------------------------------------------------
A0A8I5U2F2_BCL2L2-      --------------------------------------------------
A0A2K5CWY6_BCL2L2-      --------------------------------------------------
A0A8I5U2F2_BCL2L2-      --------------------------------------------------
A0A2K6RW35_BCL2L2-      --------------------------------------------------
A0A2K6RW35_BCL2L2-      --------------------------------------------------
A0A2K6ME72_BCL2L2-      --------------------------------------------------
A0A2R9A2Q3_BCL2L2-      --------------------------------------------------
A0A2K5MZX9_BCL2L2-      --------------------------------------------------
A0A2K6EA59_BCL2L2-      --------------------------------------------------
A0A2K6RW35_BCL2L2-      --------------------------------------------------
A0A2K6ME72_BCL2L2-      --------------------------------------------------
A0A8D2FJU1_BCL2L2-      --------------------------------------------------
A0A8D2FJU1_BCL2L2-      --------------------------------------------------
A0A8C9H679_BCL2L2-      --------------------------------------------------
A0A8C9H679_BCL2L2-      --------------------------------------------------
A0A2I3MUE4_BCL2L2-      --------------------------------------------------
A0A2I3GEA7_BCL2L2-      --------------------------------------------------
A0A2I3GEA7_BCL2L2-      --------------------------------------------------
A0A2K6AI25_BCL2L2-      --------------------------------------------------
A0A2K6AI25_BCL2L2-      --------------------------------------------------
F7G4L5_BCL2L2-02        --------------------------------------------------
F7G4L5_BCL2L2-01        --------------------------------------------------
A0A2K5V0Q3_BCL2L2-      --------------------------------------------------
A0A2K5V0Q3_BCL2L2-      --------------------------------------------------
A0A2K5V0Q3_BCL2L2-      --------------------------------------------------
A0A2K5V0Q3_BCL2L2-      --------------------------------------------------
A0A2K5V0Q3_BCL2L2-      --------------------------------------------------
A0A2K5V0Q3_BCL2L2-      --------------------------------------------------
A0A2K5V0Q3_BCL2L2-      --------------------------------------------------
G3V4B7_BCL2L2-08        --------------------------------------------------
G3V4B7_BCL2L2-07        --------------------------------------------------
G3V4B7_BCL2L2-06        --------------------------------------------------
G3V4B7_BCL2L2-05        --------------------------------------------------
G3V4B7_BCL2L2-04        --------------------------------------------------
G3V4B7_BCL2L2-03        --------------------------------------------------
G3V4B7_BCL2L2-02        --------------------------------------------------
A0A2I2YPX6_BCL2L2-      --------------------------------------------------
A0A2I2YPX6_BCL2L2-      --------------------------------------------------
A0A2K5HEJ9_BCL2L2-      --------------------------------------------------
A0A0D9RU30_BCL2L2-      --------------------------------------------------
G3V4B7_BCL2L2-01        --------------------------------------------------
G3V4B7_BCL2L2-09        --------------------------------------------------
                                                                          

H3AAS7_BCL2L2-02        --------------------------------------------------
H3AAS7_BCL2L2-01        --------------------------------------------------
Q6GP82_BCL2L2-01        --------------------------------------------------
A0A8C5PJB3_BCL2L2-      --------------------------------------------------
A0A4X2LP96_BCL2L2-      --------------------------------------------------
A0A5F8HG85_BCL2L2-      --------------------------------------------------
A0A5F8HG85_BCL2L2-      --------------------------------------------------
A0A5F8HG85_BCL2L2-      --------------------------------------------------
F7G6M3_BCL2L2-01        --------------------------------------------------
G1Q051_BCL2L2-01        --------------------------------------------------
G1TV33_BCL2L2-01        --------------------------------------------------
D3Z5F7_BCL2L2-01        --------------------------------------------------
G3V4B7_BCL2L2-10        --------------------------------------------------
A0A6I9LUT0_BCL2L2-      --------------------------------------------------
A0A8C3X592_BCL2L2-      --------------------------------------------------
A0A3Q9B4M8_BCL2L2-      --------------------------------------------------
A0A7T8CLX7_BCL2L2-      --------------------------------------------------
A0A8D0TJQ9_BCL2L2-      --------------------------------------------------
A0A4X1SF60_BCL2L2-      --------------------------------------------------
A0A4X1SF63_BCL2L2-      --------------------------------------------------
A0A8C0Q5E6_BCL2L2-      --------------------------------------------------
A0A8I3MNK9_BCL2L2-      --------------------------------------------------
A0A8I3RSU6_BCL2L2-      --------------------------------------------------
A0A673VAY7_BCL2L2-      --------------------------------------------------
A0A2I2UAE3_BCL2L2-      --------------------------------------------------
A0A8C8XCR9_BCL2L2-      --------------------------------------------------
A0A8C9J3S1_BCL2L2-      --------------------------------------------------
M3Y5X5_BCL2L2-01        --------------------------------------------------
A0A8C7EW82_BCL2L2-      --------------------------------------------------
A0A452SHI1_BCL2L2-      --------------------------------------------------
A0A384DPS8_BCL2L2-      --------------------------------------------------
A0A8C4LWK5_BCL2L2-      --------------------------------------------------
A0A8C6BK57_BCL2L2-      --------------------------------------------------
A0A8C9CXQ5_BCL2L2-      --------------------------------------------------
A0A8B8WSS7_BCL2L2-      --------------------------------------------------
W5QDH4_BCL2L2-02        --------------------------------------------------
A0A8C6CUC2_BCL2L2-      --------------------------------------------------
A0A452ECF0_BCL2L2-      --------------------------------------------------
A0A4W2D6A3_BCL2L2-      --------------------------------------------------
A0A4W2D6A3_BCL2L2-      --------------------------------------------------
A0A4W2GUJ7_BCL2L2-      aacaagtgcatggaacgtcagagaccttctggaaatgctgaatttactcc
A0A4W2GUJ7_BCL2L2-      --------------------------------------------------
A0A8B9WT05_BCL2L2-      --------------------------------------------------
A0A4W2D6A3_BCL2L2-      --------------------------------------------------
A0A4W2D6A3_BCL2L2-      --------------------------------------------------
A0A4W2GUJ7_BCL2L2-      aacaagtgcatggaacgtcagagaccttctggaaatgctgaatttactcc
A0A4W2GUJ7_BCL2L2-      --------------------------------------------------
Q05KI8_BCL2L2-01        --------------------------------------------------
A0A8C2VJ88_BCL2L2-      --------------------------------------------------
A0A286XQQ9_BCL2L2-      --------------------------------------------------
A0A8C2VJ88_BCL2L2-      --------------------------------------------------
A0A8D2APK0_BCL2L2-      --------------------------------------------------
A0A287D9B3_BCL2L2-      --------------------------------------------------
A0A8D2HGM1_BCL2L2-      --------------------------------------------------
A0A287D9B3_BCL2L2-      --------------------------------------------------
A0A8C9PGU3_BCL2L2-      --------------------------------------------------
W5QDH4_BCL2L2-01        --------------------------------------------------
A0A4W2GUJ7_BCL2L2-      --------------------------------------------------
A0A4W2GUJ7_BCL2L2-      --------------------------------------------------
A0A4W2D6A3_BCL2L2-      --------------------------------------------------
A0A4W2GUJ7_BCL2L2-      --------------------------------------------------
A0A4W2D6A3_BCL2L2-      --------------------------------------------------
A0A4W2GUJ7_BCL2L2-      --------------------------------------------------
A0A4W2GUJ7_BCL2L2-      --------------------------------------------------
A0A4W2GUJ7_BCL2L2-      --------------------------------------------------
A0A5F5PML6_BCL2L2-      --------------------------------------------------
A0A5F5PML6_BCL2L2-      --------------------------------------------------
A0A8C5L5C6_BCL2L2-      --------------------------------------------------
A0A8C0Q5E6_BCL2L2-      --------------------------------------------------
A0A8I3MNK9_BCL2L2-      --------------------------------------------------
A0A8I3RSU6_BCL2L2-      --------------------------------------------------
A0A8I3MNK9_BCL2L2-      --------------------------------------------------
A0A667I624_BCL2L2-      --------------------------------------------------
G1LKF5_BCL2L2-01        --------------------------------------------------
G1LKF5_BCL2L2-02        --------------------------------------------------
A0A384DPS8_BCL2L2-      --------------------------------------------------
A0A384DPS8_BCL2L2-      --------------------------------------------------
A0A8C6RJE0_BCL2L2-      --------------------------------------------------
A0A671DWB3_BCL2L2-      --------------------------------------------------
A0A250YBR2_BCL2L2-      --------------------------------------------------
A0A250YBR2_BCL2L2-      --------------------------------------------------
O88996_BCL2L2-01        --------------------------------------------------
Q7TS60_BCL2L2-01        --------------------------------------------------
A0A671DWB3_BCL2L2-      --------------------------------------------------
A0A8C6RJE0_BCL2L2-      --------------------------------------------------
A0A4W2D6A3_BCL2L2-      --------------------------------------------------
A0A4W2GUJ7_BCL2L2-      --------------------------------------------------
A0A4W2D6A3_BCL2L2-      --------------------------------------------------
A0A4W2GUJ7_BCL2L2-      --------------------------------------------------
A0A8C8YZD8_BCL2L2-      --------------------------------------------------
A0A8B7FJ73_BCL2L2-      --------------------------------------------------
A0A2K6GWM6_BCL2L2-      --------------------------------------------------
A0A8D0TJQ9_BCL2L2-      --------------------------------------------------
A0A482LX62_BCL2L2-      --------------------------------------------------
A0A4X1SF63_BCL2L2-      --------------------------------------------------
A0A4D6NWN1_BCL2L2-      --------------------------------------------------
A0A4X1SF60_BCL2L2-      --------------------------------------------------
A0A4X1SF63_BCL2L2-      --------------------------------------------------
A0A8D0TJQ9_BCL2L2-      --------------------------------------------------
A0A4X1SF60_BCL2L2-      --------------------------------------------------
A0A8D0TJQ9_BCL2L2-      --------------------------------------------------
H0XR82_BCL2L2-01        --------------------------------------------------
A0A4X1SF63_BCL2L2-      --------------------------------------------------
A0A4X1SF63_BCL2L2-      --------------------------------------------------
A0A8D0TJQ9_BCL2L2-      --------------------------------------------------
A0A8B7FJ73_BCL2L2-      --------------------------------------------------
A0A2K6GWM6_BCL2L2-      --------------------------------------------------
A0A5F5PML6_BCL2L2-      --------------------------------------------------
A0A8C8YZD8_BCL2L2-      --------------------------------------------------
A0A8B7FJ73_BCL2L2-      --------------------------------------------------
A0A8B7FJ73_BCL2L2-      --------------------------------------------------
A0A2K6GWM6_BCL2L2-      --------------------------------------------------
A0A2K6GWM6_BCL2L2-      --------------------------------------------------
A0A8C0Q5E6_BCL2L2-      --------------------------------------------------
A0A8I3MNK9_BCL2L2-      --------------------------------------------------
A0A8I3RSU6_BCL2L2-      --------------------------------------------------
A0A667I624_BCL2L2-      --------------------------------------------------
G1P3J2_BCL2L2-01        --------------------------------------------------
G3TMU7_BCL2L2-01        --------------------------------------------------
A0A2K6TM77_BCL2L2-      --------------------------------------------------
A0A2K6TM77_BCL2L2-      --------------------------------------------------
A0A2K5CWY6_BCL2L2-      --------------------------------------------------
A0A2K5CWY6_BCL2L2-      --------------------------------------------------
A0A2K5CWY6_BCL2L2-      --------------------------------------------------
U3CRF8_BCL2L2-02        --------------------------------------------------
U3CRF8_BCL2L2-03        --------------------------------------------------
A0A2I3GEA7_BCL2L2-      --------------------------------------------------
A0A8I5U2F2_BCL2L2-      --------------------------------------------------
A0A2I2YPX6_BCL2L2-      --------------------------------------------------
A0A2I2YPX6_BCL2L2-      --------------------------------------------------
U3CRF8_BCL2L2-01        --------------------------------------------------
A0A2K6TM77_BCL2L2-      --------------------------------------------------
A0A2K6TM77_BCL2L2-      --------------------------------------------------
A0A2K5V0Q3_BCL2L2-      --------------------------------------------------
A0A2K6EA59_BCL2L2-      --------------------------------------------------
A0A2K6EA59_BCL2L2-      --------------------------------------------------
A0A2K5MZX9_BCL2L2-      --------------------------------------------------
A0A2K5MZX9_BCL2L2-      --------------------------------------------------
A0A2K5MZX9_BCL2L2-      --------------------------------------------------
A0A2K5V0Q3_BCL2L2-      --------------------------------------------------
F7G4L5_BCL2L2-03        --------------------------------------------------
A0A2K6EA59_BCL2L2-      --------------------------------------------------
A0A2K6AI25_BCL2L2-      --------------------------------------------------
A0A8D2FJU1_BCL2L2-      --------------------------------------------------
A0A2R9A2Q3_BCL2L2-      --------------------------------------------------
A0A2R9A2Q3_BCL2L2-      --------------------------------------------------
A0A2K6RW35_BCL2L2-      --------------------------------------------------
A0A2K5HEJ9_BCL2L2-      --------------------------------------------------
A0A2K5HEJ9_BCL2L2-      --------------------------------------------------
A0A8I5U2F2_BCL2L2-      --------------------------------------------------
A0A2K5CWY6_BCL2L2-      --------------------------------------------------
A0A8I5U2F2_BCL2L2-      --------------------------------------------------
A0A2K6RW35_BCL2L2-      --------------------------------------------------
A0A2K6RW35_BCL2L2-      --------------------------------------------------
A0A2K6ME72_BCL2L2-      --------------------------------------------------
A0A2R9A2Q3_BCL2L2-      --------------------------------------------------
A0A2K5MZX9_BCL2L2-      --------------------------------------------------
A0A2K6EA59_BCL2L2-      --------------------------------------------------
A0A2K6RW35_BCL2L2-      --------------------------------------------------
A0A2K6ME72_BCL2L2-      --------------------------------------------------
A0A8D2FJU1_BCL2L2-      --------------------------------------------------
A0A8D2FJU1_BCL2L2-      --------------------------------------------------
A0A8C9H679_BCL2L2-      --------------------------------------------------
A0A8C9H679_BCL2L2-      --------------------------------------------------
A0A2I3MUE4_BCL2L2-      --------------------------------------------------
A0A2I3GEA7_BCL2L2-      --------------------------------------------------
A0A2I3GEA7_BCL2L2-      --------------------------------------------------
A0A2K6AI25_BCL2L2-      --------------------------------------------------
A0A2K6AI25_BCL2L2-      --------------------------------------------------
F7G4L5_BCL2L2-02        --------------------------------------------------
F7G4L5_BCL2L2-01        --------------------------------------------------
A0A2K5V0Q3_BCL2L2-      --------------------------------------------------
A0A2K5V0Q3_BCL2L2-      --------------------------------------------------
A0A2K5V0Q3_BCL2L2-      --------------------------------------------------
A0A2K5V0Q3_BCL2L2-      --------------------------------------------------
A0A2K5V0Q3_BCL2L2-      --------------------------------------------------
A0A2K5V0Q3_BCL2L2-      --------------------------------------------------
A0A2K5V0Q3_BCL2L2-      --------------------------------------------------
G3V4B7_BCL2L2-08        --------------------------------------------------
G3V4B7_BCL2L2-07        --------------------------------------------------
G3V4B7_BCL2L2-06        --------------------------------------------------
G3V4B7_BCL2L2-05        --------------------------------------------------
G3V4B7_BCL2L2-04        --------------------------------------------------
G3V4B7_BCL2L2-03        --------------------------------------------------
G3V4B7_BCL2L2-02        --------------------------------------------------
A0A2I2YPX6_BCL2L2-      --------------------------------------------------
A0A2I2YPX6_BCL2L2-      --------------------------------------------------
A0A2K5HEJ9_BCL2L2-      --------------------------------------------------
A0A0D9RU30_BCL2L2-      --------------------------------------------------
G3V4B7_BCL2L2-01        --------------------------------------------------
G3V4B7_BCL2L2-09        --------------------------------------------------
                                                                          

H3AAS7_BCL2L2-02        --------------------------------------------------
H3AAS7_BCL2L2-01        --------------------------------------------------
Q6GP82_BCL2L2-01        --------------------------------------------------
A0A8C5PJB3_BCL2L2-      --------------------------------------------------
A0A4X2LP96_BCL2L2-      --------------------------------------------------
A0A5F8HG85_BCL2L2-      --------------------------------------------------
A0A5F8HG85_BCL2L2-      --------------------------------------------------
A0A5F8HG85_BCL2L2-      --------------------------------------------------
F7G6M3_BCL2L2-01        --------------------------------------------------
G1Q051_BCL2L2-01        --------------------------------------------------
G1TV33_BCL2L2-01        --------------------------------------------------
D3Z5F7_BCL2L2-01        --------------------------------------------------
G3V4B7_BCL2L2-10        --------------------------------------------------
A0A6I9LUT0_BCL2L2-      --------------------------------------------------
A0A8C3X592_BCL2L2-      --------------------------------------------------
A0A3Q9B4M8_BCL2L2-      --------------------------------------------------
A0A7T8CLX7_BCL2L2-      --------------------------------------------------
A0A8D0TJQ9_BCL2L2-      --------------------------------------------------
A0A4X1SF60_BCL2L2-      --------------------------------------------------
A0A4X1SF63_BCL2L2-      --------------------------------------------------
A0A8C0Q5E6_BCL2L2-      --------------------------------------------------
A0A8I3MNK9_BCL2L2-      --------------------------------------------------
A0A8I3RSU6_BCL2L2-      --------------------------------------------------
A0A673VAY7_BCL2L2-      --------------------------------------------------
A0A2I2UAE3_BCL2L2-      --------------------------------------------------
A0A8C8XCR9_BCL2L2-      --------------------------------------------------
A0A8C9J3S1_BCL2L2-      --------------------------------------------------
M3Y5X5_BCL2L2-01        --------------------------------------------------
A0A8C7EW82_BCL2L2-      --------------------------------------------------
A0A452SHI1_BCL2L2-      --------------------------------------------------
A0A384DPS8_BCL2L2-      --------------------------------------------------
A0A8C4LWK5_BCL2L2-      --------------------------------------------------
A0A8C6BK57_BCL2L2-      --------------------------------------------------
A0A8C9CXQ5_BCL2L2-      --------------------------------------------------
A0A8B8WSS7_BCL2L2-      --------------------------------------------------
W5QDH4_BCL2L2-02        --------------------------------------------------
A0A8C6CUC2_BCL2L2-      --------------------------------------------------
A0A452ECF0_BCL2L2-      --------------------------------------------------
A0A4W2D6A3_BCL2L2-      --------------------------------------------------
A0A4W2D6A3_BCL2L2-      --------------------------------------------------
A0A4W2GUJ7_BCL2L2-      aaggtttcatgaggcccagccggcttctcttcacagcctccagggtcaga
A0A4W2GUJ7_BCL2L2-      --------------------------------------------------
A0A8B9WT05_BCL2L2-      --------------------------------------------------
A0A4W2D6A3_BCL2L2-      --------------------------------------------------
A0A4W2D6A3_BCL2L2-      --------------------------------------------------
A0A4W2GUJ7_BCL2L2-      aaggtttcatgaggcccagccggcttctcttcacagcctccagggtcaga
A0A4W2GUJ7_BCL2L2-      --------------------------------------------------
Q05KI8_BCL2L2-01        --------------------------------------------------
A0A8C2VJ88_BCL2L2-      --------------------------------------------------
A0A286XQQ9_BCL2L2-      --------------------------------------------------
A0A8C2VJ88_BCL2L2-      --------------------------------------------------
A0A8D2APK0_BCL2L2-      --------------------------------------------------
A0A287D9B3_BCL2L2-      --------------------------------------------------
A0A8D2HGM1_BCL2L2-      --------------------------------------------------
A0A287D9B3_BCL2L2-      --------------------------------------------------
A0A8C9PGU3_BCL2L2-      --------------------------------------------------
W5QDH4_BCL2L2-01        --------------------------------------------------
A0A4W2GUJ7_BCL2L2-      --------------------------------------------------
A0A4W2GUJ7_BCL2L2-      --------------------------------------------------
A0A4W2D6A3_BCL2L2-      --------------------------------------------------
A0A4W2GUJ7_BCL2L2-      --------------------------------------------------
A0A4W2D6A3_BCL2L2-      --------------------------------------------------
A0A4W2GUJ7_BCL2L2-      --------------------------------------------------
A0A4W2GUJ7_BCL2L2-      --------------------------------------------------
A0A4W2GUJ7_BCL2L2-      --------------------------------------------------
A0A5F5PML6_BCL2L2-      --------------------------------------------------
A0A5F5PML6_BCL2L2-      --------------------------------------------------
A0A8C5L5C6_BCL2L2-      --------------------------------------------------
A0A8C0Q5E6_BCL2L2-      --------------------------------------------------
A0A8I3MNK9_BCL2L2-      --------------------------------------------------
A0A8I3RSU6_BCL2L2-      --------------------------------------------------
A0A8I3MNK9_BCL2L2-      --------------------------------------------------
A0A667I624_BCL2L2-      --------------------------------------------------
G1LKF5_BCL2L2-01        --------------------------------------------------
G1LKF5_BCL2L2-02        --------------------------------------------------
A0A384DPS8_BCL2L2-      --------------------------------------------------
A0A384DPS8_BCL2L2-      --------------------------------------------------
A0A8C6RJE0_BCL2L2-      --------------------------------------------------
A0A671DWB3_BCL2L2-      --------------------------------------------------
A0A250YBR2_BCL2L2-      --------------------------------------------------
A0A250YBR2_BCL2L2-      --------------------------------------------------
O88996_BCL2L2-01        --------------------------------------------------
Q7TS60_BCL2L2-01        --------------------------------------------------
A0A671DWB3_BCL2L2-      --------------------------------------------------
A0A8C6RJE0_BCL2L2-      --------------------------------------------------
A0A4W2D6A3_BCL2L2-      --------------------------------------------------
A0A4W2GUJ7_BCL2L2-      --------------------------------------------------
A0A4W2D6A3_BCL2L2-      --------------------------------------------------
A0A4W2GUJ7_BCL2L2-      --------------------------------------------------
A0A8C8YZD8_BCL2L2-      --------------------------------------------------
A0A8B7FJ73_BCL2L2-      --------------------------------------------------
A0A2K6GWM6_BCL2L2-      --------------------------------------------------
A0A8D0TJQ9_BCL2L2-      --------------------------------------------------
A0A482LX62_BCL2L2-      --------------------------------------------------
A0A4X1SF63_BCL2L2-      --------------------------------------------------
A0A4D6NWN1_BCL2L2-      --------------------------------------------------
A0A4X1SF60_BCL2L2-      --------------------------------------------------
A0A4X1SF63_BCL2L2-      --------------------------------------------------
A0A8D0TJQ9_BCL2L2-      --------------------------------------------------
A0A4X1SF60_BCL2L2-      --------------------------------------------------
A0A8D0TJQ9_BCL2L2-      --------------------------------------------------
H0XR82_BCL2L2-01        --------------------------------------------------
A0A4X1SF63_BCL2L2-      --------------------------------------------------
A0A4X1SF63_BCL2L2-      --------------------------------------------------
A0A8D0TJQ9_BCL2L2-      --------------------------------------------------
A0A8B7FJ73_BCL2L2-      --------------------------------------------------
A0A2K6GWM6_BCL2L2-      --------------------------------------------------
A0A5F5PML6_BCL2L2-      --------------------------------------------------
A0A8C8YZD8_BCL2L2-      --------------------------------------------------
A0A8B7FJ73_BCL2L2-      --------------------------------------------------
A0A8B7FJ73_BCL2L2-      --------------------------------------------------
A0A2K6GWM6_BCL2L2-      --------------------------------------------------
A0A2K6GWM6_BCL2L2-      --------------------------------------------------
A0A8C0Q5E6_BCL2L2-      --------------------------------------------------
A0A8I3MNK9_BCL2L2-      --------------------------------------------------
A0A8I3RSU6_BCL2L2-      --------------------------------------------------
A0A667I624_BCL2L2-      --------------------------------------------------
G1P3J2_BCL2L2-01        --------------------------------------------------
G3TMU7_BCL2L2-01        --------------------------------------------------
A0A2K6TM77_BCL2L2-      --------------------------------------------------
A0A2K6TM77_BCL2L2-      --------------------------------------------------
A0A2K5CWY6_BCL2L2-      --------------------------------------------------
A0A2K5CWY6_BCL2L2-      --------------------------------------------------
A0A2K5CWY6_BCL2L2-      --------------------------------------------------
U3CRF8_BCL2L2-02        --------------------------------------------------
U3CRF8_BCL2L2-03        --------------------------------------------------
A0A2I3GEA7_BCL2L2-      --------------------------------------------------
A0A8I5U2F2_BCL2L2-      --------------------------------------------------
A0A2I2YPX6_BCL2L2-      --------------------------------------------------
A0A2I2YPX6_BCL2L2-      --------------------------------------------------
U3CRF8_BCL2L2-01        --------------------------------------------------
A0A2K6TM77_BCL2L2-      --------------------------------------------------
A0A2K6TM77_BCL2L2-      --------------------------------------------------
A0A2K5V0Q3_BCL2L2-      --------------------------------------------------
A0A2K6EA59_BCL2L2-      --------------------------------------------------
A0A2K6EA59_BCL2L2-      --------------------------------------------------
A0A2K5MZX9_BCL2L2-      --------------------------------------------------
A0A2K5MZX9_BCL2L2-      --------------------------------------------------
A0A2K5MZX9_BCL2L2-      --------------------------------------------------
A0A2K5V0Q3_BCL2L2-      --------------------------------------------------
F7G4L5_BCL2L2-03        --------------------------------------------------
A0A2K6EA59_BCL2L2-      --------------------------------------------------
A0A2K6AI25_BCL2L2-      --------------------------------------------------
A0A8D2FJU1_BCL2L2-      --------------------------------------------------
A0A2R9A2Q3_BCL2L2-      --------------------------------------------------
A0A2R9A2Q3_BCL2L2-      --------------------------------------------------
A0A2K6RW35_BCL2L2-      --------------------------------------------------
A0A2K5HEJ9_BCL2L2-      --------------------------------------------------
A0A2K5HEJ9_BCL2L2-      --------------------------------------------------
A0A8I5U2F2_BCL2L2-      --------------------------------------------------
A0A2K5CWY6_BCL2L2-      --------------------------------------------------
A0A8I5U2F2_BCL2L2-      --------------------------------------------------
A0A2K6RW35_BCL2L2-      --------------------------------------------------
A0A2K6RW35_BCL2L2-      --------------------------------------------------
A0A2K6ME72_BCL2L2-      --------------------------------------------------
A0A2R9A2Q3_BCL2L2-      --------------------------------------------------
A0A2K5MZX9_BCL2L2-      --------------------------------------------------
A0A2K6EA59_BCL2L2-      --------------------------------------------------
A0A2K6RW35_BCL2L2-      --------------------------------------------------
A0A2K6ME72_BCL2L2-      --------------------------------------------------
A0A8D2FJU1_BCL2L2-      --------------------------------------------------
A0A8D2FJU1_BCL2L2-      --------------------------------------------------
A0A8C9H679_BCL2L2-      --------------------------------------------------
A0A8C9H679_BCL2L2-      --------------------------------------------------
A0A2I3MUE4_BCL2L2-      --------------------------------------------------
A0A2I3GEA7_BCL2L2-      --------------------------------------------------
A0A2I3GEA7_BCL2L2-      --------------------------------------------------
A0A2K6AI25_BCL2L2-      --------------------------------------------------
A0A2K6AI25_BCL2L2-      --------------------------------------------------
F7G4L5_BCL2L2-02        --------------------------------------------------
F7G4L5_BCL2L2-01        --------------------------------------------------
A0A2K5V0Q3_BCL2L2-      --------------------------------------------------
A0A2K5V0Q3_BCL2L2-      --------------------------------------------------
A0A2K5V0Q3_BCL2L2-      --------------------------------------------------
A0A2K5V0Q3_BCL2L2-      --------------------------------------------------
A0A2K5V0Q3_BCL2L2-      --------------------------------------------------
A0A2K5V0Q3_BCL2L2-      --------------------------------------------------
A0A2K5V0Q3_BCL2L2-      --------------------------------------------------
G3V4B7_BCL2L2-08        --------------------------------------------------
G3V4B7_BCL2L2-07        --------------------------------------------------
G3V4B7_BCL2L2-06        --------------------------------------------------
G3V4B7_BCL2L2-05        --------------------------------------------------
G3V4B7_BCL2L2-04        --------------------------------------------------
G3V4B7_BCL2L2-03        --------------------------------------------------
G3V4B7_BCL2L2-02        --------------------------------------------------
A0A2I2YPX6_BCL2L2-      --------------------------------------------------
A0A2I2YPX6_BCL2L2-      --------------------------------------------------
A0A2K5HEJ9_BCL2L2-      --------------------------------------------------
A0A0D9RU30_BCL2L2-      --------------------------------------------------
G3V4B7_BCL2L2-01        --------------------------------------------------
G3V4B7_BCL2L2-09        --------------------------------------------------
                                                                          

H3AAS7_BCL2L2-02        --------------------------------------------------
H3AAS7_BCL2L2-01        --------------------------------------------------
Q6GP82_BCL2L2-01        --------------------------------------------------
A0A8C5PJB3_BCL2L2-      --------------------------------------------------
A0A4X2LP96_BCL2L2-      --------------------------------------------------
A0A5F8HG85_BCL2L2-      --------------------------------------------------
A0A5F8HG85_BCL2L2-      --------------------------------------------------
A0A5F8HG85_BCL2L2-      --------------------------------------------------
F7G6M3_BCL2L2-01        --------------------------------------------------
G1Q051_BCL2L2-01        --------------------------------------------------
G1TV33_BCL2L2-01        --------------------------------------------------
D3Z5F7_BCL2L2-01        --------------------------------------------------
G3V4B7_BCL2L2-10        --------------------------------------------------
A0A6I9LUT0_BCL2L2-      --------------------------------------------------
A0A8C3X592_BCL2L2-      --------------------------------------------------
A0A3Q9B4M8_BCL2L2-      --------------------------------------------------
A0A7T8CLX7_BCL2L2-      --------------------------------------------------
A0A8D0TJQ9_BCL2L2-      --------------------------------------------------
A0A4X1SF60_BCL2L2-      --------------------------------------------------
A0A4X1SF63_BCL2L2-      --------------------------------------------------
A0A8C0Q5E6_BCL2L2-      --------------------------------------------------
A0A8I3MNK9_BCL2L2-      --------------------------------------------------
A0A8I3RSU6_BCL2L2-      --------------------------------------------------
A0A673VAY7_BCL2L2-      --------------------------------------------------
A0A2I2UAE3_BCL2L2-      --------------------------------------------------
A0A8C8XCR9_BCL2L2-      --------------------------------------------------
A0A8C9J3S1_BCL2L2-      --------------------------------------------------
M3Y5X5_BCL2L2-01        --------------------------------------------------
A0A8C7EW82_BCL2L2-      --------------------------------------------------
A0A452SHI1_BCL2L2-      --------------------------------------------------
A0A384DPS8_BCL2L2-      --------------------------------------------------
A0A8C4LWK5_BCL2L2-      --------------------------------------------------
A0A8C6BK57_BCL2L2-      --------------------------------------------------
A0A8C9CXQ5_BCL2L2-      --------------------------------------------------
A0A8B8WSS7_BCL2L2-      --------------------------------------------------
W5QDH4_BCL2L2-02        --------------------------------------------------
A0A8C6CUC2_BCL2L2-      --------------------------------------------------
A0A452ECF0_BCL2L2-      --------------------------------------------------
A0A4W2D6A3_BCL2L2-      --------------------------------------------------
A0A4W2D6A3_BCL2L2-      --------------------------------------------------
A0A4W2GUJ7_BCL2L2-      agccctgcctggcccttgatgccctcctggccctgttcttcctggcctcc
A0A4W2GUJ7_BCL2L2-      --------------------------------------------------
A0A8B9WT05_BCL2L2-      --------------------------------------------------
A0A4W2D6A3_BCL2L2-      --------------------------------------------------
A0A4W2D6A3_BCL2L2-      --------------------------------------------------
A0A4W2GUJ7_BCL2L2-      agccctgcctggcccttgatgccctcctggccctgttcttcctggcctcc
A0A4W2GUJ7_BCL2L2-      --------------------------------------------------
Q05KI8_BCL2L2-01        --------------------------------------------------
A0A8C2VJ88_BCL2L2-      --------------------------------------------------
A0A286XQQ9_BCL2L2-      --------------------------------------------------
A0A8C2VJ88_BCL2L2-      --------------------------------------------------
A0A8D2APK0_BCL2L2-      --------------------------------------------------
A0A287D9B3_BCL2L2-      --------------------------------------------------
A0A8D2HGM1_BCL2L2-      --------------------------------------------------
A0A287D9B3_BCL2L2-      --------------------------------------------------
A0A8C9PGU3_BCL2L2-      --------------------------------------------------
W5QDH4_BCL2L2-01        --------------------------------------------------
A0A4W2GUJ7_BCL2L2-      --------------------------------------------------
A0A4W2GUJ7_BCL2L2-      --------------------------------------------------
A0A4W2D6A3_BCL2L2-      --------------------------------------------------
A0A4W2GUJ7_BCL2L2-      --------------------------------------------------
A0A4W2D6A3_BCL2L2-      --------------------------------------------------
A0A4W2GUJ7_BCL2L2-      --------------------------------------------------
A0A4W2GUJ7_BCL2L2-      --------------------------------------------------
A0A4W2GUJ7_BCL2L2-      --------------------------------------------------
A0A5F5PML6_BCL2L2-      --------------------------------------------------
A0A5F5PML6_BCL2L2-      --------------------------------------------------
A0A8C5L5C6_BCL2L2-      --------------------------------------------------
A0A8C0Q5E6_BCL2L2-      --------------------------------------------------
A0A8I3MNK9_BCL2L2-      --------------------------------------------------
A0A8I3RSU6_BCL2L2-      --------------------------------------------------
A0A8I3MNK9_BCL2L2-      --------------------------------------------------
A0A667I624_BCL2L2-      --------------------------------------------------
G1LKF5_BCL2L2-01        --------------------------------------------------
G1LKF5_BCL2L2-02        --------------------------------------------------
A0A384DPS8_BCL2L2-      --------------------------------------------------
A0A384DPS8_BCL2L2-      --------------------------------------------------
A0A8C6RJE0_BCL2L2-      --------------------------------------------------
A0A671DWB3_BCL2L2-      --------------------------------------------------
A0A250YBR2_BCL2L2-      --------------------------------------------------
A0A250YBR2_BCL2L2-      --------------------------------------------------
O88996_BCL2L2-01        --------------------------------------------------
Q7TS60_BCL2L2-01        --------------------------------------------------
A0A671DWB3_BCL2L2-      --------------------------------------------------
A0A8C6RJE0_BCL2L2-      --------------------------------------------------
A0A4W2D6A3_BCL2L2-      --------------------------------------------------
A0A4W2GUJ7_BCL2L2-      --------------------------------------------------
A0A4W2D6A3_BCL2L2-      --------------------------------------------------
A0A4W2GUJ7_BCL2L2-      --------------------------------------------------
A0A8C8YZD8_BCL2L2-      --------------------------------------------------
A0A8B7FJ73_BCL2L2-      --------------------------------------------------
A0A2K6GWM6_BCL2L2-      --------------------------------------------------
A0A8D0TJQ9_BCL2L2-      --------------------------------------------------
A0A482LX62_BCL2L2-      --------------------------------------------------
A0A4X1SF63_BCL2L2-      --------------------------------------------------
A0A4D6NWN1_BCL2L2-      --------------------------------------------------
A0A4X1SF60_BCL2L2-      --------------------------------------------------
A0A4X1SF63_BCL2L2-      --------------------------------------------------
A0A8D0TJQ9_BCL2L2-      --------------------------------------------------
A0A4X1SF60_BCL2L2-      --------------------------------------------------
A0A8D0TJQ9_BCL2L2-      --------------------------------------------------
H0XR82_BCL2L2-01        --------------------------------------------------
A0A4X1SF63_BCL2L2-      --------------------------------------------------
A0A4X1SF63_BCL2L2-      --------------------------------------------------
A0A8D0TJQ9_BCL2L2-      --------------------------------------------------
A0A8B7FJ73_BCL2L2-      --------------------------------------------------
A0A2K6GWM6_BCL2L2-      --------------------------------------------------
A0A5F5PML6_BCL2L2-      --------------------------------------------------
A0A8C8YZD8_BCL2L2-      --------------------------------------------------
A0A8B7FJ73_BCL2L2-      --------------------------------------------------
A0A8B7FJ73_BCL2L2-      --------------------------------------------------
A0A2K6GWM6_BCL2L2-      --------------------------------------------------
A0A2K6GWM6_BCL2L2-      --------------------------------------------------
A0A8C0Q5E6_BCL2L2-      --------------------------------------------------
A0A8I3MNK9_BCL2L2-      --------------------------------------------------
A0A8I3RSU6_BCL2L2-      --------------------------------------------------
A0A667I624_BCL2L2-      --------------------------------------------------
G1P3J2_BCL2L2-01        --------------------------------------------------
G3TMU7_BCL2L2-01        --------------------------------------------------
A0A2K6TM77_BCL2L2-      --------------------------------------------------
A0A2K6TM77_BCL2L2-      --------------------------------------------------
A0A2K5CWY6_BCL2L2-      --------------------------------------------------
A0A2K5CWY6_BCL2L2-      --------------------------------------------------
A0A2K5CWY6_BCL2L2-      --------------------------------------------------
U3CRF8_BCL2L2-02        --------------------------------------------------
U3CRF8_BCL2L2-03        --------------------------------------------------
A0A2I3GEA7_BCL2L2-      --------------------------------------------------
A0A8I5U2F2_BCL2L2-      --------------------------------------------------
A0A2I2YPX6_BCL2L2-      --------------------------------------------------
A0A2I2YPX6_BCL2L2-      --------------------------------------------------
U3CRF8_BCL2L2-01        --------------------------------------------------
A0A2K6TM77_BCL2L2-      --------------------------------------------------
A0A2K6TM77_BCL2L2-      --------------------------------------------------
A0A2K5V0Q3_BCL2L2-      --------------------------------------------------
A0A2K6EA59_BCL2L2-      --------------------------------------------------
A0A2K6EA59_BCL2L2-      --------------------------------------------------
A0A2K5MZX9_BCL2L2-      --------------------------------------------------
A0A2K5MZX9_BCL2L2-      --------------------------------------------------
A0A2K5MZX9_BCL2L2-      --------------------------------------------------
A0A2K5V0Q3_BCL2L2-      --------------------------------------------------
F7G4L5_BCL2L2-03        --------------------------------------------------
A0A2K6EA59_BCL2L2-      --------------------------------------------------
A0A2K6AI25_BCL2L2-      --------------------------------------------------
A0A8D2FJU1_BCL2L2-      --------------------------------------------------
A0A2R9A2Q3_BCL2L2-      --------------------------------------------------
A0A2R9A2Q3_BCL2L2-      --------------------------------------------------
A0A2K6RW35_BCL2L2-      --------------------------------------------------
A0A2K5HEJ9_BCL2L2-      --------------------------------------------------
A0A2K5HEJ9_BCL2L2-      --------------------------------------------------
A0A8I5U2F2_BCL2L2-      --------------------------------------------------
A0A2K5CWY6_BCL2L2-      --------------------------------------------------
A0A8I5U2F2_BCL2L2-      --------------------------------------------------
A0A2K6RW35_BCL2L2-      --------------------------------------------------
A0A2K6RW35_BCL2L2-      --------------------------------------------------
A0A2K6ME72_BCL2L2-      --------------------------------------------------
A0A2R9A2Q3_BCL2L2-      --------------------------------------------------
A0A2K5MZX9_BCL2L2-      --------------------------------------------------
A0A2K6EA59_BCL2L2-      --------------------------------------------------
A0A2K6RW35_BCL2L2-      --------------------------------------------------
A0A2K6ME72_BCL2L2-      --------------------------------------------------
A0A8D2FJU1_BCL2L2-      --------------------------------------------------
A0A8D2FJU1_BCL2L2-      --------------------------------------------------
A0A8C9H679_BCL2L2-      --------------------------------------------------
A0A8C9H679_BCL2L2-      --------------------------------------------------
A0A2I3MUE4_BCL2L2-      --------------------------------------------------
A0A2I3GEA7_BCL2L2-      --------------------------------------------------
A0A2I3GEA7_BCL2L2-      --------------------------------------------------
A0A2K6AI25_BCL2L2-      --------------------------------------------------
A0A2K6AI25_BCL2L2-      --------------------------------------------------
F7G4L5_BCL2L2-02        --------------------------------------------------
F7G4L5_BCL2L2-01        --------------------------------------------------
A0A2K5V0Q3_BCL2L2-      --------------------------------------------------
A0A2K5V0Q3_BCL2L2-      --------------------------------------------------
A0A2K5V0Q3_BCL2L2-      --------------------------------------------------
A0A2K5V0Q3_BCL2L2-      --------------------------------------------------
A0A2K5V0Q3_BCL2L2-      --------------------------------------------------
A0A2K5V0Q3_BCL2L2-      --------------------------------------------------
A0A2K5V0Q3_BCL2L2-      --------------------------------------------------
G3V4B7_BCL2L2-08        --------------------------------------------------
G3V4B7_BCL2L2-07        --------------------------------------------------
G3V4B7_BCL2L2-06        --------------------------------------------------
G3V4B7_BCL2L2-05        --------------------------------------------------
G3V4B7_BCL2L2-04        --------------------------------------------------
G3V4B7_BCL2L2-03        --------------------------------------------------
G3V4B7_BCL2L2-02        --------------------------------------------------
A0A2I2YPX6_BCL2L2-      --------------------------------------------------
A0A2I2YPX6_BCL2L2-      --------------------------------------------------
A0A2K5HEJ9_BCL2L2-      --------------------------------------------------
A0A0D9RU30_BCL2L2-      --------------------------------------------------
G3V4B7_BCL2L2-01        --------------------------------------------------
G3V4B7_BCL2L2-09        --------------------------------------------------
                                                                          

H3AAS7_BCL2L2-02        --------------------------------------------------
H3AAS7_BCL2L2-01        --------------------------------------------------
Q6GP82_BCL2L2-01        --------------------------------------------------
A0A8C5PJB3_BCL2L2-      --------------------------------------------------
A0A4X2LP96_BCL2L2-      --------------------------------------------------
A0A5F8HG85_BCL2L2-      --------------------------------------------------
A0A5F8HG85_BCL2L2-      --------------------------------------------------
A0A5F8HG85_BCL2L2-      --------------------------------------------------
F7G6M3_BCL2L2-01        --------------------------------------------------
G1Q051_BCL2L2-01        --------------------------------------------------
G1TV33_BCL2L2-01        --------------------------------------------------
D3Z5F7_BCL2L2-01        --------------------------------------------------
G3V4B7_BCL2L2-10        --------------------------------------------------
A0A6I9LUT0_BCL2L2-      --------------------------------------------------
A0A8C3X592_BCL2L2-      --------------------------------------------------
A0A3Q9B4M8_BCL2L2-      --------------------------------------------------
A0A7T8CLX7_BCL2L2-      --------------------------------------------------
A0A8D0TJQ9_BCL2L2-      --------------------------------------------------
A0A4X1SF60_BCL2L2-      --------------------------------------------------
A0A4X1SF63_BCL2L2-      --------------------------------------------------
A0A8C0Q5E6_BCL2L2-      --------------------------------------------------
A0A8I3MNK9_BCL2L2-      --------------------------------------------------
A0A8I3RSU6_BCL2L2-      --------------------------------------------------
A0A673VAY7_BCL2L2-      --------------------------------------------------
A0A2I2UAE3_BCL2L2-      --------------------------------------------------
A0A8C8XCR9_BCL2L2-      --------------------------------------------------
A0A8C9J3S1_BCL2L2-      --------------------------------------------------
M3Y5X5_BCL2L2-01        --------------------------------------------------
A0A8C7EW82_BCL2L2-      --------------------------------------------------
A0A452SHI1_BCL2L2-      --------------------------------------------------
A0A384DPS8_BCL2L2-      --------------------------------------------------
A0A8C4LWK5_BCL2L2-      --------------------------------------------------
A0A8C6BK57_BCL2L2-      --------------------------------------------------
A0A8C9CXQ5_BCL2L2-      --------------------------------------------------
A0A8B8WSS7_BCL2L2-      --------------------------------------------------
W5QDH4_BCL2L2-02        --------------------------------------------------
A0A8C6CUC2_BCL2L2-      --------------------------------------------------
A0A452ECF0_BCL2L2-      --------------------------------------------------
A0A4W2D6A3_BCL2L2-      --------------------------------------------------
A0A4W2D6A3_BCL2L2-      --------------------------------------------------
A0A4W2GUJ7_BCL2L2-      agcagccctcttctttcctgagttgtggctcttcccaagcctgcgtccca
A0A4W2GUJ7_BCL2L2-      --------------------------------------------------
A0A8B9WT05_BCL2L2-      --------------------------------------------------
A0A4W2D6A3_BCL2L2-      --------------------------------------------------
A0A4W2D6A3_BCL2L2-      --------------------------------------------------
A0A4W2GUJ7_BCL2L2-      agcagccctcttctttcctgagttgtggctcttcccaagcctgcgtccca
A0A4W2GUJ7_BCL2L2-      --------------------------------------------------
Q05KI8_BCL2L2-01        --------------------------------------------------
A0A8C2VJ88_BCL2L2-      --------------------------------------------------
A0A286XQQ9_BCL2L2-      --------------------------------------------------
A0A8C2VJ88_BCL2L2-      --------------------------------------------------
A0A8D2APK0_BCL2L2-      --------------------------------------------------
A0A287D9B3_BCL2L2-      --------------------------------------------------
A0A8D2HGM1_BCL2L2-      --------------------------------------------------
A0A287D9B3_BCL2L2-      --------------------------------------------------
A0A8C9PGU3_BCL2L2-      --------------------------------------------------
W5QDH4_BCL2L2-01        --------------------------------------------------
A0A4W2GUJ7_BCL2L2-      --------------------------------------------------
A0A4W2GUJ7_BCL2L2-      --------------------------------------------------
A0A4W2D6A3_BCL2L2-      --------------------------------------------------
A0A4W2GUJ7_BCL2L2-      --------------------------------------------------
A0A4W2D6A3_BCL2L2-      --------------------------------------------------
A0A4W2GUJ7_BCL2L2-      --------------------------------------------------
A0A4W2GUJ7_BCL2L2-      --------------------------------------------------
A0A4W2GUJ7_BCL2L2-      --------------------------------------------------
A0A5F5PML6_BCL2L2-      --------------------------------------------------
A0A5F5PML6_BCL2L2-      --------------------------------------------------
A0A8C5L5C6_BCL2L2-      --------------------------------------------------
A0A8C0Q5E6_BCL2L2-      --------------------------------------------------
A0A8I3MNK9_BCL2L2-      --------------------------------------------------
A0A8I3RSU6_BCL2L2-      --------------------------------------------------
A0A8I3MNK9_BCL2L2-      --------------------------------------------------
A0A667I624_BCL2L2-      --------------------------------------------------
G1LKF5_BCL2L2-01        --------------------------------------------------
G1LKF5_BCL2L2-02        --------------------------------------------------
A0A384DPS8_BCL2L2-      --------------------------------------------------
A0A384DPS8_BCL2L2-      --------------------------------------------------
A0A8C6RJE0_BCL2L2-      --------------------------------------------------
A0A671DWB3_BCL2L2-      --------------------------------------------------
A0A250YBR2_BCL2L2-      --------------------------------------------------
A0A250YBR2_BCL2L2-      --------------------------------------------------
O88996_BCL2L2-01        --------------------------------------------------
Q7TS60_BCL2L2-01        --------------------------------------------------
A0A671DWB3_BCL2L2-      --------------------------------------------------
A0A8C6RJE0_BCL2L2-      --------------------------------------------------
A0A4W2D6A3_BCL2L2-      --------------------------------------------------
A0A4W2GUJ7_BCL2L2-      --------------------------------------------------
A0A4W2D6A3_BCL2L2-      --------------------------------------------------
A0A4W2GUJ7_BCL2L2-      --------------------------------------------------
A0A8C8YZD8_BCL2L2-      --------------------------------------------------
A0A8B7FJ73_BCL2L2-      --------------------------------------------------
A0A2K6GWM6_BCL2L2-      --------------------------------------------------
A0A8D0TJQ9_BCL2L2-      --------------------------------------------------
A0A482LX62_BCL2L2-      --------------------------------------------------
A0A4X1SF63_BCL2L2-      --------------------------------------------------
A0A4D6NWN1_BCL2L2-      --------------------------------------------------
A0A4X1SF60_BCL2L2-      --------------------------------------------------
A0A4X1SF63_BCL2L2-      --------------------------------------------------
A0A8D0TJQ9_BCL2L2-      --------------------------------------------------
A0A4X1SF60_BCL2L2-      --------------------------------------------------
A0A8D0TJQ9_BCL2L2-      --------------------------------------------------
H0XR82_BCL2L2-01        --------------------------------------------------
A0A4X1SF63_BCL2L2-      --------------------------------------------------
A0A4X1SF63_BCL2L2-      --------------------------------------------------
A0A8D0TJQ9_BCL2L2-      --------------------------------------------------
A0A8B7FJ73_BCL2L2-      --------------------------------------------------
A0A2K6GWM6_BCL2L2-      --------------------------------------------------
A0A5F5PML6_BCL2L2-      --------------------------------------------------
A0A8C8YZD8_BCL2L2-      --------------------------------------------------
A0A8B7FJ73_BCL2L2-      --------------------------------------------------
A0A8B7FJ73_BCL2L2-      --------------------------------------------------
A0A2K6GWM6_BCL2L2-      --------------------------------------------------
A0A2K6GWM6_BCL2L2-      --------------------------------------------------
A0A8C0Q5E6_BCL2L2-      --------------------------------------------------
A0A8I3MNK9_BCL2L2-      --------------------------------------------------
A0A8I3RSU6_BCL2L2-      --------------------------------------------------
A0A667I624_BCL2L2-      --------------------------------------------------
G1P3J2_BCL2L2-01        --------------------------------------------------
G3TMU7_BCL2L2-01        --------------------------------------------------
A0A2K6TM77_BCL2L2-      --------------------------------------------------
A0A2K6TM77_BCL2L2-      --------------------------------------------------
A0A2K5CWY6_BCL2L2-      --------------------------------------------------
A0A2K5CWY6_BCL2L2-      --------------------------------------------------
A0A2K5CWY6_BCL2L2-      --------------------------------------------------
U3CRF8_BCL2L2-02        --------------------------------------------------
U3CRF8_BCL2L2-03        --------------------------------------------------
A0A2I3GEA7_BCL2L2-      --------------------------------------------------
A0A8I5U2F2_BCL2L2-      --------------------------------------------------
A0A2I2YPX6_BCL2L2-      --------------------------------------------------
A0A2I2YPX6_BCL2L2-      --------------------------------------------------
U3CRF8_BCL2L2-01        --------------------------------------------------
A0A2K6TM77_BCL2L2-      --------------------------------------------------
A0A2K6TM77_BCL2L2-      --------------------------------------------------
A0A2K5V0Q3_BCL2L2-      --------------------------------------------------
A0A2K6EA59_BCL2L2-      --------------------------------------------------
A0A2K6EA59_BCL2L2-      --------------------------------------------------
A0A2K5MZX9_BCL2L2-      --------------------------------------------------
A0A2K5MZX9_BCL2L2-      --------------------------------------------------
A0A2K5MZX9_BCL2L2-      --------------------------------------------------
A0A2K5V0Q3_BCL2L2-      --------------------------------------------------
F7G4L5_BCL2L2-03        --------------------------------------------------
A0A2K6EA59_BCL2L2-      --------------------------------------------------
A0A2K6AI25_BCL2L2-      --------------------------------------------------
A0A8D2FJU1_BCL2L2-      --------------------------------------------------
A0A2R9A2Q3_BCL2L2-      --------------------------------------------------
A0A2R9A2Q3_BCL2L2-      --------------------------------------------------
A0A2K6RW35_BCL2L2-      --------------------------------------------------
A0A2K5HEJ9_BCL2L2-      --------------------------------------------------
A0A2K5HEJ9_BCL2L2-      --------------------------------------------------
A0A8I5U2F2_BCL2L2-      --------------------------------------------------
A0A2K5CWY6_BCL2L2-      --------------------------------------------------
A0A8I5U2F2_BCL2L2-      --------------------------------------------------
A0A2K6RW35_BCL2L2-      --------------------------------------------------
A0A2K6RW35_BCL2L2-      --------------------------------------------------
A0A2K6ME72_BCL2L2-      --------------------------------------------------
A0A2R9A2Q3_BCL2L2-      --------------------------------------------------
A0A2K5MZX9_BCL2L2-      --------------------------------------------------
A0A2K6EA59_BCL2L2-      --------------------------------------------------
A0A2K6RW35_BCL2L2-      --------------------------------------------------
A0A2K6ME72_BCL2L2-      --------------------------------------------------
A0A8D2FJU1_BCL2L2-      --------------------------------------------------
A0A8D2FJU1_BCL2L2-      --------------------------------------------------
A0A8C9H679_BCL2L2-      --------------------------------------------------
A0A8C9H679_BCL2L2-      --------------------------------------------------
A0A2I3MUE4_BCL2L2-      --------------------------------------------------
A0A2I3GEA7_BCL2L2-      --------------------------------------------------
A0A2I3GEA7_BCL2L2-      --------------------------------------------------
A0A2K6AI25_BCL2L2-      --------------------------------------------------
A0A2K6AI25_BCL2L2-      --------------------------------------------------
F7G4L5_BCL2L2-02        --------------------------------------------------
F7G4L5_BCL2L2-01        --------------------------------------------------
A0A2K5V0Q3_BCL2L2-      --------------------------------------------------
A0A2K5V0Q3_BCL2L2-      --------------------------------------------------
A0A2K5V0Q3_BCL2L2-      --------------------------------------------------
A0A2K5V0Q3_BCL2L2-      --------------------------------------------------
A0A2K5V0Q3_BCL2L2-      --------------------------------------------------
A0A2K5V0Q3_BCL2L2-      --------------------------------------------------
A0A2K5V0Q3_BCL2L2-      --------------------------------------------------
G3V4B7_BCL2L2-08        --------------------------------------------------
G3V4B7_BCL2L2-07        --------------------------------------------------
G3V4B7_BCL2L2-06        --------------------------------------------------
G3V4B7_BCL2L2-05        --------------------------------------------------
G3V4B7_BCL2L2-04        --------------------------------------------------
G3V4B7_BCL2L2-03        --------------------------------------------------
G3V4B7_BCL2L2-02        --------------------------------------------------
A0A2I2YPX6_BCL2L2-      --------------------------------------------------
A0A2I2YPX6_BCL2L2-      --------------------------------------------------
A0A2K5HEJ9_BCL2L2-      --------------------------------------------------
A0A0D9RU30_BCL2L2-      --------------------------------------------------
G3V4B7_BCL2L2-01        --------------------------------------------------
G3V4B7_BCL2L2-09        --------------------------------------------------
                                                                          

H3AAS7_BCL2L2-02        --------------------------------------------------
H3AAS7_BCL2L2-01        --------------------------------------------------
Q6GP82_BCL2L2-01        --------------------------------------------------
A0A8C5PJB3_BCL2L2-      --------------------------------------------------
A0A4X2LP96_BCL2L2-      --------------------------------------------------
A0A5F8HG85_BCL2L2-      --------------------------------------------------
A0A5F8HG85_BCL2L2-      --------------------------------------------------
A0A5F8HG85_BCL2L2-      --------------------------------------------------
F7G6M3_BCL2L2-01        --------------------------------------------------
G1Q051_BCL2L2-01        --------------------------------------------------
G1TV33_BCL2L2-01        --------------------------------------------------
D3Z5F7_BCL2L2-01        --------------------------------------------------
G3V4B7_BCL2L2-10        --------------------------------------------------
A0A6I9LUT0_BCL2L2-      --------------------------------------------------
A0A8C3X592_BCL2L2-      --------------------------------------------------
A0A3Q9B4M8_BCL2L2-      --------------------------------------------------
A0A7T8CLX7_BCL2L2-      --------------------------------------------------
A0A8D0TJQ9_BCL2L2-      --------------------------------------------------
A0A4X1SF60_BCL2L2-      --------------------------------------------------
A0A4X1SF63_BCL2L2-      --------------------------------------------------
A0A8C0Q5E6_BCL2L2-      --------------------------------------------------
A0A8I3MNK9_BCL2L2-      --------------------------------------------------
A0A8I3RSU6_BCL2L2-      --------------------------------------------------
A0A673VAY7_BCL2L2-      --------------------------------------------------
A0A2I2UAE3_BCL2L2-      --------------------------------------------------
A0A8C8XCR9_BCL2L2-      --------------------------------------------------
A0A8C9J3S1_BCL2L2-      --------------------------------------------------
M3Y5X5_BCL2L2-01        --------------------------------------------------
A0A8C7EW82_BCL2L2-      --------------------------------------------------
A0A452SHI1_BCL2L2-      --------------------------------------------------
A0A384DPS8_BCL2L2-      --------------------------------------------------
A0A8C4LWK5_BCL2L2-      --------------------------------------------------
A0A8C6BK57_BCL2L2-      --------------------------------------------------
A0A8C9CXQ5_BCL2L2-      --------------------------------------------------
A0A8B8WSS7_BCL2L2-      --------------------------------------------------
W5QDH4_BCL2L2-02        --------------------------------------------------
A0A8C6CUC2_BCL2L2-      --------------------------------------------------
A0A452ECF0_BCL2L2-      --------------------------------------------------
A0A4W2D6A3_BCL2L2-      --------------------------------------------------
A0A4W2D6A3_BCL2L2-      --------------------------------------------------
A0A4W2GUJ7_BCL2L2-      gccccgcccctctctctggacgcatctctgggccccatcatcacccggcg
A0A4W2GUJ7_BCL2L2-      --------------------------------------------------
A0A8B9WT05_BCL2L2-      --------------------------------------------------
A0A4W2D6A3_BCL2L2-      --------------------------------------------------
A0A4W2D6A3_BCL2L2-      --------------------------------------------------
A0A4W2GUJ7_BCL2L2-      gccccgcccctctctctggacgcatctctgggccccatcatcacccggcg
A0A4W2GUJ7_BCL2L2-      --------------------------------------------------
Q05KI8_BCL2L2-01        --------------------------------------------------
A0A8C2VJ88_BCL2L2-      --------------------------------------------------
A0A286XQQ9_BCL2L2-      --------------------------------------------------
A0A8C2VJ88_BCL2L2-      --------------------------------------------------
A0A8D2APK0_BCL2L2-      --------------------------------------------------
A0A287D9B3_BCL2L2-      --------------------------------------------------
A0A8D2HGM1_BCL2L2-      --------------------------------------------------
A0A287D9B3_BCL2L2-      --------------------------------------------------
A0A8C9PGU3_BCL2L2-      --------------------------------------------------
W5QDH4_BCL2L2-01        --------------------------------------------------
A0A4W2GUJ7_BCL2L2-      --------------------------------------------------
A0A4W2GUJ7_BCL2L2-      --------------------------------------------------
A0A4W2D6A3_BCL2L2-      --------------------------------------------------
A0A4W2GUJ7_BCL2L2-      --------------------------------------------------
A0A4W2D6A3_BCL2L2-      --------------------------------------------------
A0A4W2GUJ7_BCL2L2-      --------------------------------------------------
A0A4W2GUJ7_BCL2L2-      --------------------------------------------------
A0A4W2GUJ7_BCL2L2-      --------------------------------------------------
A0A5F5PML6_BCL2L2-      --------------------------------------------------
A0A5F5PML6_BCL2L2-      --------------------------------------------------
A0A8C5L5C6_BCL2L2-      --------------------------------------------------
A0A8C0Q5E6_BCL2L2-      --------------------------------------------------
A0A8I3MNK9_BCL2L2-      --------------------------------------------------
A0A8I3RSU6_BCL2L2-      --------------------------------------------------
A0A8I3MNK9_BCL2L2-      --------------------------------------------------
A0A667I624_BCL2L2-      --------------------------------------------------
G1LKF5_BCL2L2-01        --------------------------------------------------
G1LKF5_BCL2L2-02        --------------------------------------------------
A0A384DPS8_BCL2L2-      --------------------------------------------------
A0A384DPS8_BCL2L2-      --------------------------------------------------
A0A8C6RJE0_BCL2L2-      --------------------------------------------------
A0A671DWB3_BCL2L2-      --------------------------------------------------
A0A250YBR2_BCL2L2-      --------------------------------------------------
A0A250YBR2_BCL2L2-      --------------------------------------------------
O88996_BCL2L2-01        --------------------------------------------------
Q7TS60_BCL2L2-01        --------------------------------------------------
A0A671DWB3_BCL2L2-      --------------------------------------------------
A0A8C6RJE0_BCL2L2-      --------------------------------------------------
A0A4W2D6A3_BCL2L2-      --------------------------------------------------
A0A4W2GUJ7_BCL2L2-      --------------------------------------------------
A0A4W2D6A3_BCL2L2-      --------------------------------------------------
A0A4W2GUJ7_BCL2L2-      --------------------------------------------------
A0A8C8YZD8_BCL2L2-      --------------------------------------------------
A0A8B7FJ73_BCL2L2-      --------------------------------------------------
A0A2K6GWM6_BCL2L2-      --------------------------------------------------
A0A8D0TJQ9_BCL2L2-      --------------------------------------------------
A0A482LX62_BCL2L2-      --------------------------------------------------
A0A4X1SF63_BCL2L2-      --------------------------------------------------
A0A4D6NWN1_BCL2L2-      --------------------------------------------------
A0A4X1SF60_BCL2L2-      --------------------------------------------------
A0A4X1SF63_BCL2L2-      --------------------------------------------------
A0A8D0TJQ9_BCL2L2-      --------------------------------------------------
A0A4X1SF60_BCL2L2-      --------------------------------------------------
A0A8D0TJQ9_BCL2L2-      --------------------------------------------------
H0XR82_BCL2L2-01        --------------------------------------------------
A0A4X1SF63_BCL2L2-      --------------------------------------------------
A0A4X1SF63_BCL2L2-      --------------------------------------------------
A0A8D0TJQ9_BCL2L2-      --------------------------------------------------
A0A8B7FJ73_BCL2L2-      --------------------------------------------------
A0A2K6GWM6_BCL2L2-      --------------------------------------------------
A0A5F5PML6_BCL2L2-      --------------------------------------------------
A0A8C8YZD8_BCL2L2-      --------------------------------------------------
A0A8B7FJ73_BCL2L2-      --------------------------------------------------
A0A8B7FJ73_BCL2L2-      --------------------------------------------------
A0A2K6GWM6_BCL2L2-      --------------------------------------------------
A0A2K6GWM6_BCL2L2-      --------------------------------------------------
A0A8C0Q5E6_BCL2L2-      --------------------------------------------------
A0A8I3MNK9_BCL2L2-      --------------------------------------------------
A0A8I3RSU6_BCL2L2-      --------------------------------------------------
A0A667I624_BCL2L2-      --------------------------------------------------
G1P3J2_BCL2L2-01        --------------------------------------------------
G3TMU7_BCL2L2-01        --------------------------------------------------
A0A2K6TM77_BCL2L2-      --------------------------------------------------
A0A2K6TM77_BCL2L2-      --------------------------------------------------
A0A2K5CWY6_BCL2L2-      --------------------------------------------------
A0A2K5CWY6_BCL2L2-      --------------------------------------------------
A0A2K5CWY6_BCL2L2-      --------------------------------------------------
U3CRF8_BCL2L2-02        --------------------------------------------------
U3CRF8_BCL2L2-03        --------------------------------------------------
A0A2I3GEA7_BCL2L2-      --------------------------------------------------
A0A8I5U2F2_BCL2L2-      --------------------------------------------------
A0A2I2YPX6_BCL2L2-      --------------------------------------------------
A0A2I2YPX6_BCL2L2-      --------------------------------------------------
U3CRF8_BCL2L2-01        --------------------------------------------------
A0A2K6TM77_BCL2L2-      --------------------------------------------------
A0A2K6TM77_BCL2L2-      --------------------------------------------------
A0A2K5V0Q3_BCL2L2-      --------------------------------------------------
A0A2K6EA59_BCL2L2-      --------------------------------------------------
A0A2K6EA59_BCL2L2-      --------------------------------------------------
A0A2K5MZX9_BCL2L2-      --------------------------------------------------
A0A2K5MZX9_BCL2L2-      --------------------------------------------------
A0A2K5MZX9_BCL2L2-      --------------------------------------------------
A0A2K5V0Q3_BCL2L2-      --------------------------------------------------
F7G4L5_BCL2L2-03        --------------------------------------------------
A0A2K6EA59_BCL2L2-      --------------------------------------------------
A0A2K6AI25_BCL2L2-      --------------------------------------------------
A0A8D2FJU1_BCL2L2-      --------------------------------------------------
A0A2R9A2Q3_BCL2L2-      --------------------------------------------------
A0A2R9A2Q3_BCL2L2-      --------------------------------------------------
A0A2K6RW35_BCL2L2-      --------------------------------------------------
A0A2K5HEJ9_BCL2L2-      --------------------------------------------------
A0A2K5HEJ9_BCL2L2-      --------------------------------------------------
A0A8I5U2F2_BCL2L2-      --------------------------------------------------
A0A2K5CWY6_BCL2L2-      --------------------------------------------------
A0A8I5U2F2_BCL2L2-      --------------------------------------------------
A0A2K6RW35_BCL2L2-      --------------------------------------------------
A0A2K6RW35_BCL2L2-      --------------------------------------------------
A0A2K6ME72_BCL2L2-      --------------------------------------------------
A0A2R9A2Q3_BCL2L2-      --------------------------------------------------
A0A2K5MZX9_BCL2L2-      --------------------------------------------------
A0A2K6EA59_BCL2L2-      --------------------------------------------------
A0A2K6RW35_BCL2L2-      --------------------------------------------------
A0A2K6ME72_BCL2L2-      --------------------------------------------------
A0A8D2FJU1_BCL2L2-      --------------------------------------------------
A0A8D2FJU1_BCL2L2-      --------------------------------------------------
A0A8C9H679_BCL2L2-      --------------------------------------------------
A0A8C9H679_BCL2L2-      --------------------------------------------------
A0A2I3MUE4_BCL2L2-      --------------------------------------------------
A0A2I3GEA7_BCL2L2-      --------------------------------------------------
A0A2I3GEA7_BCL2L2-      --------------------------------------------------
A0A2K6AI25_BCL2L2-      --------------------------------------------------
A0A2K6AI25_BCL2L2-      --------------------------------------------------
F7G4L5_BCL2L2-02        --------------------------------------------------
F7G4L5_BCL2L2-01        --------------------------------------------------
A0A2K5V0Q3_BCL2L2-      --------------------------------------------------
A0A2K5V0Q3_BCL2L2-      --------------------------------------------------
A0A2K5V0Q3_BCL2L2-      --------------------------------------------------
A0A2K5V0Q3_BCL2L2-      --------------------------------------------------
A0A2K5V0Q3_BCL2L2-      --------------------------------------------------
A0A2K5V0Q3_BCL2L2-      --------------------------------------------------
A0A2K5V0Q3_BCL2L2-      --------------------------------------------------
G3V4B7_BCL2L2-08        --------------------------------------------------
G3V4B7_BCL2L2-07        --------------------------------------------------
G3V4B7_BCL2L2-06        --------------------------------------------------
G3V4B7_BCL2L2-05        --------------------------------------------------
G3V4B7_BCL2L2-04        --------------------------------------------------
G3V4B7_BCL2L2-03        --------------------------------------------------
G3V4B7_BCL2L2-02        --------------------------------------------------
A0A2I2YPX6_BCL2L2-      --------------------------------------------------
A0A2I2YPX6_BCL2L2-      --------------------------------------------------
A0A2K5HEJ9_BCL2L2-      --------------------------------------------------
A0A0D9RU30_BCL2L2-      --------------------------------------------------
G3V4B7_BCL2L2-01        --------------------------------------------------
G3V4B7_BCL2L2-09        --------------------------------------------------
                                                                          

H3AAS7_BCL2L2-02        --------------------------------------------------
H3AAS7_BCL2L2-01        --------------------------------------------------
Q6GP82_BCL2L2-01        --------------------------------------------------
A0A8C5PJB3_BCL2L2-      --------------------------------------------------
A0A4X2LP96_BCL2L2-      --------------------------------------------------
A0A5F8HG85_BCL2L2-      --------------------------------------------------
A0A5F8HG85_BCL2L2-      --------------------------------------------------
A0A5F8HG85_BCL2L2-      --------------------------------------------------
F7G6M3_BCL2L2-01        --------------------------------------------------
G1Q051_BCL2L2-01        --------------------------------------------------
G1TV33_BCL2L2-01        --------------------------------------------------
D3Z5F7_BCL2L2-01        --------------------------------------------------
G3V4B7_BCL2L2-10        --------------------------------------------------
A0A6I9LUT0_BCL2L2-      --------------------------------------------------
A0A8C3X592_BCL2L2-      --------------------------------------------------
A0A3Q9B4M8_BCL2L2-      --------------------------------------------------
A0A7T8CLX7_BCL2L2-      --------------------------------------------------
A0A8D0TJQ9_BCL2L2-      --------------------------------------------------
A0A4X1SF60_BCL2L2-      --------------------------------------------------
A0A4X1SF63_BCL2L2-      --------------------------------------------------
A0A8C0Q5E6_BCL2L2-      --------------------------------------------------
A0A8I3MNK9_BCL2L2-      --------------------------------------------------
A0A8I3RSU6_BCL2L2-      --------------------------------------------------
A0A673VAY7_BCL2L2-      --------------------------------------------------
A0A2I2UAE3_BCL2L2-      --------------------------------------------------
A0A8C8XCR9_BCL2L2-      --------------------------------------------------
A0A8C9J3S1_BCL2L2-      --------------------------------------------------
M3Y5X5_BCL2L2-01        --------------------------------------------------
A0A8C7EW82_BCL2L2-      --------------------------------------------------
A0A452SHI1_BCL2L2-      --------------------------------------------------
A0A384DPS8_BCL2L2-      --------------------------------------------------
A0A8C4LWK5_BCL2L2-      --------------------------------------------------
A0A8C6BK57_BCL2L2-      --------------------------------------------------
A0A8C9CXQ5_BCL2L2-      --------------------------------------------------
A0A8B8WSS7_BCL2L2-      --------------------------------------------------
W5QDH4_BCL2L2-02        ---------------------------------------atgggctggcc
A0A8C6CUC2_BCL2L2-      --------------------------------------------------
A0A452ECF0_BCL2L2-      --------------------------------------------------
A0A4W2D6A3_BCL2L2-      --------------------------------------------------
A0A4W2D6A3_BCL2L2-      --------------------------------------------------
A0A4W2GUJ7_BCL2L2-      ccgggccctccctcccgccccccctttctcctccctccttccttccctcc
A0A4W2GUJ7_BCL2L2-      --------------------------------------------------
A0A8B9WT05_BCL2L2-      --------------------------------------------------
A0A4W2D6A3_BCL2L2-      --------------------------------------------------
A0A4W2D6A3_BCL2L2-      --------------------------------------------------
A0A4W2GUJ7_BCL2L2-      ccgggccctccctcccgccccccctttctcctccctccttccttccctcc
A0A4W2GUJ7_BCL2L2-      --------------------------------------------------
Q05KI8_BCL2L2-01        --------------------------------------------------
A0A8C2VJ88_BCL2L2-      --------------------------------------------------
A0A286XQQ9_BCL2L2-      --------------------------------------------------
A0A8C2VJ88_BCL2L2-      --------------------------------------------------
A0A8D2APK0_BCL2L2-      --------------------------------------------------
A0A287D9B3_BCL2L2-      --------------------------------------------------
A0A8D2HGM1_BCL2L2-      --------------------------------------------------
A0A287D9B3_BCL2L2-      --------------------------------------------------
A0A8C9PGU3_BCL2L2-      --------------------------------------------------
W5QDH4_BCL2L2-01        ---------------------------------------atgggctggcc
A0A4W2GUJ7_BCL2L2-      --------------------------------------------------
A0A4W2GUJ7_BCL2L2-      --------------------------------------------------
A0A4W2D6A3_BCL2L2-      --------------------------------------------------
A0A4W2GUJ7_BCL2L2-      --------------------------------------------------
A0A4W2D6A3_BCL2L2-      --------------------------------------------------
A0A4W2GUJ7_BCL2L2-      --------------------------------------------------
A0A4W2GUJ7_BCL2L2-      --------------------------------------------------
A0A4W2GUJ7_BCL2L2-      --------------------------------------------------
A0A5F5PML6_BCL2L2-      --------------------------------------------------
A0A5F5PML6_BCL2L2-      --------------------------------------------------
A0A8C5L5C6_BCL2L2-      --------------------------------------------------
A0A8C0Q5E6_BCL2L2-      --------------------------------------------------
A0A8I3MNK9_BCL2L2-      --------------------------------------------------
A0A8I3RSU6_BCL2L2-      --------------------------------------------------
A0A8I3MNK9_BCL2L2-      --------------------------------------------------
A0A667I624_BCL2L2-      --------------------------------------------------
G1LKF5_BCL2L2-01        --------------------------------------------------
G1LKF5_BCL2L2-02        --------------------------------------------------
A0A384DPS8_BCL2L2-      --------------------------------------------------
A0A384DPS8_BCL2L2-      --------------------------------------------------
A0A8C6RJE0_BCL2L2-      --------------------------------------------------
A0A671DWB3_BCL2L2-      --------------------------------------------------
A0A250YBR2_BCL2L2-      --------------------------------------------------
A0A250YBR2_BCL2L2-      --------------------------------------------------
O88996_BCL2L2-01        --------------------------------------------------
Q7TS60_BCL2L2-01        --------------------------------------------------
A0A671DWB3_BCL2L2-      --------------------------------------------------
A0A8C6RJE0_BCL2L2-      --------------------------------------------------
A0A4W2D6A3_BCL2L2-      --------------------------------------------------
A0A4W2GUJ7_BCL2L2-      --------------------------------------------------
A0A4W2D6A3_BCL2L2-      --------------------------------------------------
A0A4W2GUJ7_BCL2L2-      --------------------------------------------------
A0A8C8YZD8_BCL2L2-      --------------------------------------------------
A0A8B7FJ73_BCL2L2-      --------------------------------------------------
A0A2K6GWM6_BCL2L2-      --------------------------------------------------
A0A8D0TJQ9_BCL2L2-      --------------------------------------------------
A0A482LX62_BCL2L2-      --------------------------------------------------
A0A4X1SF63_BCL2L2-      --------------------------------------------------
A0A4D6NWN1_BCL2L2-      --------------------------------------------------
A0A4X1SF60_BCL2L2-      --------------------------------------------------
A0A4X1SF63_BCL2L2-      --------------------------------------------------
A0A8D0TJQ9_BCL2L2-      --------------------------------------------------
A0A4X1SF60_BCL2L2-      --------------------------------------------------
A0A8D0TJQ9_BCL2L2-      --------------------------------------------------
H0XR82_BCL2L2-01        --------------------------------------------------
A0A4X1SF63_BCL2L2-      --------------------------------------------------
A0A4X1SF63_BCL2L2-      --------------------------------------------------
A0A8D0TJQ9_BCL2L2-      --------------------------------------------------
A0A8B7FJ73_BCL2L2-      --------------------------------------------------
A0A2K6GWM6_BCL2L2-      --------------------------------------------------
A0A5F5PML6_BCL2L2-      --------------------------------------------------
A0A8C8YZD8_BCL2L2-      --------------------------------------------------
A0A8B7FJ73_BCL2L2-      --------------------------------------------------
A0A8B7FJ73_BCL2L2-      --------------------------------------------------
A0A2K6GWM6_BCL2L2-      --------------------------------------------------
A0A2K6GWM6_BCL2L2-      --------------------------------------------------
A0A8C0Q5E6_BCL2L2-      --------------------------------------------------
A0A8I3MNK9_BCL2L2-      --------------------------------------------------
A0A8I3RSU6_BCL2L2-      --------------------------------------------------
A0A667I624_BCL2L2-      --------------------------------------------------
G1P3J2_BCL2L2-01        --------------------------------------------------
G3TMU7_BCL2L2-01        --------------------------------------------------
A0A2K6TM77_BCL2L2-      --------------------------------------------------
A0A2K6TM77_BCL2L2-      --------------------------------------------------
A0A2K5CWY6_BCL2L2-      --------------------------------------------------
A0A2K5CWY6_BCL2L2-      --------------------------------------------------
A0A2K5CWY6_BCL2L2-      --------------------------------------------------
U3CRF8_BCL2L2-02        --------------------------------------------------
U3CRF8_BCL2L2-03        --------------------------------------------------
A0A2I3GEA7_BCL2L2-      --------------------------------------------------
A0A8I5U2F2_BCL2L2-      --------------------------------------------------
A0A2I2YPX6_BCL2L2-      --------------------------------------------------
A0A2I2YPX6_BCL2L2-      --------------------------------------------------
U3CRF8_BCL2L2-01        --------------------------------------------------
A0A2K6TM77_BCL2L2-      --------------------------------------------------
A0A2K6TM77_BCL2L2-      --------------------------------------------------
A0A2K5V0Q3_BCL2L2-      --------------------------------------------------
A0A2K6EA59_BCL2L2-      --------------------------------------------------
A0A2K6EA59_BCL2L2-      --------------------------------------------------
A0A2K5MZX9_BCL2L2-      --------------------------------------------------
A0A2K5MZX9_BCL2L2-      --------------------------------------------------
A0A2K5MZX9_BCL2L2-      --------------------------------------------------
A0A2K5V0Q3_BCL2L2-      --------------------------------------------------
F7G4L5_BCL2L2-03        --------------------------------------------------
A0A2K6EA59_BCL2L2-      --------------------------------------------------
A0A2K6AI25_BCL2L2-      --------------------------------------------------
A0A8D2FJU1_BCL2L2-      --------------------------------------------------
A0A2R9A2Q3_BCL2L2-      --------------------------------------------------
A0A2R9A2Q3_BCL2L2-      --------------------------------------------------
A0A2K6RW35_BCL2L2-      --------------------------------------------------
A0A2K5HEJ9_BCL2L2-      --------------------------------------------------
A0A2K5HEJ9_BCL2L2-      --------------------------------------------------
A0A8I5U2F2_BCL2L2-      --------------------------------------------------
A0A2K5CWY6_BCL2L2-      --------------------------------------------------
A0A8I5U2F2_BCL2L2-      --------------------------------------------------
A0A2K6RW35_BCL2L2-      --------------------------------------------------
A0A2K6RW35_BCL2L2-      --------------------------------------------------
A0A2K6ME72_BCL2L2-      --------------------------------------------------
A0A2R9A2Q3_BCL2L2-      --------------------------------------------------
A0A2K5MZX9_BCL2L2-      --------------------------------------------------
A0A2K6EA59_BCL2L2-      --------------------------------------------------
A0A2K6RW35_BCL2L2-      --------------------------------------------------
A0A2K6ME72_BCL2L2-      --------------------------------------------------
A0A8D2FJU1_BCL2L2-      --------------------------------------------------
A0A8D2FJU1_BCL2L2-      --------------------------------------------------
A0A8C9H679_BCL2L2-      --------------------------------------------------
A0A8C9H679_BCL2L2-      --------------------------------------------------
A0A2I3MUE4_BCL2L2-      --------------------------------------------------
A0A2I3GEA7_BCL2L2-      --------------------------------------------------
A0A2I3GEA7_BCL2L2-      --------------------------------------------------
A0A2K6AI25_BCL2L2-      --------------------------------------------------
A0A2K6AI25_BCL2L2-      --------------------------------------------------
F7G4L5_BCL2L2-02        --------------------------------------------------
F7G4L5_BCL2L2-01        --------------------------------------------------
A0A2K5V0Q3_BCL2L2-      --------------------------------------------------
A0A2K5V0Q3_BCL2L2-      --------------------------------------------------
A0A2K5V0Q3_BCL2L2-      --------------------------------------------------
A0A2K5V0Q3_BCL2L2-      --------------------------------------------------
A0A2K5V0Q3_BCL2L2-      --------------------------------------------------
A0A2K5V0Q3_BCL2L2-      --------------------------------------------------
A0A2K5V0Q3_BCL2L2-      --------------------------------------------------
G3V4B7_BCL2L2-08        --------------------------------------------------
G3V4B7_BCL2L2-07        --------------------------------------------------
G3V4B7_BCL2L2-06        --------------------------------------------------
G3V4B7_BCL2L2-05        --------------------------------------------------
G3V4B7_BCL2L2-04        --------------------------------------------------
G3V4B7_BCL2L2-03        --------------------------------------------------
G3V4B7_BCL2L2-02        --------------------------------------------------
A0A2I2YPX6_BCL2L2-      --------------------------------------------------
A0A2I2YPX6_BCL2L2-      --------------------------------------------------
A0A2K5HEJ9_BCL2L2-      --------------------------------------------------
A0A0D9RU30_BCL2L2-      --------------------------------------------------
G3V4B7_BCL2L2-01        --------------------------------------------------
G3V4B7_BCL2L2-09        --------------------------------------------------
                                                                          

H3AAS7_BCL2L2-02        --------------------------------------------------
H3AAS7_BCL2L2-01        --------------------------------------------------
Q6GP82_BCL2L2-01        --------------------------------------------------
A0A8C5PJB3_BCL2L2-      --------------------------------------------------
A0A4X2LP96_BCL2L2-      --------------------------------------------------
A0A5F8HG85_BCL2L2-      --------------------------------------------------
A0A5F8HG85_BCL2L2-      --------------------------------------------------
A0A5F8HG85_BCL2L2-      --------------------------------------------------
F7G6M3_BCL2L2-01        --------------------------------------------------
G1Q051_BCL2L2-01        --------------------------------------------------
G1TV33_BCL2L2-01        --------------------------------------------------
D3Z5F7_BCL2L2-01        --------------------------------------------------
G3V4B7_BCL2L2-10        --------------------------------------------------
A0A6I9LUT0_BCL2L2-      --------------------------------------------------
A0A8C3X592_BCL2L2-      --------------------------------------------------
A0A3Q9B4M8_BCL2L2-      --------------------------------------------------
A0A7T8CLX7_BCL2L2-      --------------------------------------------------
A0A8D0TJQ9_BCL2L2-      --------------------------------------------------
A0A4X1SF60_BCL2L2-      --------------------------------------------------
A0A4X1SF63_BCL2L2-      --------------------------------------------------
A0A8C0Q5E6_BCL2L2-      --------------------------------------------------
A0A8I3MNK9_BCL2L2-      --------------------------------------------------
A0A8I3RSU6_BCL2L2-      --------------------------------------------------
A0A673VAY7_BCL2L2-      --------------------------------------------------
A0A2I2UAE3_BCL2L2-      --------------------------------------------------
A0A8C8XCR9_BCL2L2-      --------------------------------------------------
A0A8C9J3S1_BCL2L2-      --------------------------------------------------
M3Y5X5_BCL2L2-01        -aagcctgaagcaccccttctggctttccaaccatatattcacgccagcc
A0A8C7EW82_BCL2L2-      --------------------------------------------------
A0A452SHI1_BCL2L2-      --------------------------------------------------
A0A384DPS8_BCL2L2-      --------------------------------------------------
A0A8C4LWK5_BCL2L2-      --------------------------------------------------
A0A8C6BK57_BCL2L2-      --------------------------------------------------
A0A8C9CXQ5_BCL2L2-      --------------------------------------------------
A0A8B8WSS7_BCL2L2-      --------------------------------------------------
W5QDH4_BCL2L2-02        aaacctgaaatacctccttctgggcctctcaccatatattcatgccagtc
A0A8C6CUC2_BCL2L2-      --------------------------------------------------
A0A452ECF0_BCL2L2-      --------------------------------------------------
A0A4W2D6A3_BCL2L2-      --------------------------------------------------
A0A4W2D6A3_BCL2L2-      --------------------------------------------------
A0A4W2GUJ7_BCL2L2-      cttcctccctgtctccctccctcccagctcctgcaccaggaaacagccgg
A0A4W2GUJ7_BCL2L2-      --------------------------------------------------
A0A8B9WT05_BCL2L2-      --------------------------------------------------
A0A4W2D6A3_BCL2L2-      --------------------------------------------------
A0A4W2D6A3_BCL2L2-      --------------------------------------------------
A0A4W2GUJ7_BCL2L2-      cttcctccctgtctccctccctcccagctcctgcaccaggaaacagccgg
A0A4W2GUJ7_BCL2L2-      --------------------------------------------------
Q05KI8_BCL2L2-01        --------------------------------------------------
A0A8C2VJ88_BCL2L2-      --------------------------------------------------
A0A286XQQ9_BCL2L2-      --------------------------------------------------
A0A8C2VJ88_BCL2L2-      --------------------------------------------------
A0A8D2APK0_BCL2L2-      --------------------------------------------------
A0A287D9B3_BCL2L2-      --------------------------------------------------
A0A8D2HGM1_BCL2L2-      --------------------------------------------------
A0A287D9B3_BCL2L2-      --------------------------------------------------
A0A8C9PGU3_BCL2L2-      --------------------------------------------------
W5QDH4_BCL2L2-01        aaacctgaaatacctccttctgggcctctcaccatatattcatgccagtc
A0A4W2GUJ7_BCL2L2-      --------------------------------------------------
A0A4W2GUJ7_BCL2L2-      --------------------------------------------------
A0A4W2D6A3_BCL2L2-      --------------------------------------------------
A0A4W2GUJ7_BCL2L2-      --------------------------------------------------
A0A4W2D6A3_BCL2L2-      --------------------------------------------------
A0A4W2GUJ7_BCL2L2-      --------------------------------------------------
A0A4W2GUJ7_BCL2L2-      --------------------------------------------------
A0A4W2GUJ7_BCL2L2-      --------------------------------------------------
A0A5F5PML6_BCL2L2-      --------------------------------------------------
A0A5F5PML6_BCL2L2-      --------------------------------------------------
A0A8C5L5C6_BCL2L2-      --------------------------------------------------
A0A8C0Q5E6_BCL2L2-      --------------------------------------------------
A0A8I3MNK9_BCL2L2-      --------------------------------------------------
A0A8I3RSU6_BCL2L2-      --------------------------------------------------
A0A8I3MNK9_BCL2L2-      --------------------------------------------------
A0A667I624_BCL2L2-      --------------------------------------------------
G1LKF5_BCL2L2-01        --------------------------------------------------
G1LKF5_BCL2L2-02        --------------------------------------------------
A0A384DPS8_BCL2L2-      --------------------------------------------------
A0A384DPS8_BCL2L2-      --------------------------------------------------
A0A8C6RJE0_BCL2L2-      --------------------------------------------------
A0A671DWB3_BCL2L2-      --------------------------------------------------
A0A250YBR2_BCL2L2-      --------------------------------------------------
A0A250YBR2_BCL2L2-      --------------------------------------------------
O88996_BCL2L2-01        --------------------------------------------------
Q7TS60_BCL2L2-01        -atgtccctttttggtctctgtcaatatttttcatatatttatgtcagtc
A0A671DWB3_BCL2L2-      --------------------------------------------------
A0A8C6RJE0_BCL2L2-      --------------------------------------------------
A0A4W2D6A3_BCL2L2-      --------------------------------------------------
A0A4W2GUJ7_BCL2L2-      --------------------------------------------------
A0A4W2D6A3_BCL2L2-      --------------------------------------------------
A0A4W2GUJ7_BCL2L2-      --------------------------------------------------
A0A8C8YZD8_BCL2L2-      --------------------------------------------------
A0A8B7FJ73_BCL2L2-      --------------------------------------------------
A0A2K6GWM6_BCL2L2-      --------------------------------------------------
A0A8D0TJQ9_BCL2L2-      --------------------------------------------------
A0A482LX62_BCL2L2-      --------------------------------------------------
A0A4X1SF63_BCL2L2-      --------------------------------------------------
A0A4D6NWN1_BCL2L2-      --------------------------------------------------
A0A4X1SF60_BCL2L2-      --------------------------------------------------
A0A4X1SF63_BCL2L2-      --------------------------------------------------
A0A8D0TJQ9_BCL2L2-      --------------------------------------------------
A0A4X1SF60_BCL2L2-      --------------------------------------------------
A0A8D0TJQ9_BCL2L2-      --------------------------------------------------
H0XR82_BCL2L2-01        --------------------------------------------------
A0A4X1SF63_BCL2L2-      --------------------------------------------------
A0A4X1SF63_BCL2L2-      --------------------------------------------------
A0A8D0TJQ9_BCL2L2-      --------------------------------------------------
A0A8B7FJ73_BCL2L2-      --------------------------------------------------
A0A2K6GWM6_BCL2L2-      --------------------------------------------------
A0A5F5PML6_BCL2L2-      --------------------------------------------------
A0A8C8YZD8_BCL2L2-      --------------------------------------------------
A0A8B7FJ73_BCL2L2-      --------------------------------------------------
A0A8B7FJ73_BCL2L2-      --------------------------------------------------
A0A2K6GWM6_BCL2L2-      --------------------------------------------------
A0A2K6GWM6_BCL2L2-      --------------------------------------------------
A0A8C0Q5E6_BCL2L2-      --------------------------------------------------
A0A8I3MNK9_BCL2L2-      --------------------------------------------------
A0A8I3RSU6_BCL2L2-      --------------------------------------------------
A0A667I624_BCL2L2-      --------------------------------------------------
G1P3J2_BCL2L2-01        -cctgaaatgctccattctgtgtctctgactaaatatactcatgccagtc
G3TMU7_BCL2L2-01        ----------------------------------tatattcatgttagtc
A0A2K6TM77_BCL2L2-      --------------------------------------------------
A0A2K6TM77_BCL2L2-      ----------------------------------------------catc
A0A2K5CWY6_BCL2L2-      ----------------------------------------------catc
A0A2K5CWY6_BCL2L2-      ----------atgccccttctggttctctgtccatatattcatgccagtc
A0A2K5CWY6_BCL2L2-      --------------------------------------------------
U3CRF8_BCL2L2-02        --------------------------------------------------
U3CRF8_BCL2L2-03        --------------------------------------------------
A0A2I3GEA7_BCL2L2-      --------------------------------------------------
A0A8I5U2F2_BCL2L2-      --------------------------------------------------
A0A2I2YPX6_BCL2L2-      --------------------------------------------------
A0A2I2YPX6_BCL2L2-      --------------------------------------------------
U3CRF8_BCL2L2-01        --------------------------------------------------
A0A2K6TM77_BCL2L2-      --------------------------------------------------
A0A2K6TM77_BCL2L2-      --------------------------------------------------
A0A2K5V0Q3_BCL2L2-      --------------------------------------------------
A0A2K6EA59_BCL2L2-      --------------------------------------------------
A0A2K6EA59_BCL2L2-      --------------------------------------------------
A0A2K5MZX9_BCL2L2-      --------------------------------------------------
A0A2K5MZX9_BCL2L2-      --------------------------------------------------
A0A2K5MZX9_BCL2L2-      --------------------------------------------------
A0A2K5V0Q3_BCL2L2-      --------------------------------------------------
F7G4L5_BCL2L2-03        --------------------------------------------------
A0A2K6EA59_BCL2L2-      --------------------------------------------------
A0A2K6AI25_BCL2L2-      --------------------------------------------------
A0A8D2FJU1_BCL2L2-      --------------------------------------------------
A0A2R9A2Q3_BCL2L2-      --------------------------------------------------
A0A2R9A2Q3_BCL2L2-      --------------------------------------------------
A0A2K6RW35_BCL2L2-      --------------------------------------------------
A0A2K5HEJ9_BCL2L2-      --------------------------------------------------
A0A2K5HEJ9_BCL2L2-      --------------------------------------------------
A0A8I5U2F2_BCL2L2-      --------------------------------------------------
A0A2K5CWY6_BCL2L2-      --------------------------------------------------
A0A8I5U2F2_BCL2L2-      --------------------------------------------------
A0A2K6RW35_BCL2L2-      --------------------------------------------------
A0A2K6RW35_BCL2L2-      --------------------------------------------------
A0A2K6ME72_BCL2L2-      --------------------------------------------------
A0A2R9A2Q3_BCL2L2-      --------------------------------------------------
A0A2K5MZX9_BCL2L2-      --------------------------------------------------
A0A2K6EA59_BCL2L2-      --------------------------------------------------
A0A2K6RW35_BCL2L2-      --------------------------------------------------
A0A2K6ME72_BCL2L2-      --------------------------------------------------
A0A8D2FJU1_BCL2L2-      --------------------------------------------------
A0A8D2FJU1_BCL2L2-      --------------------------------------------------
A0A8C9H679_BCL2L2-      --------------------------------------------------
A0A8C9H679_BCL2L2-      --------------------------------------------------
A0A2I3MUE4_BCL2L2-      --------------------------------------------------
A0A2I3GEA7_BCL2L2-      --------------------------------------------------
A0A2I3GEA7_BCL2L2-      --------------------------------------------------
A0A2K6AI25_BCL2L2-      --------------------------------------------------
A0A2K6AI25_BCL2L2-      --------------------------------------------------
F7G4L5_BCL2L2-02        --------------------------------------------------
F7G4L5_BCL2L2-01        --------------------------------------------------
A0A2K5V0Q3_BCL2L2-      ----------atgccccttctgattctctctccatatattcatgccagtg
A0A2K5V0Q3_BCL2L2-      ----------atgccccttctgattctctctccatatattcatgccagtg
A0A2K5V0Q3_BCL2L2-      ----------atgccccttctgattctctctccatatattcatgccagtg
A0A2K5V0Q3_BCL2L2-      ----------atgccccttctgattctctctccatatattcatgccagtg
A0A2K5V0Q3_BCL2L2-      ----------atgccccttctgattctctctccatatattcatgccagtg
A0A2K5V0Q3_BCL2L2-      --------------------------------------------------
A0A2K5V0Q3_BCL2L2-      --------------------------------------------------
G3V4B7_BCL2L2-08        --------------------------------------------------
G3V4B7_BCL2L2-07        --------------------------------------------------
G3V4B7_BCL2L2-06        --------------------------------------------------
G3V4B7_BCL2L2-05        --------------------------------------------------
G3V4B7_BCL2L2-04        --------------------------------------------------
G3V4B7_BCL2L2-03        --------------------------------------------------
G3V4B7_BCL2L2-02        --------------------------------------------------
A0A2I2YPX6_BCL2L2-      --------------------------------------------------
A0A2I2YPX6_BCL2L2-      --------------------------------------------------
A0A2K5HEJ9_BCL2L2-      --------------------------------------------------
A0A0D9RU30_BCL2L2-      --------------------------------------------------
G3V4B7_BCL2L2-01        --------------------------------------------------
G3V4B7_BCL2L2-09        --------------------------------------------------
                                                                          

H3AAS7_BCL2L2-02        -----------------------------atg------------------
H3AAS7_BCL2L2-01        -----------------------------atg------------------
Q6GP82_BCL2L2-01        -----------------------------atg------------------
A0A8C5PJB3_BCL2L2-      ---------------------------ccggg------------------
A0A4X2LP96_BCL2L2-      -----------------------------atg------------------
A0A5F8HG85_BCL2L2-      -----------------------------atg------------------
A0A5F8HG85_BCL2L2-      -----------------------------atg------------------
A0A5F8HG85_BCL2L2-      -----------------------------atg------------------
F7G6M3_BCL2L2-01        -----------------------------atg------------------
G1Q051_BCL2L2-01        -----------------------------atgaatgaattttctctagac
G1TV33_BCL2L2-01        -----------------------------atg------------------
D3Z5F7_BCL2L2-01        -----------------------------atg------------------
G3V4B7_BCL2L2-10        --------------------------------------------------
A0A6I9LUT0_BCL2L2-      -----------------------------atg------------------
A0A8C3X592_BCL2L2-      -----------------------------atg------------------
A0A3Q9B4M8_BCL2L2-      -----------------------------atg------------------
A0A7T8CLX7_BCL2L2-      --------------------------------------------------
A0A8D0TJQ9_BCL2L2-      -----------------------------atg------------------
A0A4X1SF60_BCL2L2-      -----------------------------atg------------------
A0A4X1SF63_BCL2L2-      -----------------------------atg------------------
A0A8C0Q5E6_BCL2L2-      -----------------------------atg------------------
A0A8I3MNK9_BCL2L2-      -----------------------------atg------------------
A0A8I3RSU6_BCL2L2-      -----------------------------atg------------------
A0A673VAY7_BCL2L2-      -----------------------------atg------------------
A0A2I2UAE3_BCL2L2-      -----------------------------atg------------------
A0A8C8XCR9_BCL2L2-      -----------------------------atg------------------
A0A8C9J3S1_BCL2L2-      -----------------------------atg------------------
M3Y5X5_BCL2L2-01        tttcatccttgactcttacagccgcccggatg------------------
A0A8C7EW82_BCL2L2-      -----------------------------atg------------------
A0A452SHI1_BCL2L2-      -----------------------------atg------------------
A0A384DPS8_BCL2L2-      -----------------------------atg------------------
A0A8C4LWK5_BCL2L2-      -----------------------------atg------------------
A0A8C6BK57_BCL2L2-      -----------------------------atg------------------
A0A8C9CXQ5_BCL2L2-      -----------------------------atg------------------
A0A8B8WSS7_BCL2L2-      -----------------------------atg------------------
W5QDH4_BCL2L2-02        ttttatgtttgactccaacagccgcccggatg------------------
A0A8C6CUC2_BCL2L2-      -----------------------------atg------------------
A0A452ECF0_BCL2L2-      -----------------------------atg------------------
A0A4W2D6A3_BCL2L2-      -----------------------------atg------------------
A0A4W2D6A3_BCL2L2-      -----------------------------atg------------------
A0A4W2GUJ7_BCL2L2-      atcccggcagcggcctgacccccgcccggatg------------------
A0A4W2GUJ7_BCL2L2-      -----------------------------atg------------------
A0A8B9WT05_BCL2L2-      -----------------------------atg------------------
A0A4W2D6A3_BCL2L2-      -----------------------------atg------------------
A0A4W2D6A3_BCL2L2-      -----------------------------atg------------------
A0A4W2GUJ7_BCL2L2-      atcccggcagcggcctgacccccgcccggatg------------------
A0A4W2GUJ7_BCL2L2-      -----------------------------atg------------------
Q05KI8_BCL2L2-01        -----------------------------atg------------------
A0A8C2VJ88_BCL2L2-      -----------------------------atg------------------
A0A286XQQ9_BCL2L2-      -----------------------------atg------------------
A0A8C2VJ88_BCL2L2-      -----------------------------atg------------------
A0A8D2APK0_BCL2L2-      -----------------------------atg------------------
A0A287D9B3_BCL2L2-      -----------------------------atg------------------
A0A8D2HGM1_BCL2L2-      -----------------------------atg------------------
A0A287D9B3_BCL2L2-      -----------------------------atg------------------
A0A8C9PGU3_BCL2L2-      -----------------------------atg------------------
W5QDH4_BCL2L2-01        ttttatgtttgactccaacagccgcccggatg------------------
A0A4W2GUJ7_BCL2L2-      -----------------------------atg------------------
A0A4W2GUJ7_BCL2L2-      -----------------------------atg------------------
A0A4W2D6A3_BCL2L2-      -----------------------------atg------------------
A0A4W2GUJ7_BCL2L2-      -----------------------------atg------------------
A0A4W2D6A3_BCL2L2-      -----------------------------atg------------------
A0A4W2GUJ7_BCL2L2-      -----------------------------atg------------------
A0A4W2GUJ7_BCL2L2-      -----------------------------atg------------------
A0A4W2GUJ7_BCL2L2-      -----------------------------atg------------------
A0A5F5PML6_BCL2L2-      -----------------------------atg------------------
A0A5F5PML6_BCL2L2-      -----------------------------atg------------------
A0A8C5L5C6_BCL2L2-      -----------------------------atg------------------
A0A8C0Q5E6_BCL2L2-      -----------------------------atg------------------
A0A8I3MNK9_BCL2L2-      -----------------------------atg------------------
A0A8I3RSU6_BCL2L2-      -----------------------------atg------------------
A0A8I3MNK9_BCL2L2-      -----------------------------atg------------------
A0A667I624_BCL2L2-      -----------------------------atg------------------
G1LKF5_BCL2L2-01        -----------------------------atg------------------
G1LKF5_BCL2L2-02        -----------------------------atg------------------
A0A384DPS8_BCL2L2-      -----------------------------atg------------------
A0A384DPS8_BCL2L2-      -----------------------------atg------------------
A0A8C6RJE0_BCL2L2-      -----------------------------atg------------------
A0A671DWB3_BCL2L2-      -----------------------------atg------------------
A0A250YBR2_BCL2L2-      -----------------------------atg------------------
A0A250YBR2_BCL2L2-      -----------------------------atg------------------
O88996_BCL2L2-01        -----------------------------atg------------------
Q7TS60_BCL2L2-01        tgtcatccttgcccctttcagccgcccggatg------------------
A0A671DWB3_BCL2L2-      -----------------------------atg------------------
A0A8C6RJE0_BCL2L2-      -----------------------------atg------------------
A0A4W2D6A3_BCL2L2-      -----------------------------atg------------------
A0A4W2GUJ7_BCL2L2-      -----------------------------atg------------------
A0A4W2D6A3_BCL2L2-      -----------------------------atg------------------
A0A4W2GUJ7_BCL2L2-      -----------------------------atg------------------
A0A8C8YZD8_BCL2L2-      -----------------------------atg------------------
A0A8B7FJ73_BCL2L2-      -----------------------------atg------------------
A0A2K6GWM6_BCL2L2-      -----------------------------atg------------------
A0A8D0TJQ9_BCL2L2-      -----------------------------atg------------------
A0A482LX62_BCL2L2-      -----------------------------atg------------------
A0A4X1SF63_BCL2L2-      -----------------------------atg------------------
A0A4D6NWN1_BCL2L2-      -----------------------------atg------------------
A0A4X1SF60_BCL2L2-      -----------------------------atg------------------
A0A4X1SF63_BCL2L2-      -----------------------------atg------------------
A0A8D0TJQ9_BCL2L2-      -----------------------------atg------------------
A0A4X1SF60_BCL2L2-      -----------------------------atg------------------
A0A8D0TJQ9_BCL2L2-      -----------------------------atg------------------
H0XR82_BCL2L2-01        -----------------------------atg------------------
A0A4X1SF63_BCL2L2-      -----------------------------atg------------------
A0A4X1SF63_BCL2L2-      -----------------------------atg------------------
A0A8D0TJQ9_BCL2L2-      -----------------------------atg------------------
A0A8B7FJ73_BCL2L2-      -----------------------------atg------------------
A0A2K6GWM6_BCL2L2-      -----------------------------atg------------------
A0A5F5PML6_BCL2L2-      -----------------------------atg------------------
A0A8C8YZD8_BCL2L2-      -----------------------------atg------------------
A0A8B7FJ73_BCL2L2-      -----------------------------atg------------------
A0A8B7FJ73_BCL2L2-      -----------------------------atg------------------
A0A2K6GWM6_BCL2L2-      -----------------------------atg------------------
A0A2K6GWM6_BCL2L2-      -----------------------------atg------------------
A0A8C0Q5E6_BCL2L2-      -----------------------------atg------------------
A0A8I3MNK9_BCL2L2-      -----------------------------atg------------------
A0A8I3RSU6_BCL2L2-      -----------------------------atg------------------
A0A667I624_BCL2L2-      -----------------------------atg------------------
G1P3J2_BCL2L2-01        ttttatccttgacctttacagccgcccggatg------------------
G3TMU7_BCL2L2-01        tttcatccctgactcttgcagccgcccgcatg------------------
A0A2K6TM77_BCL2L2-      -----------------------------atg------------------
A0A2K6TM77_BCL2L2-      tttcatccttgcctcttatagccgcccggatg------------------
A0A2K5CWY6_BCL2L2-      tttcatccttgcctcttatagccgcccggatg------------------
A0A2K5CWY6_BCL2L2-      tttcatccttgcctcttatagccgcccggatg------------------
A0A2K5CWY6_BCL2L2-      -----------------------------atg------------------
U3CRF8_BCL2L2-02        -----------------------------atg------------------
U3CRF8_BCL2L2-03        -----------------------------atg------------------
A0A2I3GEA7_BCL2L2-      --------------------------------------------------
A0A8I5U2F2_BCL2L2-      -----------------------------atg------------------
A0A2I2YPX6_BCL2L2-      -----------------------------atg------------------
A0A2I2YPX6_BCL2L2-      -----------------------------atg------------------
U3CRF8_BCL2L2-01        -----------------------------atg------------------
A0A2K6TM77_BCL2L2-      --------------------------------------------------
A0A2K6TM77_BCL2L2-      -----------------------------atg------------------
A0A2K5V0Q3_BCL2L2-      --------------------------------------------------
A0A2K6EA59_BCL2L2-      -----------------------------atg------------------
A0A2K6EA59_BCL2L2-      -----------------------------atg------------------
A0A2K5MZX9_BCL2L2-      -----------------------------atg------------------
A0A2K5MZX9_BCL2L2-      -----------------------------atg------------------
A0A2K5MZX9_BCL2L2-      -----------------------------atg------------------
A0A2K5V0Q3_BCL2L2-      --------------------------------------------------
F7G4L5_BCL2L2-03        -----------------------------atg------------------
A0A2K6EA59_BCL2L2-      -----------------------------atg------------------
A0A2K6AI25_BCL2L2-      --------------------------------------------------
A0A8D2FJU1_BCL2L2-      -----------------------------atg------------------
A0A2R9A2Q3_BCL2L2-      -----------------------------atg------------------
A0A2R9A2Q3_BCL2L2-      --------------------------------------------------
A0A2K6RW35_BCL2L2-      --------------------------------------------------
A0A2K5HEJ9_BCL2L2-      --------------------------------------------------
A0A2K5HEJ9_BCL2L2-      -----------------------------atg------------------
A0A8I5U2F2_BCL2L2-      -----------------------------atg------------------
A0A2K5CWY6_BCL2L2-      -----------------------------atg------------------
A0A8I5U2F2_BCL2L2-      -----------------------------atg------------------
A0A2K6RW35_BCL2L2-      -----------------------------atg------------------
A0A2K6RW35_BCL2L2-      -----------------------------atg------------------
A0A2K6ME72_BCL2L2-      -----------------------------atg------------------
A0A2R9A2Q3_BCL2L2-      -----------------------------atg------------------
A0A2K5MZX9_BCL2L2-      -----------------------------atg------------------
A0A2K6EA59_BCL2L2-      -----------------------------atg------------------
A0A2K6RW35_BCL2L2-      -----------------------------atg------------------
A0A2K6ME72_BCL2L2-      -----------------------------atg------------------
A0A8D2FJU1_BCL2L2-      -----------------------------atg------------------
A0A8D2FJU1_BCL2L2-      -----------------------------atg------------------
A0A8C9H679_BCL2L2-      -----------------------------atg------------------
A0A8C9H679_BCL2L2-      -----------------------------atg------------------
A0A2I3MUE4_BCL2L2-      -----------------------------atg------------------
A0A2I3GEA7_BCL2L2-      -----------------------------atg------------------
A0A2I3GEA7_BCL2L2-      -----------------------------atg------------------
A0A2K6AI25_BCL2L2-      -----------------------------atg------------------
A0A2K6AI25_BCL2L2-      -----------------------------atg------------------
F7G4L5_BCL2L2-02        -----------------------------atg------------------
F7G4L5_BCL2L2-01        -----------------------------atg------------------
A0A2K5V0Q3_BCL2L2-      tttcatccttgcctcttatagctgcccggatg------------------
A0A2K5V0Q3_BCL2L2-      tttcatccttgcctcttatagctgcccggatg------------------
A0A2K5V0Q3_BCL2L2-      tttcatccttgcctcttatagctgcccggatg------------------
A0A2K5V0Q3_BCL2L2-      tttcatccttgcctcttatagctgcccggatg------------------
A0A2K5V0Q3_BCL2L2-      tttcatccttgcctcttatagctgcccggatg------------------
A0A2K5V0Q3_BCL2L2-      -----------------------------atg------------------
A0A2K5V0Q3_BCL2L2-      -----------------------------atg------------------
G3V4B7_BCL2L2-08        -----------------------------atg------------------
G3V4B7_BCL2L2-07        -----------------------------atg------------------
G3V4B7_BCL2L2-06        -----------------------------atg------------------
G3V4B7_BCL2L2-05        -----------------------------atg------------------
G3V4B7_BCL2L2-04        -----------------------------atg------------------
G3V4B7_BCL2L2-03        -----------------------------atg------------------
G3V4B7_BCL2L2-02        -----------------------------atg------------------
A0A2I2YPX6_BCL2L2-      -----------------------------atg------------------
A0A2I2YPX6_BCL2L2-      -----------------------------atg------------------
A0A2K5HEJ9_BCL2L2-      -----------------------------atg------------------
A0A0D9RU30_BCL2L2-      -----------------------------atg------------------
G3V4B7_BCL2L2-01        -----------------------------atg------------------
G3V4B7_BCL2L2-09        -----------------------------atg------------------
                                                                          

H3AAS7_BCL2L2-02        --------------------------------------------------
H3AAS7_BCL2L2-01        --------------------------------------------------
Q6GP82_BCL2L2-01        --------------------------------------------------
A0A8C5PJB3_BCL2L2-      --------------------------------------------------
A0A4X2LP96_BCL2L2-      --------------------------------------------------
A0A5F8HG85_BCL2L2-      --------------------------------------------------
A0A5F8HG85_BCL2L2-      --------------------------------------------------
A0A5F8HG85_BCL2L2-      --------------------------------------------------
F7G6M3_BCL2L2-01        --------------------------------------------------
G1Q051_BCL2L2-01        aactttatgctctatagttttgattctgttgatattaggcccaaagtgct
G1TV33_BCL2L2-01        --------------------------------------------------
D3Z5F7_BCL2L2-01        --------------------------------------------------
G3V4B7_BCL2L2-10        --------------------------------------------------
A0A6I9LUT0_BCL2L2-      --------------------------------------------------
A0A8C3X592_BCL2L2-      --------------------------------------------------
A0A3Q9B4M8_BCL2L2-      --------------------------------------------------
A0A7T8CLX7_BCL2L2-      --------------------------------------------------
A0A8D0TJQ9_BCL2L2-      --------------------------------------------------
A0A4X1SF60_BCL2L2-      --------------------------------------------------
A0A4X1SF63_BCL2L2-      --------------------------------------------------
A0A8C0Q5E6_BCL2L2-      --------------------------------------------------
A0A8I3MNK9_BCL2L2-      --------------------------------------------------
A0A8I3RSU6_BCL2L2-      --------------------------------------------------
A0A673VAY7_BCL2L2-      --------------------------------------------------
A0A2I2UAE3_BCL2L2-      --------------------------------------------------
A0A8C8XCR9_BCL2L2-      --------------------------------------------------
A0A8C9J3S1_BCL2L2-      --------------------------------------------------
M3Y5X5_BCL2L2-01        --------------------------------------------------
A0A8C7EW82_BCL2L2-      --------------------------------------------------
A0A452SHI1_BCL2L2-      --------------------------------------------------
A0A384DPS8_BCL2L2-      --------------------------------------------------
A0A8C4LWK5_BCL2L2-      --------------------------------------------------
A0A8C6BK57_BCL2L2-      --------------------------------------------------
A0A8C9CXQ5_BCL2L2-      --------------------------------------------------
A0A8B8WSS7_BCL2L2-      --------------------------------------------------
W5QDH4_BCL2L2-02        --------------------------------------------------
A0A8C6CUC2_BCL2L2-      --------------------------------------------------
A0A452ECF0_BCL2L2-      --------------------------------------------------
A0A4W2D6A3_BCL2L2-      --------------------------------------------------
A0A4W2D6A3_BCL2L2-      --------------------------------------------------
A0A4W2GUJ7_BCL2L2-      --------------------------------------------------
A0A4W2GUJ7_BCL2L2-      --------------------------------------------------
A0A8B9WT05_BCL2L2-      --------------------------------------------------
A0A4W2D6A3_BCL2L2-      --------------------------------------------------
A0A4W2D6A3_BCL2L2-      --------------------------------------------------
A0A4W2GUJ7_BCL2L2-      --------------------------------------------------
A0A4W2GUJ7_BCL2L2-      --------------------------------------------------
Q05KI8_BCL2L2-01        --------------------------------------------------
A0A8C2VJ88_BCL2L2-      --------------------------------------------------
A0A286XQQ9_BCL2L2-      --------------------------------------------------
A0A8C2VJ88_BCL2L2-      --------------------------------------------------
A0A8D2APK0_BCL2L2-      --------------------------------------------------
A0A287D9B3_BCL2L2-      --------------------------------------------------
A0A8D2HGM1_BCL2L2-      --------------------------------------------------
A0A287D9B3_BCL2L2-      --------------------------------------------------
A0A8C9PGU3_BCL2L2-      --------------------------------------------------
W5QDH4_BCL2L2-01        --------------------------------------------------
A0A4W2GUJ7_BCL2L2-      --------------------------------------------------
A0A4W2GUJ7_BCL2L2-      --------------------------------------------------
A0A4W2D6A3_BCL2L2-      --------------------------------------------------
A0A4W2GUJ7_BCL2L2-      --------------------------------------------------
A0A4W2D6A3_BCL2L2-      --------------------------------------------------
A0A4W2GUJ7_BCL2L2-      --------------------------------------------------
A0A4W2GUJ7_BCL2L2-      --------------------------------------------------
A0A4W2GUJ7_BCL2L2-      --------------------------------------------------
A0A5F5PML6_BCL2L2-      --------------------------------------------------
A0A5F5PML6_BCL2L2-      --------------------------------------------------
A0A8C5L5C6_BCL2L2-      --------------------------------------------------
A0A8C0Q5E6_BCL2L2-      --------------------------------------------------
A0A8I3MNK9_BCL2L2-      --------------------------------------------------
A0A8I3RSU6_BCL2L2-      --------------------------------------------------
A0A8I3MNK9_BCL2L2-      --------------------------------------------------
A0A667I624_BCL2L2-      --------------------------------------------------
G1LKF5_BCL2L2-01        --------------------------------------------------
G1LKF5_BCL2L2-02        --------------------------------------------------
A0A384DPS8_BCL2L2-      --------------------------------------------------
A0A384DPS8_BCL2L2-      --------------------------------------------------
A0A8C6RJE0_BCL2L2-      --------------------------------------------------
A0A671DWB3_BCL2L2-      --------------------------------------------------
A0A250YBR2_BCL2L2-      --------------------------------------------------
A0A250YBR2_BCL2L2-      --------------------------------------------------
O88996_BCL2L2-01        --------------------------------------------------
Q7TS60_BCL2L2-01        --------------------------------------------------
A0A671DWB3_BCL2L2-      --------------------------------------------------
A0A8C6RJE0_BCL2L2-      --------------------------------------------------
A0A4W2D6A3_BCL2L2-      --------------------------------------------------
A0A4W2GUJ7_BCL2L2-      --------------------------------------------------
A0A4W2D6A3_BCL2L2-      --------------------------------------------------
A0A4W2GUJ7_BCL2L2-      --------------------------------------------------
A0A8C8YZD8_BCL2L2-      --------------------------------------------------
A0A8B7FJ73_BCL2L2-      --------------------------------------------------
A0A2K6GWM6_BCL2L2-      --------------------------------------------------
A0A8D0TJQ9_BCL2L2-      --------------------------------------------------
A0A482LX62_BCL2L2-      --------------------------------------------------
A0A4X1SF63_BCL2L2-      --------------------------------------------------
A0A4D6NWN1_BCL2L2-      --------------------------------------------------
A0A4X1SF60_BCL2L2-      --------------------------------------------------
A0A4X1SF63_BCL2L2-      --------------------------------------------------
A0A8D0TJQ9_BCL2L2-      --------------------------------------------------
A0A4X1SF60_BCL2L2-      --------------------------------------------------
A0A8D0TJQ9_BCL2L2-      --------------------------------------------------
H0XR82_BCL2L2-01        --------------------------------------------------
A0A4X1SF63_BCL2L2-      --------------------------------------------------
A0A4X1SF63_BCL2L2-      --------------------------------------------------
A0A8D0TJQ9_BCL2L2-      --------------------------------------------------
A0A8B7FJ73_BCL2L2-      --------------------------------------------------
A0A2K6GWM6_BCL2L2-      --------------------------------------------------
A0A5F5PML6_BCL2L2-      --------------------------------------------------
A0A8C8YZD8_BCL2L2-      --------------------------------------------------
A0A8B7FJ73_BCL2L2-      --------------------------------------------------
A0A8B7FJ73_BCL2L2-      --------------------------------------------------
A0A2K6GWM6_BCL2L2-      --------------------------------------------------
A0A2K6GWM6_BCL2L2-      --------------------------------------------------
A0A8C0Q5E6_BCL2L2-      --------------------------------------------------
A0A8I3MNK9_BCL2L2-      --------------------------------------------------
A0A8I3RSU6_BCL2L2-      --------------------------------------------------
A0A667I624_BCL2L2-      --------------------------------------------------
G1P3J2_BCL2L2-01        --------------------------------------------------
G3TMU7_BCL2L2-01        --------------------------------------------------
A0A2K6TM77_BCL2L2-      --------------------------------------------------
A0A2K6TM77_BCL2L2-      --------------------------------------------------
A0A2K5CWY6_BCL2L2-      --------------------------------------------------
A0A2K5CWY6_BCL2L2-      --------------------------------------------------
A0A2K5CWY6_BCL2L2-      --------------------------------------------------
U3CRF8_BCL2L2-02        --------------------------------------------------
U3CRF8_BCL2L2-03        --------------------------------------------------
A0A2I3GEA7_BCL2L2-      --------------------------------------------------
A0A8I5U2F2_BCL2L2-      --------------------------------------------------
A0A2I2YPX6_BCL2L2-      --------------------------------------------------
A0A2I2YPX6_BCL2L2-      --------------------------------------------------
U3CRF8_BCL2L2-01        --------------------------------------------------
A0A2K6TM77_BCL2L2-      --------------------------------------------------
A0A2K6TM77_BCL2L2-      --------------------------------------------------
A0A2K5V0Q3_BCL2L2-      --------------------------------------------------
A0A2K6EA59_BCL2L2-      --------------------------------------------------
A0A2K6EA59_BCL2L2-      --------------------------------------------------
A0A2K5MZX9_BCL2L2-      --------------------------------------------------
A0A2K5MZX9_BCL2L2-      --------------------------------------------------
A0A2K5MZX9_BCL2L2-      --------------------------------------------------
A0A2K5V0Q3_BCL2L2-      --------------------------------------------------
F7G4L5_BCL2L2-03        --------------------------------------------------
A0A2K6EA59_BCL2L2-      --------------------------------------------------
A0A2K6AI25_BCL2L2-      --------------------------------------------------
A0A8D2FJU1_BCL2L2-      --------------------------------------------------
A0A2R9A2Q3_BCL2L2-      --------------------------------------------------
A0A2R9A2Q3_BCL2L2-      --------------------------------------------------
A0A2K6RW35_BCL2L2-      --------------------------------------------------
A0A2K5HEJ9_BCL2L2-      --------------------------------------------------
A0A2K5HEJ9_BCL2L2-      --------------------------------------------------
A0A8I5U2F2_BCL2L2-      --------------------------------------------------
A0A2K5CWY6_BCL2L2-      --------------------------------------------------
A0A8I5U2F2_BCL2L2-      --------------------------------------------------
A0A2K6RW35_BCL2L2-      --------------------------------------------------
A0A2K6RW35_BCL2L2-      --------------------------------------------------
A0A2K6ME72_BCL2L2-      --------------------------------------------------
A0A2R9A2Q3_BCL2L2-      --------------------------------------------------
A0A2K5MZX9_BCL2L2-      --------------------------------------------------
A0A2K6EA59_BCL2L2-      --------------------------------------------------
A0A2K6RW35_BCL2L2-      --------------------------------------------------
A0A2K6ME72_BCL2L2-      --------------------------------------------------
A0A8D2FJU1_BCL2L2-      --------------------------------------------------
A0A8D2FJU1_BCL2L2-      --------------------------------------------------
A0A8C9H679_BCL2L2-      --------------------------------------------------
A0A8C9H679_BCL2L2-      --------------------------------------------------
A0A2I3MUE4_BCL2L2-      --------------------------------------------------
A0A2I3GEA7_BCL2L2-      --------------------------------------------------
A0A2I3GEA7_BCL2L2-      --------------------------------------------------
A0A2K6AI25_BCL2L2-      --------------------------------------------------
A0A2K6AI25_BCL2L2-      --------------------------------------------------
F7G4L5_BCL2L2-02        --------------------------------------------------
F7G4L5_BCL2L2-01        --------------------------------------------------
A0A2K5V0Q3_BCL2L2-      --------------------------------------------------
A0A2K5V0Q3_BCL2L2-      --------------------------------------------------
A0A2K5V0Q3_BCL2L2-      --------------------------------------------------
A0A2K5V0Q3_BCL2L2-      --------------------------------------------------
A0A2K5V0Q3_BCL2L2-      --------------------------------------------------
A0A2K5V0Q3_BCL2L2-      --------------------------------------------------
A0A2K5V0Q3_BCL2L2-      --------------------------------------------------
G3V4B7_BCL2L2-08        --------------------------------------------------
G3V4B7_BCL2L2-07        --------------------------------------------------
G3V4B7_BCL2L2-06        --------------------------------------------------
G3V4B7_BCL2L2-05        --------------------------------------------------
G3V4B7_BCL2L2-04        --------------------------------------------------
G3V4B7_BCL2L2-03        --------------------------------------------------
G3V4B7_BCL2L2-02        --------------------------------------------------
A0A2I2YPX6_BCL2L2-      --------------------------------------------------
A0A2I2YPX6_BCL2L2-      --------------------------------------------------
A0A2K5HEJ9_BCL2L2-      --------------------------------------------------
A0A0D9RU30_BCL2L2-      --------------------------------------------------
G3V4B7_BCL2L2-01        --------------------------------------------------
G3V4B7_BCL2L2-09        --------------------------------------------------
                                                                          

H3AAS7_BCL2L2-02        ------------------------gattcgctttacagtaaca--gagga
H3AAS7_BCL2L2-01        ------------------------gattcgctttacagtaaca--gagga
Q6GP82_BCL2L2-01        ---------gcgcagtctgacctaggagcc--------------cgggct
A0A8C5PJB3_BCL2L2-      ---------gctgccccgagcttcggacct------aggctct-cgtccc
A0A4X2LP96_BCL2L2-      ---------gcgactccagcctc-agcccc------agatact-cgagcc
A0A5F8HG85_BCL2L2-      ---------gcggcggcggcggc-ggcggc------agcagc----agcg
A0A5F8HG85_BCL2L2-      ---------gcgactccagcctc-agcccc------agatact-cgagcc
A0A5F8HG85_BCL2L2-      ---------gcgactccagcctc-agcccc------agatact-cgagcc
F7G6M3_BCL2L2-01        ---------gcgaccccggcccc-ggcctcggtctcagacacc-cgggcc
G1Q051_BCL2L2-01        gggtcctaagagctcccagcctcaggcccc------agacaca-caggct
G1TV33_BCL2L2-01        ---------gcgaccccagcctc-agcccc------agacaca-cgggct
D3Z5F7_BCL2L2-01        ---------gcgaccccagcctc-aacccc------agacaca-cgggct
G3V4B7_BCL2L2-10        --------------------------------------------------
A0A6I9LUT0_BCL2L2-      ---------gcgaccccagcctc-agcccc------agacaca-cgggct
A0A8C3X592_BCL2L2-      ---------gcgaccccggcctc-agcccc------agacact-cgggct
A0A3Q9B4M8_BCL2L2-      ---------gcgaccccggcctc-agcccc------agacaca-cgggct
A0A7T8CLX7_BCL2L2-      --------------------------------------------------
A0A8D0TJQ9_BCL2L2-      ---------gcgaccccggcctc-agcccc------agacaca-cgggct
A0A4X1SF60_BCL2L2-      ---------gcgaccccggcctc-agcccc------agacaca-cgggct
A0A4X1SF63_BCL2L2-      ---------gcgaccccggcctc-agcccc------agacaca-cgggct
A0A8C0Q5E6_BCL2L2-      ---------gcgaccccagcctc-agcccc------agacaca-cgggct
A0A8I3MNK9_BCL2L2-      ---------gcgaccccagcctc-agcccc------agacaca-cgggct
A0A8I3RSU6_BCL2L2-      ---------gcgaccccagcctc-agcccc------agacaca-cgggct
A0A673VAY7_BCL2L2-      ---------gcgaccccagcctc-agcccc------agacaca-cgggct
A0A2I2UAE3_BCL2L2-      ---------gcgaccccagcctc-agcccc------agacaca-cgggct
A0A8C8XCR9_BCL2L2-      ---------gcgaccccagcctc-agcccc------agacaca-cgggct
A0A8C9J3S1_BCL2L2-      ---------gcgaccccagcctc-agcccc------agacaca-cgggct
M3Y5X5_BCL2L2-01        ---------gcgaccccggcctc-agcccc------agacaca-cgggct
A0A8C7EW82_BCL2L2-      ---------gcgaccccggcctc-agcccc------agacaca-cgggct
A0A452SHI1_BCL2L2-      ---------gcgaccccagcctc-agcccc------agacaca-cgggct
A0A384DPS8_BCL2L2-      ---------gcgaccccagcctc-agcccc------agacaca-cgggct
A0A8C4LWK5_BCL2L2-      ---------gcgaccccagcctc-agcccc------agacaca-cgggct
A0A8C6BK57_BCL2L2-      ---------gcgaccccagcctc-ggcccc------agacaca-cgggct
A0A8C9CXQ5_BCL2L2-      ---------gcgaccccagcctc-ggcccc------agacaca-cgggct
A0A8B8WSS7_BCL2L2-      ---------gcgaccccagcctc-ggcccc------agacaca-cgggct
W5QDH4_BCL2L2-02        ---------gcgaccccagcctc-agcccc------agacaca-cgggct
A0A8C6CUC2_BCL2L2-      ---------gcgaccccagcctc-ggcccc------agacaca-cgggct
A0A452ECF0_BCL2L2-      ---------gcgaccccagcctc-agcccc------agacaca-cgggct
A0A4W2D6A3_BCL2L2-      ---------gcgaccccagcctc-ggcccc------agacaca-cgggct
A0A4W2D6A3_BCL2L2-      ---------gcgaccccagcctc-ggcccc------agacaca-cgggct
A0A4W2GUJ7_BCL2L2-      ---------gcgaccccagcctc-ggcccc------agacaca-cgggct
A0A4W2GUJ7_BCL2L2-      ---------gcgaccccagcctc-ggcccc------agacaca-cgggct
A0A8B9WT05_BCL2L2-      ---------gcgaccccagcctc-ggcccc------agacaca-cgggct
A0A4W2D6A3_BCL2L2-      ---------gcgaccccagcctc-ggcccc------agacaca-cgggct
A0A4W2D6A3_BCL2L2-      ---------gcgaccccagcctc-ggcccc------agacaca-cgggct
A0A4W2GUJ7_BCL2L2-      ---------gcgaccccagcctc-ggcccc------agacaca-cgggct
A0A4W2GUJ7_BCL2L2-      ---------gcgaccccagcctc-ggcccc------agacaca-cgggct
Q05KI8_BCL2L2-01        ---------gcgaccccagcctc-ggcccc------agacaca-cgggct
A0A8C2VJ88_BCL2L2-      ---------gcgaccccagcctc-ggcccc------agacaca-cgggct
A0A286XQQ9_BCL2L2-      ---------gcgaccccagcctc-ggcccc------agacaca-cgggct
A0A8C2VJ88_BCL2L2-      ---------gcgaccccagcctc-ggcccc------agacaca-cgggct
A0A8D2APK0_BCL2L2-      ---------gcgaccccagcctc-ggcccc------agacaca-cgggct
A0A287D9B3_BCL2L2-      ---------gcgaccccagcctc-ggcccc------agacaca-cgggct
A0A8D2HGM1_BCL2L2-      ---------gcgaccccagcctc-ggcccc------agacaca-cgggct
A0A287D9B3_BCL2L2-      ---------gcgaccccagcctc-ggcccc------agacaca-cgggct
A0A8C9PGU3_BCL2L2-      ---------gcgaccccagcctc-ggcccc------agacaca-cgggct
W5QDH4_BCL2L2-01        ---------gcgaccccagcctc-agcccc------agacaca-cgggct
A0A4W2GUJ7_BCL2L2-      ---------gcgaccccagcctc-ggcccc------agacaca-cgggct
A0A4W2GUJ7_BCL2L2-      ---------gcgaccccagcctc-ggcccc------agacaca-cgggct
A0A4W2D6A3_BCL2L2-      ---------gcgaccccagcctc-ggcccc------agacaca-cgggct
A0A4W2GUJ7_BCL2L2-      ---------gcgaccccagcctc-ggcccc------agacaca-cgggct
A0A4W2D6A3_BCL2L2-      ---------gcgaccccagcctc-ggcccc------agacaca-cgggct
A0A4W2GUJ7_BCL2L2-      ---------gcgaccccagcctc-ggcccc------agacaca-cgggct
A0A4W2GUJ7_BCL2L2-      ---------gcgaccccagcctc-ggcccc------agacaca-cgggct
A0A4W2GUJ7_BCL2L2-      ---------gcgaccccagcctc-ggcccc------agacaca-cgggct
A0A5F5PML6_BCL2L2-      ---------gcgaccccagcctc-agcccc------agacaca-cgggct
A0A5F5PML6_BCL2L2-      ---------gcgaccccagcctc-agcccc------agacaca-cgggct
A0A8C5L5C6_BCL2L2-      ---------gcgaccccagcctc-ggcccc------agacaca-cgggct
A0A8C0Q5E6_BCL2L2-      ---------gcgaccccagcctc-agcccc------agacaca-cgggct
A0A8I3MNK9_BCL2L2-      ---------gcgaccccagcctc-agcccc------agacaca-cgggct
A0A8I3RSU6_BCL2L2-      ---------gcgaccccagcctc-agcccc------agacaca-cgggct
A0A8I3MNK9_BCL2L2-      ---------gcgaccccagcctc-agcccc------agacaca-cgggct
A0A667I624_BCL2L2-      ---------gcgaccccagcctc-agcccc------agacaca-cgggct
G1LKF5_BCL2L2-01        ---------gcgaccccagcttc-agcccc------agacaca-cgggct
G1LKF5_BCL2L2-02        ---------gcgaccccagcttc-agcccc------agacaca-cgggct
A0A384DPS8_BCL2L2-      ---------gcgaccccagcctc-agcccc------agacaca-cgggct
A0A384DPS8_BCL2L2-      ---------gcgaccccagcctc-agcccc------agacaca-cgggct
A0A8C6RJE0_BCL2L2-      ---------gcgaccccagcctc-tgcccc------agacaca-cgggct
A0A671DWB3_BCL2L2-      ---------gcggcggcggcggc-ggcggcga---cagcggcagcggggg
A0A250YBR2_BCL2L2-      ---------gcgaccccagcctc-ggcccc------agacaca-cgggct
A0A250YBR2_BCL2L2-      ---------gcgaccccagcctc-ggcccc------agacaca-cgggct
O88996_BCL2L2-01        ---------gcgaccccagcctc-aacccc------agacaca-cgggct
Q7TS60_BCL2L2-01        ---------gcgaccccagcctc-aacccc------agacaca-cgggct
A0A671DWB3_BCL2L2-      ---------gcgaccccagcctc-agcccc------agacaca-cgggct
A0A8C6RJE0_BCL2L2-      ---------gcgaccccagcctc-tgcccc------agacaca-cgggct
A0A4W2D6A3_BCL2L2-      ---------gcggcggcggcggc-ggcggc------agcagcagcggggg
A0A4W2GUJ7_BCL2L2-      ---------gcggcggcggcggc-ggcggc------agcagcagcggggg
A0A4W2D6A3_BCL2L2-      ---------gcggcggcggcggc-ggcggc------agcagcagcggggg
A0A4W2GUJ7_BCL2L2-      ---------gcggcggcggcggc-ggcggc------agcagcagcggggg
A0A8C8YZD8_BCL2L2-      ---------gcgaccccagcctc-agcccc------agacaca-cgggct
A0A8B7FJ73_BCL2L2-      ---------gcgaccccagcctc-agcccc------agacaca-cgggct
A0A2K6GWM6_BCL2L2-      ---------gcgaccccagcctc-agcccc------agacaca-cgggct
A0A8D0TJQ9_BCL2L2-      ---------gcgaccccggcctc-agcccc------agacaca-cgggct
A0A482LX62_BCL2L2-      ---------gcgaccccggcctc-agcccc------agacaca-cgggct
A0A4X1SF63_BCL2L2-      ---------gcgaccccggcctc-agcccc------agacaca-cgggct
A0A4D6NWN1_BCL2L2-      ---------gcgaccccggcctc-agcccc------agacaca-cgggct
A0A4X1SF60_BCL2L2-      ---------gcgaccccggcctc-agcccc------agacaca-cgggct
A0A4X1SF63_BCL2L2-      ---------gcgaccccggcctc-agcccc------agacaca-cgggct
A0A8D0TJQ9_BCL2L2-      ---------gcgaccccggcctc-agcccc------agacaca-cgggct
A0A4X1SF60_BCL2L2-      ---------gcgaccccggcctc-agcccc------agacaca-cgggct
A0A8D0TJQ9_BCL2L2-      ---------gcgaccccggcctc-agcccc------agacaca-cgggct
H0XR82_BCL2L2-01        ---------gcgaccccagcctc-agcccc------agacaca-cgggct
A0A4X1SF63_BCL2L2-      ---------gcggcggcggcggc-ggcggc------agcagcagcggggg
A0A4X1SF63_BCL2L2-      ---------gcggcggcggcggc-ggcggc------agcagcagcggggg
A0A8D0TJQ9_BCL2L2-      ---------gcggcggcggcggc-ggcggc------agcagcagcggggg
A0A8B7FJ73_BCL2L2-      ---------gcgaccccagcctc-agcccc------agacaca-cgggct
A0A2K6GWM6_BCL2L2-      ---------gcgaccccagcctc-agcccc------agacaca-cgggct
A0A5F5PML6_BCL2L2-      ---------gcggcggcggcggc-ggcggc------agcagcagcggggg
A0A8C8YZD8_BCL2L2-      ---------gcggcggcggcggc-ggcggc------agcagcagcggggg
A0A8B7FJ73_BCL2L2-      ---------gcggcggcggcggc-ggcggc------agcagcagcggggg
A0A8B7FJ73_BCL2L2-      ---------gcggcggcggcggc-ggcggc------agcagcagcggggg
A0A2K6GWM6_BCL2L2-      ---------gcggcggcggcggc-ggcggc------agcagcagcggggg
A0A2K6GWM6_BCL2L2-      ---------gcggcggcggcggc-ggcggc------agcagcagcggggg
A0A8C0Q5E6_BCL2L2-      ---------gcggcggcggcggc-ggcggc------agcagcagcggggg
A0A8I3MNK9_BCL2L2-      ---------gcggcggcggcggc-ggcggc------agcagcagcggggg
A0A8I3RSU6_BCL2L2-      ---------gcggcggcggcggc-ggcggc------agcagcagcggggg
A0A667I624_BCL2L2-      ---------gcggcggcggcggc-ggcggc------agcagcagcggggg
G1P3J2_BCL2L2-01        ---------gcgaccccagcctc-ggcccc------agacaca-cgggct
G3TMU7_BCL2L2-01        ---------gcgaccccagcctc-agcccc------agacaca-cgggct
A0A2K6TM77_BCL2L2-      ---------gcgaccccagcctc-agcccc------agacaca-cgggct
A0A2K6TM77_BCL2L2-      ---------gcgaccccagcctc-agcccc------agacaca-cgggct
A0A2K5CWY6_BCL2L2-      ---------gcgaccccagcctc-ggcccc------agacaca-cgggct
A0A2K5CWY6_BCL2L2-      ---------gcgaccccagcctc-ggcccc------agacaca-cgggct
A0A2K5CWY6_BCL2L2-      ---------gcggcggcggcggc-ggcggc------agcagcagcggggg
U3CRF8_BCL2L2-02        ---------gcggcggcggcggc-ggcggc------agcagcagcggggg
U3CRF8_BCL2L2-03        ---------gcggcggcggcggc-ggcggc------agcagcagcggggg
A0A2I3GEA7_BCL2L2-      -----------------------------------------------ggg
A0A8I5U2F2_BCL2L2-      ---------gcggcggcggcggc-ggcggc------agcagcagcggggg
A0A2I2YPX6_BCL2L2-      ---------gcggcggcggcggc-ggcggc------agcagcagcggggg
A0A2I2YPX6_BCL2L2-      ---------gcggcggcggcggc-ggcggc------agcagcagcggggg
U3CRF8_BCL2L2-01        ---------gcgaccccagcctc-cgcccc------agacaca-cgggct
A0A2K6TM77_BCL2L2-      --------------------------------------------------
A0A2K6TM77_BCL2L2-      ---------gcgaccccagcctc-agcccc------agacaca-cgggct
A0A2K5V0Q3_BCL2L2-      --------------------------------------------------
A0A2K6EA59_BCL2L2-      ---------gcggcggcggcggc-ggcggc------agcagca----gcg
A0A2K6EA59_BCL2L2-      ---------gcgaccccagcctc-ggcccc------agacaca-cgggct
A0A2K5MZX9_BCL2L2-      ---------gcggcggcggcggc-ggcggc------agcagca----gcg
A0A2K5MZX9_BCL2L2-      ---------gcgaccccagcctc-ggcccc------agacaca-cgggct
A0A2K5MZX9_BCL2L2-      ---------gcggcggcggcggc-ggcggc------agcagca----gcg
A0A2K5V0Q3_BCL2L2-      --------------------------------------------------
F7G4L5_BCL2L2-03        ---------gcggcggcggcggc-ggcggc------agcagca----gcg
A0A2K6EA59_BCL2L2-      ---------gcggcggcggcggc-ggcggc------agcagca----gcg
A0A2K6AI25_BCL2L2-      --------------------------------------------------
A0A8D2FJU1_BCL2L2-      ---------gcggcggcggcggc-ggcggc------agcagca----gcg
A0A2R9A2Q3_BCL2L2-      ---------gcgaccccagcctc-agcccc------agacaca-cgggct
A0A2R9A2Q3_BCL2L2-      --------------------------------------------------
A0A2K6RW35_BCL2L2-      --------------------------------------------------
A0A2K5HEJ9_BCL2L2-      --------------------------------------------------
A0A2K5HEJ9_BCL2L2-      ---------gcgaccccagcctc-ggcccc------agacaca-cgggct
A0A8I5U2F2_BCL2L2-      ---------gcgaccccagcctc-ggcccc------agacaca-cgggct
A0A2K5CWY6_BCL2L2-      ---------gcgaccccagcctc-ggcccc------agacaca-cgggct
A0A8I5U2F2_BCL2L2-      ---------gcgaccccagcctc-ggcccc------agacaca-cgggct
A0A2K6RW35_BCL2L2-      ---------gcgaccccagcctc-ggcccc------agacaca-cgggct
A0A2K6RW35_BCL2L2-      ---------gcgaccccagcctc-ggcccc------agacaca-cgggct
A0A2K6ME72_BCL2L2-      ---------gcgaccccagcctc-ggcccc------agacaca-cgggct
A0A2R9A2Q3_BCL2L2-      ---------gcgaccccagcctc-agcccc------agacaca-cgggct
A0A2K5MZX9_BCL2L2-      ---------gcgaccccagcctc-ggcccc------agacaca-cgggct
A0A2K6EA59_BCL2L2-      ---------gcgaccccagcctc-ggcccc------agacaca-cgggct
A0A2K6RW35_BCL2L2-      ---------gcgaccccagcctc-ggcccc------agacaca-cgggct
A0A2K6ME72_BCL2L2-      ---------gcgaccccagcctc-ggcccc------agacaca-cgggct
A0A8D2FJU1_BCL2L2-      ---------gcgaccccagcctc-ggcccc------agacaca-cgggct
A0A8D2FJU1_BCL2L2-      ---------gcgaccccagcctc-ggcccc------agacaca-cgggct
A0A8C9H679_BCL2L2-      ---------gcgaccccagcctc-ggcccc------agacaca-cgggct
A0A8C9H679_BCL2L2-      ---------gcgaccccagcctc-ggcccc------agacaca-cgggct
A0A2I3MUE4_BCL2L2-      ---------gcgaccccagcctc-ggcccc------agacaca-cgggct
A0A2I3GEA7_BCL2L2-      ---------gcgaccccagcctc-ggcccc------agacaca-cgggct
A0A2I3GEA7_BCL2L2-      ---------gcgaccccagcctc-ggcccc------agacaca-cgggct
A0A2K6AI25_BCL2L2-      ---------gcgaccccagcctc-ggcccc------agacaca-cgggct
A0A2K6AI25_BCL2L2-      ---------gcgaccccagcctc-ggcccc------agacaca-cgggct
F7G4L5_BCL2L2-02        ---------gcgaccccagcctc-ggcccc------agacaca-cgggct
F7G4L5_BCL2L2-01        ---------gcgaccccagcctc-ggcccc------agacaca-cgggct
A0A2K5V0Q3_BCL2L2-      ---------gcgaccccagcctc-ggcccc------agacaca-cgggct
A0A2K5V0Q3_BCL2L2-      ---------gcgaccccagcctc-ggcccc------agacaca-cgggct
A0A2K5V0Q3_BCL2L2-      ---------gcgaccccagcctc-ggcccc------agacaca-cgggct
A0A2K5V0Q3_BCL2L2-      ---------gcgaccccagcctc-ggcccc------agacaca-cgggct
A0A2K5V0Q3_BCL2L2-      ---------gcgaccccagcctc-ggcccc------agacaca-cgggct
A0A2K5V0Q3_BCL2L2-      ---------gcgaccccagcctc-ggcccc------agacaca-cgggct
A0A2K5V0Q3_BCL2L2-      ---------gcgaccccagcctc-ggcccc------agacaca-cgggct
G3V4B7_BCL2L2-08        ---------gcgaccccagcctc-ggcccc------agacaca-cgggct
G3V4B7_BCL2L2-07        ---------gcgaccccagcctc-ggcccc------agacaca-cgggct
G3V4B7_BCL2L2-06        ---------gcgaccccagcctc-ggcccc------agacaca-cgggct
G3V4B7_BCL2L2-05        ---------gcgaccccagcctc-ggcccc------agacaca-cgggct
G3V4B7_BCL2L2-04        ---------gcgaccccagcctc-ggcccc------agacaca-cgggct
G3V4B7_BCL2L2-03        ---------gcgaccccagcctc-ggcccc------agacaca-cgggct
G3V4B7_BCL2L2-02        ---------gcgaccccagcctc-ggcccc------agacaca-cgggct
A0A2I2YPX6_BCL2L2-      ---------gcgaccccagcctc-ggcccc------agacaca-cgggct
A0A2I2YPX6_BCL2L2-      ---------gcgaccccagcctc-ggcccc------agacaca-cgggct
A0A2K5HEJ9_BCL2L2-      ---------gcgaccccagcctc-ggcccc------agacaca-cgggct
A0A0D9RU30_BCL2L2-      ---------gcgaccccagcctc-ggcccc------agacaca-cgggct
G3V4B7_BCL2L2-01        ---------gcgaccccagcctc-ggcccc------agacaca-cgggct
G3V4B7_BCL2L2-09        ---------gcgaccccagcctc-ggcccc------agacaca-cgggct
                                                                          

H3AAS7_BCL2L2-02        gtggtggaggacttcatttattacaaactcggccagaaggggtac-tctc
H3AAS7_BCL2L2-01        gtggtggaggacttcatttattacaaactcggccagaaggggtac-tctc
Q6GP82_BCL2L2-01        ttggtggaggattttgtgcggtacaagttatgccaacgtagtcttgttc-
A0A8C5PJB3_BCL2L2-      ttggtggaggattttgttcggtataaattacaccagcgtgggttagtgtc
A0A4X2LP96_BCL2L2-      ctggtggcagattttgtgggttacaagctaaggcagaaaggctatgcctg
A0A5F8HG85_BCL2L2-      ggggctgcgggcggtcgaggctccgggccggggcggcggcgccat-cttg
A0A5F8HG85_BCL2L2-      ctggtggcagattttgtgggttacaagctgaggcagaagggctatgcctg
A0A5F8HG85_BCL2L2-      ctggtggcagattttgtgggttacaagctgaggcagaagggctatgcctg
F7G6M3_BCL2L2-01        ctggtggcggactttgtgggctacaagctgcggcagaagggcttcgcctg
G1Q051_BCL2L2-01        ctggtggcagactttgtaggctacaagctgaggcagaagggttatgtttg
G1TV33_BCL2L2-01        ctggtggccgactttgtaggctacaagctgaggcagaagggttatgtctg
D3Z5F7_BCL2L2-01        ctagtggctgactttgtaggctataagctgaggcagaagggttatgtctg
G3V4B7_BCL2L2-10        --------------------------------------------------
A0A6I9LUT0_BCL2L2-      ctagtggctgactttgtaggctataagctgaggcagaagggttatgtctg
A0A8C3X592_BCL2L2-      ctagtggcagactttgtgggctataagctgaggcagaagggttatgtctg
A0A3Q9B4M8_BCL2L2-      ctagtggcagactttgtgggctataagatgaggcagaagggttatgtctg
A0A7T8CLX7_BCL2L2-      --------------------------------------------------
A0A8D0TJQ9_BCL2L2-      ctagtggcagactttgtgggctataagctgaggcagaagggttatgtctg
A0A4X1SF60_BCL2L2-      ctagtggcagactttgtgggctataagctgaggcagaagggttatgtctg
A0A4X1SF63_BCL2L2-      ctagtggcagactttgtgggctataagctgaggcagaagggttatgtctg
A0A8C0Q5E6_BCL2L2-      ctagtggcagactttgtaggctataagctgaggcagaagggttatgtttg
A0A8I3MNK9_BCL2L2-      ctagtggcagactttgtaggctataagctgaggcagaagggttatgtttg
A0A8I3RSU6_BCL2L2-      ctagtggcagactttgtaggctataagctgaggcagaagggttatgtttg
A0A673VAY7_BCL2L2-      ctagtggcagactttgtaggctataagctgaggcagaagggttatgtttg
A0A2I2UAE3_BCL2L2-      ctagtggcagactttgtaggctataagctgaggcagaagggttatgtttg
A0A8C8XCR9_BCL2L2-      ctagtggcagactttgtaggctataagctgaggcagaagggttatgtttg
A0A8C9J3S1_BCL2L2-      ctagtggcagactttgtaggctataagctgaggcagaagggttatgtttg
M3Y5X5_BCL2L2-01        ctagtggcagactttgtaggctataagctgaggcagaagggttatgtttg
A0A8C7EW82_BCL2L2-      ctagtggcagactttgtaggctataagctgaggcagaagggttatgtttg
A0A452SHI1_BCL2L2-      ctagtggcagactttgtaggctataagctgaggcagaaaggttatgtgtg
A0A384DPS8_BCL2L2-      ctagtggcagactttgtaggctataagctgaggcagaaaggttatgtgtg
A0A8C4LWK5_BCL2L2-      ctagtggcagactttgtaggctataagctgaggcagaagggttatgtttg
A0A8C6BK57_BCL2L2-      ctagtggcagactttgtaggctataagctgaggcagaagggttatgtttg
A0A8C9CXQ5_BCL2L2-      ctagtggcagactttgtaggctataagctgaggcagaagggttatgtttg
A0A8B8WSS7_BCL2L2-      ctagtggcagactttgtaggctataagctaaggcagaagggttatgtttg
W5QDH4_BCL2L2-02        ctagtggcagactttgtgggctataagctgaggcagaaggggtatgtttg
A0A8C6CUC2_BCL2L2-      ctagtggcagactttgtgggctataagctgaggcagaaggggtatgtttg
A0A452ECF0_BCL2L2-      ctagtggcagactttgtgggctataagctgaggcagaaggggtatgtttg
A0A4W2D6A3_BCL2L2-      ctagtggcagactttgtgggctataagctgaggcagaaggggtatgtttg
A0A4W2D6A3_BCL2L2-      ctagtggcagactttgtgggctataagctgaggcagaaggggtatgtttg
A0A4W2GUJ7_BCL2L2-      ctagtggcagactttgtgggctataagctgaggcagaaggggtatgtttg
A0A4W2GUJ7_BCL2L2-      ctagtggcagactttgtgggctataagctgaggcagaaggggtatgtttg
A0A8B9WT05_BCL2L2-      ctagtggcagactttgtgggctataagctgaggcagaaggggtatgtttg
A0A4W2D6A3_BCL2L2-      ctagtggcagactttgtgggctataagctgaggcagaaggggtatgtttg
A0A4W2D6A3_BCL2L2-      ctagtggcagactttgtgggctataagctgaggcagaaggggtatgtttg
A0A4W2GUJ7_BCL2L2-      ctagtggcagactttgtgggctataagctgaggcagaaggggtatgtttg
A0A4W2GUJ7_BCL2L2-      ctagtggcagactttgtgggctataagctgaggcagaaggggtatgtttg
Q05KI8_BCL2L2-01        ctagtggcagactttgtgggctataagctgaggcagaaggggtatgtttg
A0A8C2VJ88_BCL2L2-      ctggtggctgactttgtaggctataagctgaggcagaagggttatgtctg
A0A286XQQ9_BCL2L2-      ctggtggctgactttgtaggctataagctgaggcagaagggttatgtctg
A0A8C2VJ88_BCL2L2-      ctggtggctgactttgtaggctataagctgaggcagaagggttatgtctg
A0A8D2APK0_BCL2L2-      ctggtggctgactttgtaggctataagctgaggcagaagggttatgtctg
A0A287D9B3_BCL2L2-      ctggtggccgactttgtaggctataagctgaggcagaagggttacgtctg
A0A8D2HGM1_BCL2L2-      ctggtggccgactttgtaggctataagctgaggcagaagggttatgtctg
A0A287D9B3_BCL2L2-      ctggtggccgactttgtaggctataagctgaggcagaagggttacgtctg
A0A8C9PGU3_BCL2L2-      ctggtggccgactttgtaggctataagctgaggcagaagggttatgtctg
W5QDH4_BCL2L2-01        ctagtggcagactttgtgggctataagctgaggcagaaggggtatgtttg
A0A4W2GUJ7_BCL2L2-      ctagtggcagactttgtgggctataagctgaggcagaaggggtatgtttg
A0A4W2GUJ7_BCL2L2-      ctagtggcagactttgtgggctataagctgaggcagaaggggtatgtttg
A0A4W2D6A3_BCL2L2-      ctagtggcagactttgtgggctataagctgaggcagaaggggtatgtttg
A0A4W2GUJ7_BCL2L2-      ctagtggcagactttgtgggctataagctgaggcagaaggggtatgtttg
A0A4W2D6A3_BCL2L2-      ctagtggcagactttgtgggctataagctgaggcagaaggggtatgtttg
A0A4W2GUJ7_BCL2L2-      ctagtggcagactttgtgggctataagctgaggcagaaggggtatgtttg
A0A4W2GUJ7_BCL2L2-      ctagtggcagactttgtgggctataagctgaggcagaaggggtatgtttg
A0A4W2GUJ7_BCL2L2-      ctagtggcagactttgtgggctataagctgaggcagaaggggtatgtttg
A0A5F5PML6_BCL2L2-      ctagtggcagactttgtaggctataagctgaggcagaagggttatgtttg
A0A5F5PML6_BCL2L2-      ctagtggcagactttgtaggctataagctgaggcagaagggttatgtttg
A0A8C5L5C6_BCL2L2-      ctggtggctgactttgtaggctataagctgagacagaagggttatgtctg
A0A8C0Q5E6_BCL2L2-      ctagtggcagactttgtaggctataagctgaggcagaagggttatgtttg
A0A8I3MNK9_BCL2L2-      ctagtggcagactttgtaggctataagctgaggcagaagggttatgtttg
A0A8I3RSU6_BCL2L2-      ctagtggcagactttgtaggctataagctgaggcagaagggttatgtttg
A0A8I3MNK9_BCL2L2-      ctagtggcagactttgtaggctataagctgaggcagaagggttatgtttg
A0A667I624_BCL2L2-      ctagtggcagactttgtaggctataagctgaggcagaagggttatgtttg
G1LKF5_BCL2L2-01        ctagtggcagactttgtaggctataagctgaggcagaaaggttatgtgtg
G1LKF5_BCL2L2-02        ctagtggcagactttgtaggctataagctgaggcagaaaggttatgtgtg
A0A384DPS8_BCL2L2-      ctagtggcagactttgtaggctataagctgaggcagaaaggttatgtgtg
A0A384DPS8_BCL2L2-      ctagtggcagactttgtaggctataagctgaggcagaaaggttatgtgtg
A0A8C6RJE0_BCL2L2-      ctggtggctgactttgtaggctataagctgaggcagaagggttatgtctg
A0A671DWB3_BCL2L2-      ctgcgggcgg----tcggggctccgggccggggcggcgacgccatct-tg
A0A250YBR2_BCL2L2-      ctggtggctgactttgtaggctataagctgaggcagaagggttatgtctg
A0A250YBR2_BCL2L2-      ctggtggctgactttgtaggctataagctgaggcagaagggttatgtctg
O88996_BCL2L2-01        ctagtggctgactttgtaggctataagctgaggcagaagggttatgtctg
Q7TS60_BCL2L2-01        ctagtggctgactttgtaggctataagctgaggcagaagggttatgtctg
A0A671DWB3_BCL2L2-      ctagtggcagactttgtaggctataagctgagacagaagggttatgtttg
A0A8C6RJE0_BCL2L2-      ctggtggctgactttgtaggctataagctgaggcagaagggttatgtctg
A0A4W2D6A3_BCL2L2-      ctgcgggcgg----tcggggctccgggccggggcggcggcgccatct-tg
A0A4W2GUJ7_BCL2L2-      ctgcgggcgg----tcggggctccgggccggggcggcggcgccatct-tg
A0A4W2D6A3_BCL2L2-      ctgcgggcgg----tcggggctccgggccggggcggcggcgccatct-tg
A0A4W2GUJ7_BCL2L2-      ctgcgggcgg----tcggggctccgggccggggcggcggcgccatct-tg
A0A8C8YZD8_BCL2L2-      ctggtggcagactttgtaggctataagctgaggcagaagggttatgtctg
A0A8B7FJ73_BCL2L2-      ctggtggcagactttgtaggctataagctgaggcagaaaggttatgtctg
A0A2K6GWM6_BCL2L2-      ctggtggcagactttgtaggctataagctgaggcagaagggttatgtctg
A0A8D0TJQ9_BCL2L2-      ctagtggcagactttgtgggctataagctgaggcagaagggttatgtctg
A0A482LX62_BCL2L2-      ctagtggcagactttgtgggctataagctgaggcagaagggttatgtctg
A0A4X1SF63_BCL2L2-      ctagtggcagactttgtgggctataagctgaggcagaagggttatgtctg
A0A4D6NWN1_BCL2L2-      ctagtggcagactttgtgggctataagctgaggcagaagggttatgtctg
A0A4X1SF60_BCL2L2-      ctagtggcagactttgtgggctataagctgaggcagaagggttatgtctg
A0A4X1SF63_BCL2L2-      ctagtggcagactttgtgggctataagctgaggcagaagggttatgtctg
A0A8D0TJQ9_BCL2L2-      ctagtggcagactttgtgggctataagctgaggcagaagggttatgtctg
A0A4X1SF60_BCL2L2-      ctagtggcagactttgtgggctataagctgaggcagaagggttatgtctg
A0A8D0TJQ9_BCL2L2-      ctagtggcagactttgtgggctataagctgaggcagaagggttatgtctg
H0XR82_BCL2L2-01        ctggtggcagactttgtaggctataagctgaggcagaagggttatgtctg
A0A4X1SF63_BCL2L2-      ctgcgggcgg----tcggggctccgggccggggcggcggcgccatct-tg
A0A4X1SF63_BCL2L2-      ctgcgggcgg----tcggggctccgggccggggcggcggcgccatct-tg
A0A8D0TJQ9_BCL2L2-      ctgcgggcgg----tcggggctccgggccggggcggcggcgccatct-tg
A0A8B7FJ73_BCL2L2-      ctggtggcagactttgtaggctataagctgaggcagaaaggttatgtctg
A0A2K6GWM6_BCL2L2-      ctggtggcagactttgtaggctataagctgaggcagaagggttatgtctg
A0A5F5PML6_BCL2L2-      ctgcgggcgg----tcggggctccgggccggggcggcggcgccatct-tg
A0A8C8YZD8_BCL2L2-      ctgcgggcgg----tcggggctccgggccggggcggcggcgccatct-tg
A0A8B7FJ73_BCL2L2-      ctgcgggcgg----tcggggctccgggccggggcggcggcgccatct-tg
A0A8B7FJ73_BCL2L2-      ctgcgggcgg----tcggggctccgggccggggcggcggcgccatct-tg
A0A2K6GWM6_BCL2L2-      ctgcgggcgg----tcggggctccgggccggggcggcggcgccatct-tg
A0A2K6GWM6_BCL2L2-      ctgcgggcgg----tcggggctccgggccggggcggcggcgccatct-tg
A0A8C0Q5E6_BCL2L2-      ctgcgggcgg----tcggggctccgggccggggcggcggcgccatct-tg
A0A8I3MNK9_BCL2L2-      ctgcgggcgg----tcggggctccgggccggggcggcggcgccatct-tg
A0A8I3RSU6_BCL2L2-      ctgcgggcgg----tcggggctccgggccggggcggcggcgccatct-tg
A0A667I624_BCL2L2-      ctgcgggcgg----tcggggctccgggccggggcggcggcgccatct-tg
G1P3J2_BCL2L2-01        ctggtggcagactttgtaggctacaagctgaggcagaagggttatgtttg
G3TMU7_BCL2L2-01        ctggtggcagactttgtgggctacaagctgaggcagaagggttatgtttg
A0A2K6TM77_BCL2L2-      ctggtggcagactttgtaggttataagctgaggcagaagggttatgtctg
A0A2K6TM77_BCL2L2-      ctggtggcagactttgtaggttataagctgaggcagaagggttatgtctg
A0A2K5CWY6_BCL2L2-      ctggtggcagactttgtaggttataagctgaggcagaagggttatgtctg
A0A2K5CWY6_BCL2L2-      ctggtggcagactttgtaggttataagctgaggcagaagggttatgtctg
A0A2K5CWY6_BCL2L2-      ctgcgggcgg----tcggggctccgggccggggcggcggcgccatct-tg
U3CRF8_BCL2L2-02        ctgcgggcgg----tcggggctccgggccggggcggcggcgccatct-tg
U3CRF8_BCL2L2-03        ctgcgggcgg----tcggggctccgggccggggcggcggcgccatct-tg
A0A2I3GEA7_BCL2L2-      ctgcgggcgg---ttcggggctccgggccggggcggcggcgccatct-tg
A0A8I5U2F2_BCL2L2-      ctgcgggcgg----tcggggctccgggccggggcggcggcgccatct-tg
A0A2I2YPX6_BCL2L2-      ctgcgggcgg----tcggggctccgggccggggcggcgacgccatct-tg
A0A2I2YPX6_BCL2L2-      ctgcgggcgg----tcggggctccgggccggggcggcgacgccatct-tg
U3CRF8_BCL2L2-01        ctggtggcagactttgtaggttataagctgaggcagaaaggttatgtctg
A0A2K6TM77_BCL2L2-      --------------------------------------------------
A0A2K6TM77_BCL2L2-      ctggtggcagactttgtaggttataagctgaggcagaagggttatgtctg
A0A2K5V0Q3_BCL2L2-      --------------------------------------------------
A0A2K6EA59_BCL2L2-      ggggctgcgggcggtcggggctccgggccggggcggcggcgccatct-tg
A0A2K6EA59_BCL2L2-      ctggtggcagactttgtaggttataagctgaggcagaagggttatgtctg
A0A2K5MZX9_BCL2L2-      ggggctgcgggcggtcggggctccgggccggggcggcggcgccatct-tg
A0A2K5MZX9_BCL2L2-      ctggtggcagactttgtaggttataagctgaggcagaagggttatgtctg
A0A2K5MZX9_BCL2L2-      ggggctgcgggcggtcggggctccgggccggggcggcggcgccatct-tg
A0A2K5V0Q3_BCL2L2-      --------------------------------------------------
F7G4L5_BCL2L2-03        ggggctgcgggcggtcggggctccgggccggggcggcggcgccatct-tg
A0A2K6EA59_BCL2L2-      ggggctgcgggcggtcggggctccgggccggggcggcggcgccatct-tg
A0A2K6AI25_BCL2L2-      --------------------------------------------------
A0A8D2FJU1_BCL2L2-      ggggctgcgggcggtcggggctccgggccggggcggcggcgccatct-tg
A0A2R9A2Q3_BCL2L2-      ctggtggcagactttgtaggttataagctgaggcagaagggttatgtctg
A0A2R9A2Q3_BCL2L2-      --------------------------------------------------
A0A2K6RW35_BCL2L2-      --------------------------------------------------
A0A2K5HEJ9_BCL2L2-      --------------------------------------------------
A0A2K5HEJ9_BCL2L2-      ctggtggcagactttgtaggttataagctgaggcagaagggttatgtctg
A0A8I5U2F2_BCL2L2-      ctggtggcagactttgtaggttataagctgaggcagaagggttatgtctg
A0A2K5CWY6_BCL2L2-      ctggtggcagactttgtaggttataagctgaggcagaagggttatgtctg
A0A8I5U2F2_BCL2L2-      ctggtggcagactttgtaggttataagctgaggcagaagggttatgtctg
A0A2K6RW35_BCL2L2-      ctggtggcagactttttaggttataagctgaggcagaagggttatgtctg
A0A2K6RW35_BCL2L2-      ctggtggcagactttttaggttataagctgaggcagaagggttatgtctg
A0A2K6ME72_BCL2L2-      ctggtggcagactttgtaggttataagctgaggcagaagggttatgtctg
A0A2R9A2Q3_BCL2L2-      ctggtggcagactttgtaggttataagctgaggcagaagggttatgtctg
A0A2K5MZX9_BCL2L2-      ctggtggcagactttgtaggttataagctgaggcagaagggttatgtctg
A0A2K6EA59_BCL2L2-      ctggtggcagactttgtaggttataagctgaggcagaagggttatgtctg
A0A2K6RW35_BCL2L2-      ctggtggcagactttttaggttataagctgaggcagaagggttatgtctg
A0A2K6ME72_BCL2L2-      ctggtggcagactttgtaggttataagctgaggcagaagggttatgtctg
A0A8D2FJU1_BCL2L2-      ctggtggcagactttgtaggttataagctgaggcagaagggttatgtctg
A0A8D2FJU1_BCL2L2-      ctggtggcagactttgtaggttataagctgaggcagaagggttatgtctg
A0A8C9H679_BCL2L2-      ctggtggcagactttgtaggttataagctgaggcagaagggttatgtctg
A0A8C9H679_BCL2L2-      ctggtggcagactttgtaggttataagctgaggcagaagggttatgtctg
A0A2I3MUE4_BCL2L2-      ctggtggcagactttgtaggttataagctgaggcagaagggttatgtctg
A0A2I3GEA7_BCL2L2-      ctggtggcagactttgtaggttataagctgaggcagaagggttatgtctg
A0A2I3GEA7_BCL2L2-      ctggtggcagactttgtaggttataagctgaggcagaagggttatgtctg
A0A2K6AI25_BCL2L2-      ctggtggcagactttgtaggttataagctgaggcagaagggttatgtctg
A0A2K6AI25_BCL2L2-      ctggtggcagactttgtaggttataagctgaggcagaagggttatgtctg
F7G4L5_BCL2L2-02        ctggtggcagactttgtaggttataagctgaggcagaagggttatgtctg
F7G4L5_BCL2L2-01        ctggtggcagactttgtaggttataagctgaggcagaagggttatgtctg
A0A2K5V0Q3_BCL2L2-      ctggtggcagactttgtaggttataagctgaggcagaagggttatgtctg
A0A2K5V0Q3_BCL2L2-      ctggtggcagactttgtaggttataagctgaggcagaagggttatgtctg
A0A2K5V0Q3_BCL2L2-      ctggtggcagactttgtaggttataagctgaggcagaagggttatgtctg
A0A2K5V0Q3_BCL2L2-      ctggtggcagactttgtaggttataagctgaggcagaagggttatgtctg
A0A2K5V0Q3_BCL2L2-      ctggtggcagactttgtaggttataagctgaggcagaagggttatgtctg
A0A2K5V0Q3_BCL2L2-      ctggtggcagactttgtaggttataagctgaggcagaagggttatgtctg
A0A2K5V0Q3_BCL2L2-      ctggtggcagactttgtaggttataagctgaggcagaagggttatgtctg
G3V4B7_BCL2L2-08        ctggtggcagactttgtaggttataagctgaggcagaagggttatgtctg
G3V4B7_BCL2L2-07        ctggtggcagactttgtaggttataagctgaggcagaagggttatgtctg
G3V4B7_BCL2L2-06        ctggtggcagactttgtaggttataagctgaggcagaagggttatgtctg
G3V4B7_BCL2L2-05        ctggtggcagactttgtaggttataagctgaggcagaagggttatgtctg
G3V4B7_BCL2L2-04        ctggtggcagactttgtaggttataagctgaggcagaagggttatgtctg
G3V4B7_BCL2L2-03        ctggtggcagactttgtaggttataagctgaggcagaagggttatgtctg
G3V4B7_BCL2L2-02        ctggtggcagactttgtaggttataagctgaggcagaagggttatgtctg
A0A2I2YPX6_BCL2L2-      ctggtggcagactttgtaggttataagctgaggcagaagggttatgtctg
A0A2I2YPX6_BCL2L2-      ctggtggcagactttgtaggttataagctgaggcagaagggttatgtctg
A0A2K5HEJ9_BCL2L2-      ctggtggcagactttgtaggttataagctgaggcagaagggttatgtctg
A0A0D9RU30_BCL2L2-      ctggtggcagactttgtaggttataagctgaggcagaagggttatgtctg
G3V4B7_BCL2L2-01        ctggtggcagactttgtaggttataagctgaggcagaagggttatgtctg
G3V4B7_BCL2L2-09        ctggtggcagactttgtaggttataagctgaggcagaagggttatgtctg
                                                                          

H3AAS7_BCL2L2-02        agcagggtgcccca---acggatccccccgccaaccc-----actctacc
H3AAS7_BCL2L2-01        agcagggtgcccca---acggatccccccgccaaccc-----actctacc
Q6GP82_BCL2L2-01        -----cagagcctgcagga----ccagcatcctgtgc-----tttgcatt
A0A8C5PJB3_BCL2L2-      agaacctg-------ttggagccccatcatgcgc--------gctccatt
A0A4X2LP96_BCL2L2-      tggaactggcccag-gagagggccctacaactgagcc-----cctgcacc
A0A5F8HG85_BCL2L2-      t-gcccggggccgg-gggggagcccggggagggggcc-----------cc
A0A5F8HG85_BCL2L2-      tggaactggcccag-gagagggccctacaacagagcc-----cttgcacc
A0A5F8HG85_BCL2L2-      tggaactggcccag-gagagggccctacaacagagcc-----cttgcacc
F7G6M3_BCL2L2-01        cggggccgggcccg-gggagggccccccggcccagcc-----cctgcacc
G1Q051_BCL2L2-01        tggagcgggtcccg-gagagggcccagcagctgaccc-----actgcacc
G1TV33_BCL2L2-01        tggggctggccctg-gagagggcccggcagctaaccc-----gctgcacc
D3Z5F7_BCL2L2-01        tggagctggccctg-gggaaggcccagccgccgaccc-----gctgcacc
G3V4B7_BCL2L2-10        --------------------------------------------------
A0A6I9LUT0_BCL2L2-      tggagctggcccag-gggagggcccagcagctgaccc-----cctgcacc
A0A8C3X592_BCL2L2-      tggagctggccccg-gggagggcccagcagctgaccc-----gctgcacc
A0A3Q9B4M8_BCL2L2-      tggagctggccccg-gggagggcccagcagctgaccc-----gctgcacc
A0A7T8CLX7_BCL2L2-      --------------------------------------------------
A0A8D0TJQ9_BCL2L2-      tggagctggccccg-gggagggcccagcagctgaccc-----gctgcacc
A0A4X1SF60_BCL2L2-      tggagctggccccg-gggagggcccagcagctgaccc-----gctgcacc
A0A4X1SF63_BCL2L2-      tggagctggccccg-gggagggcccagcagctgaccc-----gctgcacc
A0A8C0Q5E6_BCL2L2-      tggagctggccctg-gagagggcccagcagctgatcc-----actgcacc
A0A8I3MNK9_BCL2L2-      tggagctggccctg-gagagggcccagcagctgatcc-----actgcacc
A0A8I3RSU6_BCL2L2-      tggagctggccctg-gagagggcccagcagctgatcc-----actgcacc
A0A673VAY7_BCL2L2-      tggagcaggccctg-gggagggcccagcagctgaccc-----actgcatc
A0A2I2UAE3_BCL2L2-      tggagcaggccctg-gggagggcccagcagctgaccc-----actgcacc
A0A8C8XCR9_BCL2L2-      tggagcaggccctg-gggagggcccagcagctgaccc-----actgcacc
A0A8C9J3S1_BCL2L2-      tggagcaggccctg-gggagggcccagcagctgaccc-----actgcacc
M3Y5X5_BCL2L2-01        tggagctggccctg-gggagggcccagcagctgaccc-----actgcacc
A0A8C7EW82_BCL2L2-      tggagctggccctg-gggagggcccagcagctgaccc-----actgcacc
A0A452SHI1_BCL2L2-      tggagctggccctg-gggagggcccagcagctgaccc-----actgcacc
A0A384DPS8_BCL2L2-      tggagctggccctg-gggagggcccagcagctgaccc-----actgcacc
A0A8C4LWK5_BCL2L2-      tggagctggccccg-gggagggcccagccgctgaccc-----actgcacc
A0A8C6BK57_BCL2L2-      tggagctggccccg-gggagggcccagcagctgaccc-----gctgcacc
A0A8C9CXQ5_BCL2L2-      tggagctggccccg-gggagggcccagcagctgaccc-----gctgcacc
A0A8B8WSS7_BCL2L2-      tggagctggcccag-gggagggcccagcagctgaccc-----gctgcacc
W5QDH4_BCL2L2-02        tggagctggccccg-gggagggcccagcagctgaccc-----gctacacc
A0A8C6CUC2_BCL2L2-      tggagctggccccg-gggagggcccagcagctgatcc-----gctacacc
A0A452ECF0_BCL2L2-      tggagctggccccg-gggagggcccagcagctgaccc-----gctacacc
A0A4W2D6A3_BCL2L2-      tggagctggccccg-gggagggcccagcagctgaccc-----gctacacc
A0A4W2D6A3_BCL2L2-      tggagctggccccg-gggagggcccagcagctgaccc-----gctacacc
A0A4W2GUJ7_BCL2L2-      tggagctggccccg-gggagggcccagcagctgaccc-----gctacacc
A0A4W2GUJ7_BCL2L2-      tggagctggccccg-gggagggcccagcagctgaccc-----gctacacc
A0A8B9WT05_BCL2L2-      tggagctggccccg-gggagggcccagcagctgaccc-----gctacacc
A0A4W2D6A3_BCL2L2-      tggagctggccccg-gggagggcccagcagctgaccc-----gctacacc
A0A4W2D6A3_BCL2L2-      tggagctggccccg-gggagggcccagcagctgaccc-----gctacacc
A0A4W2GUJ7_BCL2L2-      tggagctggccccg-gggagggcccagcagctgaccc-----gctacacc
A0A4W2GUJ7_BCL2L2-      tggagctggccccg-gggagggcccagcagctgaccc-----gctacacc
Q05KI8_BCL2L2-01        tggagctggccccg-gggagggcccagcagctgaccc-----gctacacc
A0A8C2VJ88_BCL2L2-      tggagctggccctg-gggagggcccagcagctgaccc-----actgcacc
A0A286XQQ9_BCL2L2-      tggagctggccctg-gggagggcccagcagctgaccc-----gctgcacc
A0A8C2VJ88_BCL2L2-      tggagctggccctg-gggagggcccagcagctgaccc-----actgcacc
A0A8D2APK0_BCL2L2-      tggagctggccctg-gggagggcccagcagctgaccc-----actgcatc
A0A287D9B3_BCL2L2-      tggagctggccctg-gggagggcccagcagctgatcc-----actgcacc
A0A8D2HGM1_BCL2L2-      tggagctggccctg-gggagggcccagcagctgatcc-----actgcacc
A0A287D9B3_BCL2L2-      tggagctggccctg-gggagggcccagcagctgatcc-----actgcacc
A0A8C9PGU3_BCL2L2-      tggagctggccctg-gggagggcccagcagctgatcc-----actgcacc
W5QDH4_BCL2L2-01        tggagctggccccg-gggagggcccagcagctgaccc-----gctacacc
A0A4W2GUJ7_BCL2L2-      tggagctggccccg-gggagggcccagcagctgaccc-----gctacacc
A0A4W2GUJ7_BCL2L2-      tggagctggccccg-gggagggcccagcagctgaccc-----gctacacc
A0A4W2D6A3_BCL2L2-      tggagctggccccg-gggagggcccagcagctgaccc-----gctacacc
A0A4W2GUJ7_BCL2L2-      tggagctggccccg-gggagggcccagcagctgaccc-----gctacacc
A0A4W2D6A3_BCL2L2-      tggagctggccccg-gggagggcccagcagctgaccc-----gctacacc
A0A4W2GUJ7_BCL2L2-      tggagctggccccg-gggagggcccagcagctgaccc-----gctacacc
A0A4W2GUJ7_BCL2L2-      tggagctggccccg-gggagggcccagcagctgaccc-----gctacacc
A0A4W2GUJ7_BCL2L2-      tggagctggccccg-gggagggcccagcagctgaccc-----gctacacc
A0A5F5PML6_BCL2L2-      tggagctggccccg-gggagggcccagccgctgaccc-----actgcacc
A0A5F5PML6_BCL2L2-      tggagctggccccg-gggagggcccagccgctgaccc-----actgcacc
A0A8C5L5C6_BCL2L2-      tggagctggccctg-gagagggcccagcagctgatcc-----acttcacc
A0A8C0Q5E6_BCL2L2-      tggagctggccctg-gagagggcccagcagctgatcc-----actgcacc
A0A8I3MNK9_BCL2L2-      tggagctggccctg-gagagggcccagcagctgatcc-----actgcacc
A0A8I3RSU6_BCL2L2-      tggagctggccctg-gagagggcccagcagctgatcc-----actgcacc
A0A8I3MNK9_BCL2L2-      tggagctggccctg-gagagggcccagcagctgatcc-----actgcacc
A0A667I624_BCL2L2-      tggagcaggccctg-gggagggcccagcagctgaccc-----actgcacc
G1LKF5_BCL2L2-01        tggagctggccctg-gggagggcccagcagctgaccc-----actgcacc
G1LKF5_BCL2L2-02        tggagctggccctg-gggagggcccagcagctgaccc-----actgcacc
A0A384DPS8_BCL2L2-      tggagctggccctg-gggagggcccagcagctgaccc-----actgcacc
A0A384DPS8_BCL2L2-      tggagctggccctg-gggagggcccagcagctgaccc-----actgcacc
A0A8C6RJE0_BCL2L2-      tggagctggccccg-gggaaggcccagcagccgaccc-----tctgcacc
A0A671DWB3_BCL2L2-      tg-cccggggccggtggggaggccggggagggggccccagggggcgcagg
A0A250YBR2_BCL2L2-      tggagctggccctg-gagagggcccagctgctgaccc-----gttacacc
A0A250YBR2_BCL2L2-      tggagctggccctg-gagagggcccagctgctgaccc-----gttacacc
O88996_BCL2L2-01        tggagctggccctg-gggaaggcccagcagccgaccc-----gctgcacc
Q7TS60_BCL2L2-01        tggagctggccctg-gggaaggcccagcagccgaccc-----gctgcacc
A0A671DWB3_BCL2L2-      tggagctgggcccg-gggagggcccagcagctgatcc-----gctgcacc
A0A8C6RJE0_BCL2L2-      tggagctggccccg-gggaaggcccagcagccgaccc-----tctgcacc
A0A4W2D6A3_BCL2L2-      tg-cccggggccggtggggaggccggggagggggccccggggggcgcagg
A0A4W2GUJ7_BCL2L2-      tg-cccggggccggtggggaggccggggagggggccccggggggcgcagg
A0A4W2D6A3_BCL2L2-      tg-cccggggccggtggggaggccggggagggggccccggggggcgcagg
A0A4W2GUJ7_BCL2L2-      tg-cccggggccggtggggaggccggggagggggccccggggggcgcagg
A0A8C8YZD8_BCL2L2-      tggagctggccctg-gggagggcccagcagctgaccc-----gctgcacc
A0A8B7FJ73_BCL2L2-      tggagctggcccag-gggagggcccagcagctgaccc-----gctgcacc
A0A2K6GWM6_BCL2L2-      tggagctggcccgg-gggagggcccagcagctgaccc-----gctgcacc
A0A8D0TJQ9_BCL2L2-      tggagctggccccg-gggagggcccagcagctgaccc-----gctgcacc
A0A482LX62_BCL2L2-      tggagctggccccg-gggagggcccagcagctgaccc-----gctgcacc
A0A4X1SF63_BCL2L2-      tggagctggccccg-gggagggcccagcagctgaccc-----gctgcacc
A0A4D6NWN1_BCL2L2-      tggagctggccccg-gggagggcccagcagctgaccc-----gctgcacc
A0A4X1SF60_BCL2L2-      tggagctggccccg-gggagggcccagcagctgaccc-----gctgcacc
A0A4X1SF63_BCL2L2-      tggagctggccccg-gggagggcccagcagctgaccc-----gctgcacc
A0A8D0TJQ9_BCL2L2-      tggagctggccccg-gggagggcccagcagctgaccc-----gctgcacc
A0A4X1SF60_BCL2L2-      tggagctggccccg-gggagggcccagcagctgaccc-----gctgcacc
A0A8D0TJQ9_BCL2L2-      tggagctggccccg-gggagggcccagcagctgaccc-----gctgcacc
H0XR82_BCL2L2-01        tggagctggcccag-gggagggcccagcaactgaccc-----gttgcacc
A0A4X1SF63_BCL2L2-      tg-cccggggccggtggggaggccggggagggggccccggggggcgcagg
A0A4X1SF63_BCL2L2-      tg-cccggggccggtggggaggccggggagggggccccggggggcgcagg
A0A8D0TJQ9_BCL2L2-      tg-cccggggccggtggggaggccggggagggggccccggggggcgcagg
A0A8B7FJ73_BCL2L2-      tggagctggcccag-gggagggcccagcagctgaccc-----gctgcacc
A0A2K6GWM6_BCL2L2-      tggagctggcccgg-gggagggcccagcagctgaccc-----gctgcacc
A0A5F5PML6_BCL2L2-      tg-cccggggccggtggggaggccggggagggggccccggggggcgcagg
A0A8C8YZD8_BCL2L2-      tg-cccggggccggtggggaggccggggagggggccccggggggcgcagg
A0A8B7FJ73_BCL2L2-      tg-cccggggccggtggggaggccggggagggggccccggggggcgcagg
A0A8B7FJ73_BCL2L2-      tg-cccggggccggtggggaggccggggagggggccccggggggcgcagg
A0A2K6GWM6_BCL2L2-      tg-cccggggccggtggggaggccggggagggggccccggggggcgcagg
A0A2K6GWM6_BCL2L2-      tg-cccggggccggtggggaggccggggagggggccccggggggcgcagg
A0A8C0Q5E6_BCL2L2-      tg-cccggggccggtggggaggccggggagggggccccggggggcgcagg
A0A8I3MNK9_BCL2L2-      tg-cccggggccggtggggaggccggggagggggccccggggggcgcagg
A0A8I3RSU6_BCL2L2-      tg-cccggggccggtggggaggccggggagggggccccggggggcgcagg
A0A667I624_BCL2L2-      tg-cccggggccggtggggaggccggggagggggccccggggggcgcagg
G1P3J2_BCL2L2-01        tggagcgggtcccg-gagagggcccagcagctgaccc-----gctgcacc
G3TMU7_BCL2L2-01        tggagctggccccg-gggagggcccagcagctgaccc-----gctgcacc
A0A2K6TM77_BCL2L2-      tggagctggccccg-gggagggcccagcagctgaccc-----gctgcacc
A0A2K6TM77_BCL2L2-      tggagctggccccg-gggagggcccagcagctgaccc-----gctgcacc
A0A2K5CWY6_BCL2L2-      tggagctggccccg-gggagggcccagcagctgaccc-----gctgcacc
A0A2K5CWY6_BCL2L2-      tggagctggccccg-gggagggcccagcagctgaccc-----gctgcacc
A0A2K5CWY6_BCL2L2-      tg-cccggggccggtggggaggccggggagggggccccggggggcgcagg
U3CRF8_BCL2L2-02        tg-cccggggccggtggggaggccggggagggggccccggggggcgcagg
U3CRF8_BCL2L2-03        tg-cccggggccggtggggaggccggggagggggccccggggggcgcagg
A0A2I3GEA7_BCL2L2-      tgccccggggccggtggggaggccggggaggggggccccgggg-------
A0A8I5U2F2_BCL2L2-      tg-cccggggccggtggggaggccggggagggggccccggggggcgcagg
A0A2I2YPX6_BCL2L2-      tg-cccggggccggtggggaggccggggagggggccccggggggcgcagg
A0A2I2YPX6_BCL2L2-      tg-cccggggccggtggggaggccggggagggggccccggggggcgcagg
U3CRF8_BCL2L2-01        tggaactggccccg-gggagggcccagcagctgaccc-----gctgcacc
A0A2K6TM77_BCL2L2-      --------------------------------------------------
A0A2K6TM77_BCL2L2-      tggagctggccccg-gggagggcccagcagctgaccc-----gctgcacc
A0A2K5V0Q3_BCL2L2-      --------------------------------------------------
A0A2K6EA59_BCL2L2-      tgcccggggccggt-ggggaggccggggagggggccccggggggcgcagg
A0A2K6EA59_BCL2L2-      tggagctggccctg-gggagggcccagcagctgaccc-----gctgcacc
A0A2K5MZX9_BCL2L2-      tgcccggggccggt-ggggaggccggggagggggccccggggggcgcagg
A0A2K5MZX9_BCL2L2-      tggagctggccctg-gggagggcccagcagctgaccc-----gctgcacc
A0A2K5MZX9_BCL2L2-      tgcccggggccggt-ggggaggccggggagggggccccggggggcgcagg
A0A2K5V0Q3_BCL2L2-      --------------------------------------------------
F7G4L5_BCL2L2-03        tgcccggggccggt-ggggaggccggggagggggccccggggggcgcagg
A0A2K6EA59_BCL2L2-      tgcccggggccggt-ggggaggccggggagggggccccggggggcgcagg
A0A2K6AI25_BCL2L2-      --------------------------------------------------
A0A8D2FJU1_BCL2L2-      tgcccggggccggt-ggggaggccggggagggggccccggggggcgcagg
A0A2R9A2Q3_BCL2L2-      tggagctggccccg-gggagggcccagcagctgaccc-----gctgcacc
A0A2R9A2Q3_BCL2L2-      --------------------------------------------------
A0A2K6RW35_BCL2L2-      --------------------------------------------------
A0A2K5HEJ9_BCL2L2-      --------------------------------------------------
A0A2K5HEJ9_BCL2L2-      tggagctggccccg-gggagggcccagcagctgaccc-----gctgcacc
A0A8I5U2F2_BCL2L2-      tggagctggccccg-gggaaggcccagcagctgaccc-----gctgcacc
A0A2K5CWY6_BCL2L2-      tggagctggccccg-gggagggcccagcagctgaccc-----gctgcacc
A0A8I5U2F2_BCL2L2-      tggagctggccccg-gggaaggcccagcagctgaccc-----gctgcacc
A0A2K6RW35_BCL2L2-      tggagctggccctg-gggagggcccagcagctgaccc-----gctgcacc
A0A2K6RW35_BCL2L2-      tggagctggccctg-gggagggcccagcagctgaccc-----gctgcacc
A0A2K6ME72_BCL2L2-      tggagctggccctg-gggagggcccagcagctgaccc-----gctgcacc
A0A2R9A2Q3_BCL2L2-      tggagctggccccg-gggagggcccagcagctgaccc-----gctgcacc
A0A2K5MZX9_BCL2L2-      tggagctggccctg-gggagggcccagcagctgaccc-----gctgcacc
A0A2K6EA59_BCL2L2-      tggagctggccctg-gggagggcccagcagctgaccc-----gctgcacc
A0A2K6RW35_BCL2L2-      tggagctggccctg-gggagggcccagcagctgaccc-----gctgcacc
A0A2K6ME72_BCL2L2-      tggagctggccctg-gggagggcccagcagctgaccc-----gctgcacc
A0A8D2FJU1_BCL2L2-      tggagctggccccg-gggagggcccagcagctgaccc-----gctgcacc
A0A8D2FJU1_BCL2L2-      tggagctggccccg-gggagggcccagcagctgaccc-----gctgcacc
A0A8C9H679_BCL2L2-      tggagctggccccg-gggagggcccagcagctgaccc-----gctgcacc
A0A8C9H679_BCL2L2-      tggagctggccccg-gggagggcccagcagctgaccc-----gctgcacc
A0A2I3MUE4_BCL2L2-      tggagctggccccg-gggagggcccagcagctgaccc-----gctgcacc
A0A2I3GEA7_BCL2L2-      tggagctggccccg-gggagggcccagcagctgaccc-----gctgcacc
A0A2I3GEA7_BCL2L2-      tggagctggccccg-gggagggcccagcagctgaccc-----gctgcacc
A0A2K6AI25_BCL2L2-      tggagctggccccg-gggagggcccagcagctgaccc-----gctgcacc
A0A2K6AI25_BCL2L2-      tggagctggccccg-gggagggcccagcagctgaccc-----gctgcacc
F7G4L5_BCL2L2-02        tggagctggccccg-gggagggcccagcagctgaccc-----gctgcacc
F7G4L5_BCL2L2-01        tggagctggccccg-gggagggcccagcagctgaccc-----gctgcacc
A0A2K5V0Q3_BCL2L2-      tggagctggccccg-gggagggcccagcagctgaccc-----gctgcacc
A0A2K5V0Q3_BCL2L2-      tggagctggccccg-gggagggcccagcagctgaccc-----gctgcacc
A0A2K5V0Q3_BCL2L2-      tggagctggccccg-gggagggcccagcagctgaccc-----gctgcacc
A0A2K5V0Q3_BCL2L2-      tggagctggccccg-gggagggcccagcagctgaccc-----gctgcacc
A0A2K5V0Q3_BCL2L2-      tggagctggccccg-gggagggcccagcagctgaccc-----gctgcacc
A0A2K5V0Q3_BCL2L2-      tggagctggccccg-gggagggcccagcagctgaccc-----gctgcacc
A0A2K5V0Q3_BCL2L2-      tggagctggccccg-gggagggcccagcagctgaccc-----gctgcacc
G3V4B7_BCL2L2-08        tggagctggccccg-gggagggcccagcagctgaccc-----gctgcacc
G3V4B7_BCL2L2-07        tggagctggccccg-gggagggcccagcagctgaccc-----gctgcacc
G3V4B7_BCL2L2-06        tggagctggccccg-gggagggcccagcagctgaccc-----gctgcacc
G3V4B7_BCL2L2-05        tggagctggccccg-gggagggcccagcagctgaccc-----gctgcacc
G3V4B7_BCL2L2-04        tggagctggccccg-gggagggcccagcagctgaccc-----gctgcacc
G3V4B7_BCL2L2-03        tggagctggccccg-gggagggcccagcagctgaccc-----gctgcacc
G3V4B7_BCL2L2-02        tggagctggccccg-gggagggcccagcagctgaccc-----gctgcacc
A0A2I2YPX6_BCL2L2-      tggagctggccccg-gggagggcccagcagctgaccc-----gctgcacc
A0A2I2YPX6_BCL2L2-      tggagctggccccg-gggagggcccagcagctgaccc-----gctgcacc
A0A2K5HEJ9_BCL2L2-      tggagctggccccg-gggagggcccagcagctgaccc-----gctgcacc
A0A0D9RU30_BCL2L2-      tggagctggccccg-gggagggcccagcagctgaccc-----gctgcacc
G3V4B7_BCL2L2-01        tggagctggccccg-gggagggcccagcagctgaccc-----gctgcacc
G3V4B7_BCL2L2-09        tggagctggccccg-gggagggcccagcagctgaccc-----gctgcacc
                                                                          

H3AAS7_BCL2L2-02        gtgccatgcgggaggcg--ggggatgagtttgaggcccgcttccaccgca
H3AAS7_BCL2L2-01        gtgccatgcgggaggcg--ggggatgagtttgaggcccgcttccaccgca
Q6GP82_BCL2L2-01        cagctatgcgtgctgca--ggggatgaatttgaggagcgattcagacaag
A0A8C5PJB3_BCL2L2-      cagccatgcgtgccgct--ggagatgaatttgaagaccgtttccgtcagg
A0A4X2LP96_BCL2L2-      gggccatgcgagctgct--ggagatgagtttgagtcccgcttccaacgca
A0A5F8HG85_BCL2L2-      gggcggcgcgggggactacgggaacgggctggag--------gcggag--
A0A5F8HG85_BCL2L2-      gggccatgcgtgctgct--ggagacgagtttgagtcccgctttcgacgca
A0A5F8HG85_BCL2L2-      gggccatgcgtgctgct--ggagacgagtttgagtcccgctttcgacgca
F7G6M3_BCL2L2-01        gggccatgcgggccgcc--ggggacgagttcgagtcacgcttccggcggg
G1Q051_BCL2L2-01        aagccatgcgggcagct--ggagatgagtttgagacccatttccgatgca
G1TV33_BCL2L2-01        aagccatgcgggcagcc--ggagatgagttcgagacccgcttccggcaaa
D3Z5F7_BCL2L2-01        aagccatgcgggctgct--ggagacgagtttgagacccgtttccgccgca
G3V4B7_BCL2L2-10        ---------------------------------------------gcgca
A0A6I9LUT0_BCL2L2-      aagccatgcgggctgct--ggagacgagtttgagacacgcttccggcgca
A0A8C3X592_BCL2L2-      aagccatgcgggcagct--ggagatgagtttgagacccgcttccggcgta
A0A3Q9B4M8_BCL2L2-      aagccatgcgggcagct--ggagatgagttcgagacccgcttccggcgca
A0A7T8CLX7_BCL2L2-      -----atgcgggcagct--ggagatgagttcgagacccgcttccggcgca
A0A8D0TJQ9_BCL2L2-      aagccatgcgggcagct--ggagatgagttcgagacccgcttccggcgca
A0A4X1SF60_BCL2L2-      aagccatgcgggcagct--ggagatgagttcgagacccgcttccggcgca
A0A4X1SF63_BCL2L2-      aagccatgcgggcagct--ggagatgagttcgagacccgcttccggcgca
A0A8C0Q5E6_BCL2L2-      aagccatgcgggcagct--ggagatgagtttgagacccgcttccggcgca
A0A8I3MNK9_BCL2L2-      aagccatgcgggcagct--ggagatgagtttgagacccgcttccggcgca
A0A8I3RSU6_BCL2L2-      aagccatgcgggcagct--ggagatgagtttgagacccgcttccggcgca
A0A673VAY7_BCL2L2-      aagccatgcgggcagct--ggagatgagtttgagacccgcttccggcgca
A0A2I2UAE3_BCL2L2-      aagccatgcgtgcagct--ggagatgagtttgagacccgcttccggcgca
A0A8C8XCR9_BCL2L2-      aagccatgcgtgcagct--ggagatgagtttgagacccgcttccggcgca
A0A8C9J3S1_BCL2L2-      aagccatgcgtgcagct--ggagatgagtttgagacccgcttccggcgca
M3Y5X5_BCL2L2-01        aagccatgcgggcagct--ggagatgagtttgagacccgcttccggcgta
A0A8C7EW82_BCL2L2-      aagccatgcgggcagct--ggagatgagtttgagacccgcttccggcgta
A0A452SHI1_BCL2L2-      aagccatgcgggcagct--ggagatgagtttgagacccgcttccggcgca
A0A384DPS8_BCL2L2-      aagccatgcgggcagct--ggagatgagtttgagacccgcttccggcgca
A0A8C4LWK5_BCL2L2-      aagccatgcgggcagct--ggagatgagtttgagacccgcttccggcgca
A0A8C6BK57_BCL2L2-      aagccatgcgggcagct--ggagatgagttcgagacccgcttccggcgca
A0A8C9CXQ5_BCL2L2-      aagccatgcgggcagct--ggagatgagttcgagacccgcttccggcgca
A0A8B8WSS7_BCL2L2-      aagccatgcgggcagct--ggagatgagttcgagacccgcttccggcgca
W5QDH4_BCL2L2-02        aagccatgcgggcagct--ggagatgagtttgagacccgcttccggcgca
A0A8C6CUC2_BCL2L2-      aagccatgcgggcagct--ggagatgagttcgagacccgcttccggcgca
A0A452ECF0_BCL2L2-      aagccatgcgggcagct--ggagatgagtttgagacccgcttccggcgca
A0A4W2D6A3_BCL2L2-      aagccatgcgggcagct--ggagatgagttcgagacccgcttccggcgca
A0A4W2D6A3_BCL2L2-      aagccatgcgggcagct--ggagatgagttcgagacccgcttccggcgca
A0A4W2GUJ7_BCL2L2-      aagccatgcgggcagct--ggagatgagttcgagacccgcttccggcgca
A0A4W2GUJ7_BCL2L2-      aagccatgcgggcagct--ggagatgagttcgagacccgcttccggcgca
A0A8B9WT05_BCL2L2-      aagccatgcgggcagct--ggagatgagttcgagacccgcttccggcgca
A0A4W2D6A3_BCL2L2-      aagccatgcgggcagct--ggagatgagttcgagacccgcttccggcgca
A0A4W2D6A3_BCL2L2-      aagccatgcgggcagct--ggagatgagttcgagacccgcttccggcgca
A0A4W2GUJ7_BCL2L2-      aagccatgcgggcagct--ggagatgagttcgagacccgcttccggcgca
A0A4W2GUJ7_BCL2L2-      aagccatgcgggcagct--ggagatgagttcgagacccgcttccggcgca
Q05KI8_BCL2L2-01        aagccatgcgggcagct--ggagatgagttcgagacccgcttccggcgca
A0A8C2VJ88_BCL2L2-      aagccatgcgggcagct--ggagatgagttcgagacccggttccggcgca
A0A286XQQ9_BCL2L2-      aagccatgcgggcagct--ggggatgagttcgagacccgattccggcgca
A0A8C2VJ88_BCL2L2-      aagccatgcgggcagct--ggagatgagttcgagacccggttccggcgca
A0A8D2APK0_BCL2L2-      aagccatgcgggcagct--ggagatgagttcgagacccgcttccggcgca
A0A287D9B3_BCL2L2-      aagccatgcgggcagct--ggagatgagttcgagacccgcttccggcgca
A0A8D2HGM1_BCL2L2-      aagccatgcgggcagct--ggagatgagttcgagacccgcttccggcgca
A0A287D9B3_BCL2L2-      aagccatgcgggcagct--ggagatgagttcgagacccgcttccggcgca
A0A8C9PGU3_BCL2L2-      aagccatgcgggcagct--ggagatgagttcgagacccgcttccggcgca
W5QDH4_BCL2L2-01        aagccatgcgggcagct--ggagatgagtttgagacccgcttccggcgca
A0A4W2GUJ7_BCL2L2-      aagccatgcgggcagct--ggagatgagttcgagacccgcttccggcgca
A0A4W2GUJ7_BCL2L2-      aagccatgcgggcagct--ggagatgagttcgagacccgcttccggcgca
A0A4W2D6A3_BCL2L2-      aagccatgcgggcagct--ggagatgagttcgagacccgcttccggcgca
A0A4W2GUJ7_BCL2L2-      aagccatgcgggcagct--ggagatgagttcgagacccgcttccggcgca
A0A4W2D6A3_BCL2L2-      aagccatgcgggcagct--ggagatgagttcgagacccgcttccggcgca
A0A4W2GUJ7_BCL2L2-      aagccatgcgggcagct--ggagatgagttcgagacccgcttccggcgca
A0A4W2GUJ7_BCL2L2-      aagccatgcgggcagct--ggagatgagttcgagacccgcttccggcgca
A0A4W2GUJ7_BCL2L2-      aagccatgcgggcagct--ggagatgagttcgagacccgcttccggcgca
A0A5F5PML6_BCL2L2-      aagccatgcgggcagct--ggagatgagtttgagacccgcttccggcgca
A0A5F5PML6_BCL2L2-      aagccatgcgggcagct--ggagatgagtttgagacccgcttccggcgca
A0A8C5L5C6_BCL2L2-      aagccatgagggcagct--ggagatgagtttgagacccgcttccggcgca
A0A8C0Q5E6_BCL2L2-      aagccatgcgggcagct--ggagatgagtttgagacccgcttccggcgca
A0A8I3MNK9_BCL2L2-      aagccatgcgggcagct--ggagatgagtttgagacccgcttccggcgca
A0A8I3RSU6_BCL2L2-      aagccatgcgggcagct--ggagatgagtttgagacccgcttccggcgca
A0A8I3MNK9_BCL2L2-      aagccatgcgggcagct--ggagatgagtttgagacccgcttccggcgca
A0A667I624_BCL2L2-      aagccatgcgtgcagct--ggagatgagtttgagacccgcttccggcgca
G1LKF5_BCL2L2-01        aagccatgcgggcagct--ggagatgagtttgagacacgcttccggcgca
G1LKF5_BCL2L2-02        aagccatgcgggcagct--ggagatgagtttgagacacgcttccggcgca
A0A384DPS8_BCL2L2-      aagccatgcgggcagct--ggagatgagtttgagacccgcttccggcgca
A0A384DPS8_BCL2L2-      aagccatgcgggcagct--ggagatgagtttgagacccgcttccggcgca
A0A8C6RJE0_BCL2L2-      aagccatgcgggcagct--ggagatgagtttgagacccgcttccggcgca
A0A671DWB3_BCL2L2-      ggactacgggaacggcc--tggagt---ctgaggaactggagcctgggga
A0A250YBR2_BCL2L2-      aagccatgcgggcagct--ggagatgagtttgagacccgcttccggcgca
A0A250YBR2_BCL2L2-      aagccatgcgggcagct--ggagatgagtttgagacccgcttccggcgca
O88996_BCL2L2-01        aagccatgcgggcagct--ggagacgagtttgagacccgcttccggcgca
Q7TS60_BCL2L2-01        aagccatgcgggcagct--ggagacgagtttgagacccgcttccggcgca
A0A671DWB3_BCL2L2-      aagccatgcgggcagct--ggagatgagttcgagacccgcttccgtcgca
A0A8C6RJE0_BCL2L2-      aagccatgcgggcagct--ggagatgagtttgagacccgcttccggcgca
A0A4W2D6A3_BCL2L2-      ggactacgggaacggct--tggagt---ctgaggaactggagcctgagga
A0A4W2GUJ7_BCL2L2-      ggactacgggaacggct--tggagt---ctgaggaactggagcctgagga
A0A4W2D6A3_BCL2L2-      ggactacgggaacggct--tggagt---ctgaggaactggagcctgagga
A0A4W2GUJ7_BCL2L2-      ggactacgggaacggct--tggagt---ctgaggaactggagcctgagga
A0A8C8YZD8_BCL2L2-      aagccatgcgggcagct--ggggatgagtttgagacccgcttccggcgta
A0A8B7FJ73_BCL2L2-      aagccatgcgggcagct--ggagatgagttcgagacccgcttccggcgta
A0A2K6GWM6_BCL2L2-      aagccatgcgggcagct--ggagatgagtttgagacccgcttccggcgta
A0A8D0TJQ9_BCL2L2-      aagccatgcgggcagct--ggagatgagttcgagacccgcttccggcgca
A0A482LX62_BCL2L2-      aagccatgcgggcagct--ggagatgagttcgagacccgcttccggcgca
A0A4X1SF63_BCL2L2-      aagccatgcgggcagct--ggagatgagttcgagacccgcttccggcgca
A0A4D6NWN1_BCL2L2-      aagccatgcgggcagct--ggagatgagttcgagacccgcttccggcgca
A0A4X1SF60_BCL2L2-      aagccatgcgggcagct--ggagatgagttcgagacccgcttccggcgca
A0A4X1SF63_BCL2L2-      aagccatgcgggcagct--ggagatgagttcgagacccgcttccggcgca
A0A8D0TJQ9_BCL2L2-      aagccatgcgggcagct--ggagatgagttcgagacccgcttccggcgca
A0A4X1SF60_BCL2L2-      aagccatgcgggcagct--ggagatgagttcgagacccgcttccggcgca
A0A8D0TJQ9_BCL2L2-      aagccatgcgggcagct--ggagatgagttcgagacccgcttccggcgca
H0XR82_BCL2L2-01        aagccatgcgggcagct--ggagatgagttcgagacccgcttccggcgta
A0A4X1SF63_BCL2L2-      ggactacgggaacggct--tggagt---ctgaggagctggagcctgagga
A0A4X1SF63_BCL2L2-      ggactacgggaacggct--tggagt---ctgaggagctggagcctgagga
A0A8D0TJQ9_BCL2L2-      ggactacgggaacggct--tggagt---ctgaggagctggagcctgagga
A0A8B7FJ73_BCL2L2-      aagccatgcgggcagct--ggagatgagttcgagacccgcttccggcgta
A0A2K6GWM6_BCL2L2-      aagccatgcgggcagct--ggagatgagtttgagacccgcttccggcgta
A0A5F5PML6_BCL2L2-      ggactacgggaacggcc--tggagt---ctgaggaactggagcctgagga
A0A8C8YZD8_BCL2L2-      ggactacgggaacggcc--tggagt---ctgaggaactggagcctgggga
A0A8B7FJ73_BCL2L2-      ggactacgggaacggcc--tggagt---ctgaggaactggagcctgggga
A0A8B7FJ73_BCL2L2-      ggactacgggaacggcc--tggagt---ctgaggaactggagcctgggga
A0A2K6GWM6_BCL2L2-      ggactacgggaacggcc--tggagt---ctgaggaactggagcctgggga
A0A2K6GWM6_BCL2L2-      ggactacgggaacggcc--tggagt---ctgaggaactggagcctgggga
A0A8C0Q5E6_BCL2L2-      ggactacgggaacggcc--tggagt---ctgaggaactggagcctgagga
A0A8I3MNK9_BCL2L2-      ggactacgggaacggcc--tggagt---ctgaggaactggagcctgagga
A0A8I3RSU6_BCL2L2-      ggactacgggaacggcc--tggagt---ctgaggaactggagcctgagga
A0A667I624_BCL2L2-      ggactacgggaacggcc--tggagt---ctgaggaactggagcctgagga
G1P3J2_BCL2L2-01        aagccatgcgggcagct--ggagatgagttcgagacccgtttccgtcgca
G3TMU7_BCL2L2-01        aagccatgcgggcagct--ggagatgagttcgagacccgcttccggcgca
A0A2K6TM77_BCL2L2-      aagcaatgcgggcagct--ggagatgagttcgagacccgcttccggcgca
A0A2K6TM77_BCL2L2-      aagcaatgcgggcagct--ggagatgagttcgagacccgcttccggcgca
A0A2K5CWY6_BCL2L2-      aagcaatgcgggcagct--ggagatgagttcgagacccgcttccggcgca
A0A2K5CWY6_BCL2L2-      aagcaatgcgggcagct--ggagatgagttcgagacccgcttccggcgca
A0A2K5CWY6_BCL2L2-      ggactacgggaacggcc--tggagt---ctgaggaactggagcctgagga
U3CRF8_BCL2L2-02        ggactacgggaacggcc--tggagt---ctgaggaactggagcctgagga
U3CRF8_BCL2L2-03        ggactacgggaacggcc--tggagt---ctgaggaactggagcctgagga
A0A2I3GEA7_BCL2L2-      -----------------------------------------gcctgagga
A0A8I5U2F2_BCL2L2-      ggactacgggaacggcc--tggagt---ctgaggaactggagcctgagga
A0A2I2YPX6_BCL2L2-      ggactacgggaacggcc--tggagt---ctgaggaactggagcctgagga
A0A2I2YPX6_BCL2L2-      ggactacgggaacggcc--tggagt---ctgaggaactggagcctgagga
U3CRF8_BCL2L2-01        aagcaatgcgggcagct--ggagatgaattcgagacccgcttccggcgca
A0A2K6TM77_BCL2L2-      --------------------------------------------------
A0A2K6TM77_BCL2L2-      aagcaatgcgggcagct--ggagatgagttcgagacccgcttccggcgca
A0A2K5V0Q3_BCL2L2-      --------------------------------------------------
A0A2K6EA59_BCL2L2-      ggactacgggaacggcc--tggagt---ctgaggaactggagcctgagga
A0A2K6EA59_BCL2L2-      aagccatgcgggcagct--ggagatgagttcgagacccgcttccggcgca
A0A2K5MZX9_BCL2L2-      ggactacgggaacggcc--tggagt---ctgaggaactggagcctgagga
A0A2K5MZX9_BCL2L2-      aagccatgcgggcagct--ggagatgagttcgagacccgcttccggcgca
A0A2K5MZX9_BCL2L2-      ggactacgggaacggcc--tggagt---ctgaggaactggagcctgagga
A0A2K5V0Q3_BCL2L2-      --------------------------------------------------
F7G4L5_BCL2L2-03        ggactacgggaacggcc--tggagt---ctgaggaactggagcctgagga
A0A2K6EA59_BCL2L2-      ggactacgggaacggcc--tggagt---ctgaggaactggagcctgagga
A0A2K6AI25_BCL2L2-      --------------------------------------------------
A0A8D2FJU1_BCL2L2-      ggactacgggaacggcc--tggagt---ctgaggaactggagcctgagga
A0A2R9A2Q3_BCL2L2-      aagccatgcgggcagct--ggagatgagttcgagacccgcttccggcgca
A0A2R9A2Q3_BCL2L2-      --------------------------------------------------
A0A2K6RW35_BCL2L2-      --------------------------------------------------
A0A2K5HEJ9_BCL2L2-      --------------------------------------------------
A0A2K5HEJ9_BCL2L2-      aagccatgcgggcagct--ggagatgagttcgagacccgcttccggcgca
A0A8I5U2F2_BCL2L2-      aagccatgcgggcagct--ggggatgagttcgagacccgcttccggcgca
A0A2K5CWY6_BCL2L2-      aagcaatgcgggcagct--ggagatgagttcgagacccgcttccggcgca
A0A8I5U2F2_BCL2L2-      aagccatgcgggcagct--ggggatgagttcgagacccgcttccggcgca
A0A2K6RW35_BCL2L2-      aagccatgcgggcagct--ggagatgagttcgagacccgcttccggcgca
A0A2K6RW35_BCL2L2-      aagccatgcgggcagct--ggagatgagttcgagacccgcttccggcgca
A0A2K6ME72_BCL2L2-      aagccatgcgggcagct--ggagatgagttcgagacccgcttccggcgca
A0A2R9A2Q3_BCL2L2-      aagccatgcgggcagct--ggagatgagttcgagacccgcttccggcgca
A0A2K5MZX9_BCL2L2-      aagccatgcgggcagct--ggagatgagttcgagacccgcttccggcgca
A0A2K6EA59_BCL2L2-      aagccatgcgggcagct--ggagatgagttcgagacccgcttccggcgca
A0A2K6RW35_BCL2L2-      aagccatgcgggcagct--ggagatgagttcgagacccgcttccggcgca
A0A2K6ME72_BCL2L2-      aagccatgcgggcagct--ggagatgagttcgagacccgcttccggcgca
A0A8D2FJU1_BCL2L2-      aagccatgcgggcagct--ggagatgagttcgagacccgcttccggcgca
A0A8D2FJU1_BCL2L2-      aagccatgcgggcagct--ggagatgagttcgagacccgcttccggcgca
A0A8C9H679_BCL2L2-      aagccatgcgggcagct--ggagatgagttcgagacccgcttccggcgca
A0A8C9H679_BCL2L2-      aagccatgcgggcagct--ggagatgagttcgagacccgcttccggcgca
A0A2I3MUE4_BCL2L2-      aagccatgcgggcagct--ggagatgagttcgagacccgcttccggcgca
A0A2I3GEA7_BCL2L2-      aagccatgcgggcagct--ggagatgagttcgagacccgcttccggcgca
A0A2I3GEA7_BCL2L2-      aagccatgcgggcagct--ggagatgagttcgagacccgcttccggcgca
A0A2K6AI25_BCL2L2-      aagccatgcgggcagct--ggagatgagttcgagacccgcttccggcgca
A0A2K6AI25_BCL2L2-      aagccatgcgggcagct--ggagatgagttcgagacccgcttccggcgca
F7G4L5_BCL2L2-02        aagccatgcgggcagct--ggagatgagttcgagacccgcttccggcgca
F7G4L5_BCL2L2-01        aagccatgcgggcagct--ggagatgagttcgagacccgcttccggcgca
A0A2K5V0Q3_BCL2L2-      aagccatgcgggcagct--ggagatgagttcgagacccgcttccggcgca
A0A2K5V0Q3_BCL2L2-      aagccatgcgggcagct--ggagatgagttcgagacccgcttccggcgca
A0A2K5V0Q3_BCL2L2-      aagccatgcgggcagct--ggagatgagttcgagacccgcttccggcgca
A0A2K5V0Q3_BCL2L2-      aagccatgcgggcagct--ggagatgagttcgagacccgcttccggcgca
A0A2K5V0Q3_BCL2L2-      aagccatgcgggcagct--ggagatgagttcgagacccgcttccggcgca
A0A2K5V0Q3_BCL2L2-      aagccatgcgggcagct--ggagatgagttcgagacccgcttccggcgca
A0A2K5V0Q3_BCL2L2-      aagccatgcgggcagct--ggagatgagttcgagacccgcttccggcgca
G3V4B7_BCL2L2-08        aagccatgcgggcagct--ggagatgagttcgagacccgcttccggcgca
G3V4B7_BCL2L2-07        aagccatgcgggcagct--ggagatgagttcgagacccgcttccggcgca
G3V4B7_BCL2L2-06        aagccatgcgggcagct--ggagatgagttcgagacccgcttccggcgca
G3V4B7_BCL2L2-05        aagccatgcgggcagct--ggagatgagttcgagacccgcttccggcgca
G3V4B7_BCL2L2-04        aagccatgcgggcagct--ggagatgagttcgagacccgcttccggcgca
G3V4B7_BCL2L2-03        aagccatgcgggcagct--ggagatgagttcgagacccgcttccggcgca
G3V4B7_BCL2L2-02        aagccatgcgggcagct--ggagatgagttcgagacccgcttccggcgca
A0A2I2YPX6_BCL2L2-      aagccatgcgggcagct--ggagatgagttcgagacccgcttccggcgca
A0A2I2YPX6_BCL2L2-      aagccatgcgggcagct--ggagatgagttcgagacccgcttccggcgca
A0A2K5HEJ9_BCL2L2-      aagccatgcgggcagct--ggagatgagttcgagacccgcttccggcgca
A0A0D9RU30_BCL2L2-      aagccatgcgggcagct--ggagatgagttcgagacccgcttccggcgca
G3V4B7_BCL2L2-01        aagccatgcgggcagct--ggagatga-----------------------
G3V4B7_BCL2L2-09        aagccatgcgggcagct--ggagatgagttcgagacccgcttccggcgca
                                                                          

H3AAS7_BCL2L2-02        ccttcaactccttgtcgtcacaccttcacatcacaccgggcacggcttac
H3AAS7_BCL2L2-01        ccttcaactccttgtcgtcacaccttcacatcacaccgggcacggcttac
Q6GP82_BCL2L2-01        cattcagtgagatctccacacagatccacgtgacccccggcacagcatat
A0A8C5PJB3_BCL2L2-      ccttcagcgaaatatctactcagatccacgtcacgcctggcacggcatat
A0A4X2LP96_BCL2L2-      cattttctgatctggctgctcaattgcatgtgactcctggctcagctcag
A0A5F8HG85_BCL2L2-      --------gagctggagcctgag--------gaattgctgctagagccag
A0A5F8HG85_BCL2L2-      cattttctgatctggccgctcagttgcatgtgactcctggctcggctcag
A0A5F8HG85_BCL2L2-      cattttctgatctggccgctcagttgcatgtgactcctggctcggctcag
F7G6M3_BCL2L2-01        ccttctcggacttggcgtcccagctgcacgtgacgcccggctcggcccag
G1Q051_BCL2L2-01        ccttctctgatctggtggctcagctgcatgtgaccccaggttcagcccag
G1TV33_BCL2L2-01        acttctccgacctggccgctcagttgcatgtgaccccaggctcagcacag
D3Z5F7_BCL2L2-01        ccttctctgacctggccgctcagctacacgtgaccccaggctcagcccag
G3V4B7_BCL2L2-10        ccttctctgatctggcggctcagctgcatgtgaccccaggctcagcccaa
A0A6I9LUT0_BCL2L2-      ccttctccgacctggccgctcagctacacgtgaccccaggctcagcccag
A0A8C3X592_BCL2L2-      ccttctcagatctggcgtctcagttgcatgtaaccccagggtcggcccag
A0A3Q9B4M8_BCL2L2-      ccttctcagatttggcagctcagttgcatgtgaccccgggctcggcccag
A0A7T8CLX7_BCL2L2-      ccttctcagatttggcagctcagttgcatgtgaccccgggctcggcccag
A0A8D0TJQ9_BCL2L2-      ccttctcagatttggcagctcagttgcatgtgaccccgggctcggcccag
A0A4X1SF60_BCL2L2-      ccttctcagatttggcagctcagttgcatgtgaccccgggctcggcccag
A0A4X1SF63_BCL2L2-      ccttctcagatttggcagctcagttgcatgtgaccccgggctcggcccag
A0A8C0Q5E6_BCL2L2-      ccttctctgatttggcagcccagctgcatgtgaccccaggctcagcccag
A0A8I3MNK9_BCL2L2-      ccttctctgatttggcagcccagctgcatgtgaccccaggctcagcccag
A0A8I3RSU6_BCL2L2-      ccttctctgatttggcagcccagctgcatgtgaccccaggctcagcccag
A0A673VAY7_BCL2L2-      ccttctctgatttggcagcccagttgcatgtgacccctggctcagcccag
A0A2I2UAE3_BCL2L2-      ccttctctgatttggcagcccagttgcatgtgacccctgggtcagcccag
A0A8C8XCR9_BCL2L2-      ccttctctgatttggcagcccagttgcatgtgacccctgggtcagcccag
A0A8C9J3S1_BCL2L2-      ccttctctgatttggcagcccagttgcatgtgacccctgggtcagcccag
M3Y5X5_BCL2L2-01        ccttctctgatttggcagcccagctgcatgtgaccccaggctcggcccag
A0A8C7EW82_BCL2L2-      ccttctctgatttggcagcccagctgcatgtgaccccaggctcggcccag
A0A452SHI1_BCL2L2-      ccttctctgatttggcagcccagctgcatgtgaccccaggctcagcccag
A0A384DPS8_BCL2L2-      ccttctctgatttggcagcccagctgcatgtgaccccaggctcagcccag
A0A8C4LWK5_BCL2L2-      ccttctctgatctggcggctcagctgcatgtgaccccgggctcagcccag
A0A8C6BK57_BCL2L2-      ccttctcggatctggcagctcagctgcatgtgaccccgggctcggcccag
A0A8C9CXQ5_BCL2L2-      ccttctcagatctggcagctcagctgcatgtgaccccgggctcggcccag
A0A8B8WSS7_BCL2L2-      ccttctccgatctggcagctcagctgcatgtgaccccgggctcggcccag
W5QDH4_BCL2L2-02        ccttctccgatttggcagctcagctgcatgtgaccccgggttcggcccag
A0A8C6CUC2_BCL2L2-      ccttctccgatctggcagctcagttgcatgtgaccccgggctcggcccag
A0A452ECF0_BCL2L2-      ccttctccgatctggcagctcagctgcatgtgaccccgggttcggcccag
A0A4W2D6A3_BCL2L2-      ccttctccgatctggcagctcagctgcatgtgaccccgggctcggcccag
A0A4W2D6A3_BCL2L2-      ccttctccgatctggcagctcagctgcatgtgaccccgggctcggcccag
A0A4W2GUJ7_BCL2L2-      ccttctccgatctggcagctcagctgcatgtgaccccgggctcggcccag
A0A4W2GUJ7_BCL2L2-      ccttctccgatctggcagctcagctgcatgtgaccccgggctcggcccag
A0A8B9WT05_BCL2L2-      ccttctccgatctggcagctcagctgcatgtgaccccgggctcggcccag
A0A4W2D6A3_BCL2L2-      ccttctccgatctggcagctcagctgcatgtgaccccgggctcggcccag
A0A4W2D6A3_BCL2L2-      ccttctccgatctggcagctcagctgcatgtgaccccgggctcggcccag
A0A4W2GUJ7_BCL2L2-      ccttctccgatctggcagctcagctgcatgtgaccccgggctcggcccag
A0A4W2GUJ7_BCL2L2-      ccttctccgatctggcagctcagctgcatgtgaccccgggctcggcccag
Q05KI8_BCL2L2-01        ccttctccgatctggcagctcagctgcatgtgaccccgggctcggcccag
A0A8C2VJ88_BCL2L2-      ccttctcagatctggctgctcagctgcatgtgacccctggctcagcccag
A0A286XQQ9_BCL2L2-      ccttctctgatctggctgctcagctgcatgtgacccctggctcagcccag
A0A8C2VJ88_BCL2L2-      ccttctcagatctggctgctcagctgcatgtgacccctggctcagcccag
A0A8D2APK0_BCL2L2-      ccttctctgatttggcagctcagcttcatgtgaccccaggttcagcacag
A0A287D9B3_BCL2L2-      ccttctctgatctggcagctcagctgcatgtgaccccgggttcagctcag
A0A8D2HGM1_BCL2L2-      ccttctcggatctggcagctcagctgcatgtgaccccgggttcagctcag
A0A287D9B3_BCL2L2-      ccttctctgatctggcagctcagctgcatgtgaccccgggttcagctcag
A0A8C9PGU3_BCL2L2-      ccttctctgatctggcagctcagctgcatgtgaccccgggttcagctcag
W5QDH4_BCL2L2-01        ccttctccgatttggcagctcagctgcatgtgaccccgggttcggcccag
A0A4W2GUJ7_BCL2L2-      ccttctccgatctggcagctcagctgcatgtgaccccgggctcggcccag
A0A4W2GUJ7_BCL2L2-      ccttctccgatctggcagctcagctgcatgtgaccccgggctcggcccag
A0A4W2D6A3_BCL2L2-      ccttctccgatctggcagctcagctgcatgtgaccccgggctcggcccag
A0A4W2GUJ7_BCL2L2-      ccttctccgatctggcagctcagctgcatgtgaccccgggctcggcccag
A0A4W2D6A3_BCL2L2-      ccttctccgatctggcagctcagctgcatgtgaccccgggctcggcccag
A0A4W2GUJ7_BCL2L2-      ccttctccgatctggcagctcagctgcatgtgaccccgggctcggcccag
A0A4W2GUJ7_BCL2L2-      ccttctccgatctggcagctcagctgcatgtgaccccgggctcggcccag
A0A4W2GUJ7_BCL2L2-      ccttctccgatctggcagctcagctgcatgtgaccccgggctcggcccag
A0A5F5PML6_BCL2L2-      ccttctctgatctggcggctcagctgcatgtgaccccgggctcagcccag
A0A5F5PML6_BCL2L2-      ccttctctgatctggcggctcagctgcatgtgaccccgggctcagcccag
A0A8C5L5C6_BCL2L2-      ccttctctgacctagctgctcagctgcatgtgaccccaggctcagcccag
A0A8C0Q5E6_BCL2L2-      ccttctctgatttggcagcccagctgcatgtgaccccaggctcagcccag
A0A8I3MNK9_BCL2L2-      ccttctctgatttggcagcccagctgcatgtgaccccaggctcagcccag
A0A8I3RSU6_BCL2L2-      ccttctctgatttggcagcccagctgcatgtgaccccaggctcagcccag
A0A8I3MNK9_BCL2L2-      ccttctctgatttggcagcccagctgcatgtgaccccaggctcagcccag
A0A667I624_BCL2L2-      ccttctctgatttggcagcccagttgcatgtgacccctgggtcagcccag
G1LKF5_BCL2L2-01        ccttctctgatttggcagcccagctgcatgtgaccccaggctcagcccag
G1LKF5_BCL2L2-02        ccttctctgatttggcagcccagctgcatgtgaccccaggctcagcccag
A0A384DPS8_BCL2L2-      ccttctctgatttggcagcccagctgcatgtgaccccaggctcagcccag
A0A384DPS8_BCL2L2-      ccttctctgatttggcagcccagctgcatgtgaccccaggctcagcccag
A0A8C6RJE0_BCL2L2-      ccttctctgatctagccgctcagctgcatgtgaccccaggctcagcccag
A0A671DWB3_BCL2L2-      gttgct----gctggagccggagcc-----cgagcccgagcccgaagagg
A0A250YBR2_BCL2L2-      cattctctgatctggcggctcagctacatgtgaccccaggctcagcccag
A0A250YBR2_BCL2L2-      cattctctgatctggcggctcagctacatgtgaccccaggctcagcccag
O88996_BCL2L2-01        ccttctctgacctggccgctcagctacacgtgaccccaggctcagcccag
Q7TS60_BCL2L2-01        ccttctctgacctggccgctcagctacacgtgaccccaggctcagcccag
A0A671DWB3_BCL2L2-      ccttctctgatctggcggctcagttgcatgtgaccccgggctcagctcag
A0A8C6RJE0_BCL2L2-      ccttctctgatctagccgctcagctgcatgtgaccccaggctcagcccag
A0A4W2D6A3_BCL2L2-      gctgct----gctggagcccgagccg-----gagcccgagcccgaagagg
A0A4W2GUJ7_BCL2L2-      gctgct----gctggagcccgagccg-----gagcccgagcccgaagagg
A0A4W2D6A3_BCL2L2-      gctgct----gctggagcccgagccg-----gagcccgagcccgaagagg
A0A4W2GUJ7_BCL2L2-      gctgct----gctggagcccgagccg-----gagcccgagcccgaagagg
A0A8C8YZD8_BCL2L2-      ccttctctgatctggcggctcagctgcatgtgaccccgggctcagcccag
A0A8B7FJ73_BCL2L2-      ccttctctgatctggcagctcagctgcatgtgaccccaggctcagcccag
A0A2K6GWM6_BCL2L2-      ccttctctgatctggcggctcagctgcatgtgacccccggctcagcccag
A0A8D0TJQ9_BCL2L2-      ccttctcagatttggcagctcagttgcatgtgaccccgggctcggcccag
A0A482LX62_BCL2L2-      ccttctcagatttggcagctcagttgcatgtgaccccgggctcggcccag
A0A4X1SF63_BCL2L2-      ccttctcagatttggcagctcagttgcatgtgaccccgggctcggcccag
A0A4D6NWN1_BCL2L2-      ccttctcagatttggcagctcagttgcatgtgaccccgggctcggcccag
A0A4X1SF60_BCL2L2-      ccttctcagatttggcagctcagttgcatgtgaccccgggctcggcccag
A0A4X1SF63_BCL2L2-      ccttctcagatttggcagctcagttgcatgtgaccccgggctcggcccag
A0A8D0TJQ9_BCL2L2-      ccttctcagatttggcagctcagttgcatgtgaccccgggctcggcccag
A0A4X1SF60_BCL2L2-      ccttctcagatttggcagctcagttgcatgtgaccccgggctcggcccag
A0A8D0TJQ9_BCL2L2-      ccttctcagatttggcagctcagttgcatgtgaccccgggctcggcccag
H0XR82_BCL2L2-01        ccttctctgatctggcagctcagctacatgtgaccccaggctcagcccag
A0A4X1SF63_BCL2L2-      gctgct----gctggagcccgagccg-----gagcccgagcccgaagagg
A0A4X1SF63_BCL2L2-      gctgct----gctggagcccgagccg-----gagcccgagcccgaagagg
A0A8D0TJQ9_BCL2L2-      gctgct----gctggagcccgagccg-----gagcccgagcccgaagagg
A0A8B7FJ73_BCL2L2-      ccttctctgatctggcagctcagctgcatgtgaccccaggctcagcccag
A0A2K6GWM6_BCL2L2-      ccttctctgatctggcggctcagctgcatgtgacccccggctcagcccag
A0A5F5PML6_BCL2L2-      gctgct----gctggagcccgagccg-----gagcccgagcccgaagagg
A0A8C8YZD8_BCL2L2-      gctgct----gctggagcccgagccg-----gagcccgagcccgaagagg
A0A8B7FJ73_BCL2L2-      gctgct----gctggagcccgagccg-----gagcccgagcccgaagagg
A0A8B7FJ73_BCL2L2-      --------------------------------------------------
A0A2K6GWM6_BCL2L2-      gctgct----gctggagcccgagccg-----gagcccgagcccgaagagg
A0A2K6GWM6_BCL2L2-      --------------------------------------------------
A0A8C0Q5E6_BCL2L2-      gctgct----gctggagcccgagccg-----gagcccgagcccgaagagg
A0A8I3MNK9_BCL2L2-      gctgct----gctggagcccgagccg-----gagcccgagcccgaagagg
A0A8I3RSU6_BCL2L2-      gctgct----gctggagcccgagccg-----gagcccgagcccgaagagg
A0A667I624_BCL2L2-      gctgct----gctggagcccgagccg-----gagcccgagcccgaagagg
G1P3J2_BCL2L2-01        ccttctctgatctggcggctcagctgcatgtgaccccgggctcagcccag
G3TMU7_BCL2L2-01        ccttctctgatctggcagcccagctgcatgtgaccccaggctcagcccag
A0A2K6TM77_BCL2L2-      ccttctctgatctggcggctcagctgcatgtgaccccaggctcagcccaa
A0A2K6TM77_BCL2L2-      ccttctctgatctggcggctcagctgcatgtgaccccaggctcagcccaa
A0A2K5CWY6_BCL2L2-      ccttctctgatctggcggctcagctgcatgtgaccccaggctcagcccaa
A0A2K5CWY6_BCL2L2-      ccttctctgatctggcggctcagctgcatgtgaccccaggctcagcccaa
A0A2K5CWY6_BCL2L2-      gctgct----gctggagcccgagccg-----gagcccgagcctgaa----
U3CRF8_BCL2L2-02        gctgct----gctggagcccgagccg-----gagcccgagcctgaagagg
U3CRF8_BCL2L2-03        gctgct----gctggagcccgagccg-----gagcccgagcctgaagagg
A0A2I3GEA7_BCL2L2-      gctgct----gctggagcccgagccg-----gagcccgagcccgaagagg
A0A8I5U2F2_BCL2L2-      gctgct----gctggagcccgagccg-----gagcccgagcccgaagagg
A0A2I2YPX6_BCL2L2-      gctgct----gctggagcccgagccg-----gagcccgagcccgaagagg
A0A2I2YPX6_BCL2L2-      --------------------------------------------------
U3CRF8_BCL2L2-01        ccttctctgatctggcggctcagctgcatgtgaccccaggttcagcccaa
A0A2K6TM77_BCL2L2-      --------------------------------------------------
A0A2K6TM77_BCL2L2-      ccttctctgatctggcggctcagctgcatgtgaccccaggctcagcccaa
A0A2K5V0Q3_BCL2L2-      --------------------------------------------------
A0A2K6EA59_BCL2L2-      --------------------------------------------------
A0A2K6EA59_BCL2L2-      ccttctctgatctggcggctcagctgcatgtgaccccaggctcagcacag
A0A2K5MZX9_BCL2L2-      --------------------------------------------------
A0A2K5MZX9_BCL2L2-      ccttctctgatctggcggctcagctgcatgtgaccccaggctcagcacag
A0A2K5MZX9_BCL2L2-      gctgct----gctggagcccgagccg-----gagcccgagcccgaagagg
A0A2K5V0Q3_BCL2L2-      --------------------------------------------------
F7G4L5_BCL2L2-03        gctgct----gctggagcccgagccg-----gagcccgagcccgaagagg
A0A2K6EA59_BCL2L2-      gctgct----gctggagcccgagccg-----gagcccgagcccgaagagg
A0A2K6AI25_BCL2L2-      --------------------------------------------------
A0A8D2FJU1_BCL2L2-      gctgct----gctggagcccgagccg-----gagcccgagcccgaagagg
A0A2R9A2Q3_BCL2L2-      ccttctctgatctggcggctcagctgcatgtgaccccaggctcagcccaa
A0A2R9A2Q3_BCL2L2-      --------------------------------------------------
A0A2K6RW35_BCL2L2-      --------------------------------------------------
A0A2K5HEJ9_BCL2L2-      --------------------------------------------------
A0A2K5HEJ9_BCL2L2-      ccttctctgatctggcggctcagctgcatgtgaccccaggctcagcgcag
A0A8I5U2F2_BCL2L2-      ccttctctgatctggcggctcagctgcatgtgaccccaggctcagcccaa
A0A2K5CWY6_BCL2L2-      ccttctctgatctggcggctcagctgcatgtgaccccaggctcagcccaa
A0A8I5U2F2_BCL2L2-      ccttctctgatctggcggctcagctgcatgtgaccccaggctcagcccaa
A0A2K6RW35_BCL2L2-      ccttctctgatctggcggctcagctgcatgtgaccccaggctcagcgcag
A0A2K6RW35_BCL2L2-      ccttctctgatctggcggctcagctgcatgtgaccccaggctcagcgcag
A0A2K6ME72_BCL2L2-      ccttctctgatctggcggctcagctgcatgtgaccccaggctcagcgcag
A0A2R9A2Q3_BCL2L2-      ccttctctgatctggcggctcagctgcatgtgaccccaggctcagcccaa
A0A2K5MZX9_BCL2L2-      ccttctctgatctggcggctcagctgcatgtgaccccaggctcagcacag
A0A2K6EA59_BCL2L2-      ccttctctgatctggcggctcagctgcatgtgaccccaggctcagcacag
A0A2K6RW35_BCL2L2-      ccttctctgatctggcggctcagctgcatgtgaccccaggctcagcgcag
A0A2K6ME72_BCL2L2-      ccttctctgatctggcggctcagctgcatgtgaccccaggctcagcgcag
A0A8D2FJU1_BCL2L2-      ccttctctgatctggcggctcagctgcatgtgaccccaggctcagcacag
A0A8D2FJU1_BCL2L2-      ccttctctgatctggcggctcagctgcatgtgaccccaggctcagcacag
A0A8C9H679_BCL2L2-      ccttctctgatctggcggctcagctgcatgtaaccccaggctcagcgcag
A0A8C9H679_BCL2L2-      ccttctctgatctggcggctcagctgcatgtaaccccaggctcagcgcag
A0A2I3MUE4_BCL2L2-      ccttctctgatctggcggctcagctgcatgtgaccccaggctcagcacag
A0A2I3GEA7_BCL2L2-      ccttctctgatctggcggctcagctgcatgtgaccccaggctcagcccaa
A0A2I3GEA7_BCL2L2-      ccttctctgatctggcggctcagctgcatgtgaccccaggctcagcccaa
A0A2K6AI25_BCL2L2-      ccttctctgatctggcggctcagctgcatgtgaccccaggctcagcacag
A0A2K6AI25_BCL2L2-      ccttctctgatctggcggctcagctgcatgtgaccccaggctcagcacag
F7G4L5_BCL2L2-02        ccttctctgatctggcggctcagctgcatgtgaccccaggctcagcacag
F7G4L5_BCL2L2-01        ccttctctgatctggcggctcagctgcatgtgaccccaggctcagcacag
A0A2K5V0Q3_BCL2L2-      ccttctctgatctggcggctcagctgcatgtgaccccaggctcagcacag
A0A2K5V0Q3_BCL2L2-      ccttctctgatctggcggctcagctgcatgtgaccccaggctcagcacag
A0A2K5V0Q3_BCL2L2-      ccttctctgatctggcggctcagctgcatgtgaccccaggctcagcacag
A0A2K5V0Q3_BCL2L2-      ccttctctgatctggcggctcagctgcatgtgaccccaggctcagcacag
A0A2K5V0Q3_BCL2L2-      ccttctctgatctggcggctcagctgcatgtgaccccaggctcagcacag
A0A2K5V0Q3_BCL2L2-      ccttctctgatctggcggctcagctgcatgtgaccccaggctcagcacag
A0A2K5V0Q3_BCL2L2-      ccttctctgatctggcggctcagctgcatgtgaccccaggctcagcacag
G3V4B7_BCL2L2-08        ccttctctgatctggcggctcagctgcatgtgaccccaggctcagcccaa
G3V4B7_BCL2L2-07        ccttctctgatctggcggctcagctgcatgtgaccccaggctcagcccaa
G3V4B7_BCL2L2-06        ccttctctgatctggcggctcagctgcatgtgaccccaggctcagcccaa
G3V4B7_BCL2L2-05        ccttctctgatctggcggctcagctgcatgtgaccccaggctcagcccaa
G3V4B7_BCL2L2-04        ccttctctgatctggcggctcagctgcatgtgaccccaggctcagcccaa
G3V4B7_BCL2L2-03        ccttctctgatctggcggctcagctgcatgtgaccccaggctcagcccaa
G3V4B7_BCL2L2-02        ccttctctgatctggcggctcagctgcatgtgaccccaggctcagcccaa
A0A2I2YPX6_BCL2L2-      ccttctctgatctggcggctcagctgcatgtgaccccaggctcagcccaa
A0A2I2YPX6_BCL2L2-      ccttctctgatctggcggctcagctgcatgtgaccccaggctcagcccaa
A0A2K5HEJ9_BCL2L2-      ccttctctgatctggcggctcagctgcatgtgaccccaggctcagcgcag
A0A0D9RU30_BCL2L2-      ccttctctgatctggcggctcagctgcatgtgaccccaggctcagcgcag
G3V4B7_BCL2L2-01        --------------------------------------------------
G3V4B7_BCL2L2-09        ccttctctgatctggcggctcagctgcatgtgacccc-------------
                                                                          

H3AAS7_BCL2L2-02        cggcgatttgctgagacggcagacagcctcttccaggatggggtgaactg
H3AAS7_BCL2L2-01        cggcgatttgctgagacggcagacagcctcttccaggatggggtgaactg
Q6GP82_BCL2L2-01        gcacgatttgctgaagtagcaggtagcctgttccaaggaggggtgaattg
A0A8C5PJB3_BCL2L2-      gcgcgcttcgcagaggtggctggaggtcttttccaaggtggggtgaactg
A0A4X2LP96_BCL2L2-      cagcgctttacccaagtctcagatgagctcttccagggggggcccaactg
A0A5F8HG85_BCL2L2-      a--------gcccgagcccgag--------cccgaggaggagccgccccg
A0A5F8HG85_BCL2L2-      cagcgctttacccaggtctcagatgagctcttccaaggggggcccaactg
A0A5F8HG85_BCL2L2-      cagcgctttacccaggtctcagatgagctcttccaaggggggcccaactg
F7G6M3_BCL2L2-01        cagcgcttcacccaggtgtcggacgagctcttccagggggggcccaactg
G1Q051_BCL2L2-01        caatgtttcacccaggtctctgatgaactcttccaggggggccccaactg
G1TV33_BCL2L2-01        cagagcttcacccaggtctgcgatgaacttttccaaaggggtcccaactg
D3Z5F7_BCL2L2-01        caacgcttcacccaggtttccgacgaacttttccaagggggccctaactg
G3V4B7_BCL2L2-10        caacgcttcacccaggtctccgatgaactttttcaagggggccccaactg
A0A6I9LUT0_BCL2L2-      caacgcttcacccaggtttccgatgaacttttccaagggggccccaactg
A0A8C3X592_BCL2L2-      caacgcttcacccaggtctctgatgaactcttccaagggggccccaactg
A0A3Q9B4M8_BCL2L2-      cagcgcttcacccaggtctctgatgaactcttccaagggggccccaactg
A0A7T8CLX7_BCL2L2-      cagcgcttcacccaggtctctgatgaactcttccaagggggccccaactg
A0A8D0TJQ9_BCL2L2-      cagcgcttcacccaggtctctgatgaactcttccaagggggccccaactg
A0A4X1SF60_BCL2L2-      cagcgcttcacccaggtctctgatgaactcttccaaggaggccccaactg
A0A4X1SF63_BCL2L2-      cagcgcttcacccaggtctctgatgaactcttccaaggaggccccaactg
A0A8C0Q5E6_BCL2L2-      caacgcttcacccaggtctctgacgaactcttccaagggggccccaactg
A0A8I3MNK9_BCL2L2-      caacgcttcacccaggtctctgacgaactcttccaagggggccccaactg
A0A8I3RSU6_BCL2L2-      caacgcttcacccaggtctctgacgaactcttccaagggggccccaactg
A0A673VAY7_BCL2L2-      caacgcttcacccaggtctctgatgaactcttccaagggggccccaactg
A0A2I2UAE3_BCL2L2-      caacgcttcacccaggtctctgatgaactcttccaagggggccccaactg
A0A8C8XCR9_BCL2L2-      caacgcttcacccaggtctctgatgaactcttccaagggggccccaactg
A0A8C9J3S1_BCL2L2-      caacgcttcacccaggtctctgatgaactcttccaagggggccccaactg
M3Y5X5_BCL2L2-01        cagcgcttcacccaggtctctgacgaactcttccaagggggccccaactg
A0A8C7EW82_BCL2L2-      cagcgcttcacccaggtctctgacgaactcttccaagggggccccaactg
A0A452SHI1_BCL2L2-      caacgcttcacccaggtctctgacgaactcttccaagggggccccaactg
A0A384DPS8_BCL2L2-      caacgcttcacccaggtctctgacgaactcttccaagggggccccaactg
A0A8C4LWK5_BCL2L2-      caacgcttcacccaggtctctgacgaactcttccaagggggccccaactg
A0A8C6BK57_BCL2L2-      caacgcttcacccaggtctctgatgaactcttccaaggggggcccaactg
A0A8C9CXQ5_BCL2L2-      caacgcttcacccaggtctctgatgaactcttccaaggggggcccaactg
A0A8B8WSS7_BCL2L2-      caacgcttcacccaggtctctgatgaactcttccaagggggccccaactg
W5QDH4_BCL2L2-02        cagcgcttcacccaggtctctgatgaactcttccaagggggccccaactg
A0A8C6CUC2_BCL2L2-      caacgcttcacccaggtctctgatgaactcttccaagggggccccaactg
A0A452ECF0_BCL2L2-      cagcgcttcacccaggtctctgatgaactcttccaagggggccccaactg
A0A4W2D6A3_BCL2L2-      caacgcttcacccaggtctctgatgaactcttccaagggggccccaactg
A0A4W2D6A3_BCL2L2-      caacgcttcacccaggtctctgatgaactcttccaagggggccccaactg
A0A4W2GUJ7_BCL2L2-      caacgcttcacccaggtctctgatgaactcttccaagggggccccaactg
A0A4W2GUJ7_BCL2L2-      caacgcttcacccaggtctctgatgaactcttccaagggggccccaactg
A0A8B9WT05_BCL2L2-      caacgcttcacccaggtctctgatgaactcttccaagggggccccaactg
A0A4W2D6A3_BCL2L2-      caacgcttcacccaggtctctgatgaactcttccaagggggccccaactg
A0A4W2D6A3_BCL2L2-      caacgcttcacccaggtctctgatgaactcttccaagggggccccaactg
A0A4W2GUJ7_BCL2L2-      caacgcttcacccaggtctctgatgaactcttccaagggggccccaactg
A0A4W2GUJ7_BCL2L2-      caacgcttcacccaggtctctgatgaactcttccaagggggccccaactg
Q05KI8_BCL2L2-01        caacgcttcacccaggtctctgatgaactcttccaagggggccccaactg
A0A8C2VJ88_BCL2L2-      cagcgcttcacccaggtctccgacgaacttttccaagggggccccaactg
A0A286XQQ9_BCL2L2-      caacgcttcacccaggtctccgacgaacttttccaaggtggccccaactg
A0A8C2VJ88_BCL2L2-      cagcgcttcacccaggtctccgacgaacttttccaagggggccccaactg
A0A8D2APK0_BCL2L2-      cagcgcttcacccaggtctctgatgaacttttccaagggggtcccaactg
A0A287D9B3_BCL2L2-      caacgcttcacccaggtctctgacgaacttttccaagggggtcccaactg
A0A8D2HGM1_BCL2L2-      caacgcttcacccaggtctctgacgaacttttccaagggggtcccaactg
A0A287D9B3_BCL2L2-      caacgcttcacccaggtctctgacgaacttttccaagggggtcccaactg
A0A8C9PGU3_BCL2L2-      caacgcttcacccaggtctctgacgaacttttccaagggggtcccaactg
W5QDH4_BCL2L2-01        cagcgcttcacccaggtctctgatgaactcttccaagggggccccaactg
A0A4W2GUJ7_BCL2L2-      caacgcttcacccaggtctctgatgaactcttccaagggggccccaactg
A0A4W2GUJ7_BCL2L2-      caacgcttcacccaggtctctgatgaactcttccaagggggccccaactg
A0A4W2D6A3_BCL2L2-      caacgcttcacccaggtctctgatgaactcttccaagggggccccaactg
A0A4W2GUJ7_BCL2L2-      caacgcttcacccaggtctctgatgaactcttccaagggggccccaactg
A0A4W2D6A3_BCL2L2-      caacgcttcacccaggtctctgatgaactcttccaagggggccccaactg
A0A4W2GUJ7_BCL2L2-      caacgcttcacccaggtctctgatgaactcttccaagggggccccaactg
A0A4W2GUJ7_BCL2L2-      caacgcttcacccaggtctctgatgaactcttccaagggggccccaactg
A0A4W2GUJ7_BCL2L2-      caacgcttcacccaggtctctgatgaactcttccaagggggccccaactg
A0A5F5PML6_BCL2L2-      caacgcttcacccaggtctctgacgaactcttccaaggtggccccaactg
A0A5F5PML6_BCL2L2-      caacgcttcacccaggtctctgacgaactcttccaaggtggccccaactg
A0A8C5L5C6_BCL2L2-      caacgcttcacccaggtctccgatgaactttttcaagggggccccaactg
A0A8C0Q5E6_BCL2L2-      caacgcttcacccaggtctctgacgaactcttccaagggggccccaactg
A0A8I3MNK9_BCL2L2-      caacgcttcacccaggtctctgacgaactcttccaagggggccccaactg
A0A8I3RSU6_BCL2L2-      caacgcttcacccaggtctctgacgaactcttccaagggggccccaactg
A0A8I3MNK9_BCL2L2-      caacgcttcacccaggtctctgacgaactcttccaagggggccccaactg
A0A667I624_BCL2L2-      caacgcttcacccaggtctctgatgaactcttccaagggggccccaactg
G1LKF5_BCL2L2-01        caacgcttcacccaggtctctgatgaactcttccaagggggccccaactg
G1LKF5_BCL2L2-02        caacgcttcacccaggtctctgatgaactcttccaagggggccccaactg
A0A384DPS8_BCL2L2-      caacgcttcacccaggtctctgacgaactcttccaagggggccccaactg
A0A384DPS8_BCL2L2-      caacgcttcacccaggtctctgacgaactcttccaagggggccccaactg
A0A8C6RJE0_BCL2L2-      caacgcttcacccaggtgtccgacgaacttttccaagggggccccaactg
A0A671DWB3_BCL2L2-      agcctccccggccccgcgccc-----------ccccgggagctccg----
A0A250YBR2_BCL2L2-      caacgcttcacccaggtctctgatgaacttttccaagggggccccaactg
A0A250YBR2_BCL2L2-      caacgcttcacccaggtctctgatgaacttttccaagggggccccaactg
O88996_BCL2L2-01        caacgcttcacccaggtttccgacgaacttttccaagggggccccaactg
Q7TS60_BCL2L2-01        caacgcttcacccaggtttccgacgaacttttccaagggggccccaactg
A0A671DWB3_BCL2L2-      cagcgcttcacccaggtctctgatgaactcttccaagggggtcccaactg
A0A8C6RJE0_BCL2L2-      caacgcttcacccaggtgtccgacgaacttttccaagggggccccaactg
A0A4W2D6A3_BCL2L2-      agccgccccggccccgcgccc-----------ccccgggagctccg----
A0A4W2GUJ7_BCL2L2-      agccgccccggccccgcgccc-----------ccccgggagctccg----
A0A4W2D6A3_BCL2L2-      agccgccccggccccgcgccc-----------ccccgggagctccg----
A0A4W2GUJ7_BCL2L2-      agccgccccggccccgcgccc-----------ccccgggagctccg----
A0A8C8YZD8_BCL2L2-      cagcgcttcacccaggtctccgatgaacttttccaagggggccccaactg
A0A8B7FJ73_BCL2L2-      cagcgcttcacccaggtctccgatgaacttttccaagggggccccaactg
A0A2K6GWM6_BCL2L2-      cagcgcttcacccaggtctccgatgaacttttccaagggggccccaactg
A0A8D0TJQ9_BCL2L2-      cagcgcttcacccaggtctctgatgaactcttccaagggggccccaactg
A0A482LX62_BCL2L2-      cagcgcttcacccaggtctctgatgaactcttccaagggggccccaactg
A0A4X1SF63_BCL2L2-      cagcgcttcacccaggtctctgatgaactcttccaaggaggccccaactg
A0A4D6NWN1_BCL2L2-      cagcgcttcacccaggtctctgatgaactcttccaagggggccccaactg
A0A4X1SF60_BCL2L2-      cagcgcttcacccaggtctctgatgaactcttccaaggaggccccaactg
A0A4X1SF63_BCL2L2-      cagcgcttcacccaggtctctgatgaactcttccaaggaggccccaactg
A0A8D0TJQ9_BCL2L2-      cagcgcttcacccaggtctctgatgaactcttccaagggggccccaactg
A0A4X1SF60_BCL2L2-      cagcgcttcacccaggtctctgatgaactcttccaaggaggccccaactg
A0A8D0TJQ9_BCL2L2-      cagcgcttcacccaggtctctgatgaactcttccaagggggccccaactg
H0XR82_BCL2L2-01        caacgcttcacccaggtctctgatgaacttttccaagggggccccaactg
A0A4X1SF63_BCL2L2-      agccgccccggccccgcgccc-----------ccccaggagctccg----
A0A4X1SF63_BCL2L2-      agccgccccggccccgcgccc-----------ccccaggagctccg----
A0A8D0TJQ9_BCL2L2-      agccgccccggccccgcgccc-----------ccccaggagctccg----
A0A8B7FJ73_BCL2L2-      cagcgcttcacccaggtctccgatgaacttttccaagggggccccaactg
A0A2K6GWM6_BCL2L2-      cagcgcttcacccaggtctccgatgaacttttccaagggggccccaactg
A0A5F5PML6_BCL2L2-      agccgccccggccccgcgccc-----------ccccgggagctccg----
A0A8C8YZD8_BCL2L2-      agccgccccggccccgcgccc-----------ccccgggagctccg----
A0A8B7FJ73_BCL2L2-      agccgccccggccccgcgccc-----------ccccgggagctccg----
A0A8B7FJ73_BCL2L2-      --------------------------------------------------
A0A2K6GWM6_BCL2L2-      agccgccccggccccgcgccc-----------ccccgggagctccg----
A0A2K6GWM6_BCL2L2-      --------------------------------------------------
A0A8C0Q5E6_BCL2L2-      agccgccccggccccgcgccc-----------ccccgggagctccg----
A0A8I3MNK9_BCL2L2-      agccgccccggccccgcgccc-----------ccccgggagctccg----
A0A8I3RSU6_BCL2L2-      agccgccccggccccgcgccc-----------ccccgggagctccg----
A0A667I624_BCL2L2-      agccgccccggccccgcgccc-----------ccccgggagctccg----
G1P3J2_BCL2L2-01        caacgcttcacccaggtctctgatgaactcttccaagggggccccaactg
G3TMU7_BCL2L2-01        caacgcttcacccaggtctctgatgaactcttccaagggggccccaactg
A0A2K6TM77_BCL2L2-      caacgcttcacccaggtctccgatgaacttttccaagggggtcccaactg
A0A2K6TM77_BCL2L2-      caacgcttcacccaggtctccgatgaacttttccaagggggtcccaactg
A0A2K5CWY6_BCL2L2-      caacgcttcacccaggtctccgatgaacttttccaagggggccctaactg
A0A2K5CWY6_BCL2L2-      caacgcttcacccaggtctccgatgaacttttccaagggggccctaactg
A0A2K5CWY6_BCL2L2-      --------------------------------------------------
U3CRF8_BCL2L2-02        agccgccccggccccgcgccc-----------ccccgggagctccg----
U3CRF8_BCL2L2-03        agccgccccggccccgcgccc-----------ccccgggagctccg----
A0A2I3GEA7_BCL2L2-      agccgccccggccccgcgccc-----------ccccgggagctccg----
A0A8I5U2F2_BCL2L2-      agccgccccggccccgcgccc-----------ccccgggagctccg----
A0A2I2YPX6_BCL2L2-      agccgccccggccccgcgccc-----------ccccgggagctccg----
A0A2I2YPX6_BCL2L2-      --------------------------------------------------
U3CRF8_BCL2L2-01        caacgcttcacccaggtctccgatgaacttttccaagggggtcccaactg
A0A2K6TM77_BCL2L2-      --------------------------------------------------
A0A2K6TM77_BCL2L2-      caacgcttcacccaggtctccgatgaacttttccaagggggtcccaactg
A0A2K5V0Q3_BCL2L2-      --------------------------------------------------
A0A2K6EA59_BCL2L2-      --------------------------------------------------
A0A2K6EA59_BCL2L2-      caacgcttcacccaggtctccgatgaacttttccaagggggccccaactg
A0A2K5MZX9_BCL2L2-      --------------------------------------------------
A0A2K5MZX9_BCL2L2-      caacgcttcacccaggtctccgatgaacttttccaagggggccccaactg
A0A2K5MZX9_BCL2L2-      agccgccccggccccgcgccc-----------ccccgggagctccg----
A0A2K5V0Q3_BCL2L2-      --------------------------------------------------
F7G4L5_BCL2L2-03        agccgccccggccccgcgccc-----------ccccgggagctccg----
A0A2K6EA59_BCL2L2-      agccgccccggccccgcgccc-----------ccccgggagctccg----
A0A2K6AI25_BCL2L2-      --------------------------------------------------
A0A8D2FJU1_BCL2L2-      agccgccccggccccgcgccc-----------ccccgggagctccg----
A0A2R9A2Q3_BCL2L2-      caacgcttcacccaggtctccgatgaactttttcaagggggccccaactg
A0A2R9A2Q3_BCL2L2-      --------------------------------------------------
A0A2K6RW35_BCL2L2-      --------------------------------------------------
A0A2K5HEJ9_BCL2L2-      --------------------------------------------------
A0A2K5HEJ9_BCL2L2-      caacgcttcacccaggtctctgatgaacttttccaagggggccccaactg
A0A8I5U2F2_BCL2L2-      caacgcttcacccaggtctccgatgaactttttcaagggggccccaactg
A0A2K5CWY6_BCL2L2-      caacgcttcacccaggtctccgatgaacttttccaagggggccctaactg
A0A8I5U2F2_BCL2L2-      caacgcttcacccaggtctccgatgaactttttcaagggggccccaactg
A0A2K6RW35_BCL2L2-      caacgcttcacccaggtctctgatgaacttttccaagggggccccaactg
A0A2K6RW35_BCL2L2-      caacgcttcacccaggtctctgatgaacttttccaagggggccccaactg
A0A2K6ME72_BCL2L2-      caacgcttcacccaggtctctgatgaacttttccaagggggccccaactg
A0A2R9A2Q3_BCL2L2-      caacgcttcacccaggtctccgatgaactttttcaagggggccccaactg
A0A2K5MZX9_BCL2L2-      caacgcttcacccaggtctccgatgaacttttccaagggggccccaactg
A0A2K6EA59_BCL2L2-      caacgcttcacccaggtctccgatgaacttttccaagggggccccaactg
A0A2K6RW35_BCL2L2-      caacgcttcacccaggtctctgatgaacttttccaagggggccccaactg
A0A2K6ME72_BCL2L2-      caacgcttcacccaggtctctgatgaacttttccaagggggccccaactg
A0A8D2FJU1_BCL2L2-      caacgcttcacccaggtctccgatgaacttttccaagggggccccaactg
A0A8D2FJU1_BCL2L2-      caacgcttcacccaggtctccgatgaacttttccaagggggccccaactg
A0A8C9H679_BCL2L2-      caacgcttcacccaggtctctgatgaacttttccaagggggccccaactg
A0A8C9H679_BCL2L2-      caacgcttcacccaggtctctgatgaacttttccaagggggccccaactg
A0A2I3MUE4_BCL2L2-      caacgcttcacccaggtctccgatgaacttttccaagggggccccaactg
A0A2I3GEA7_BCL2L2-      caacgcttcacccaggtctccgatgaactttttcaagggggccccaactg
A0A2I3GEA7_BCL2L2-      caacgcttcacccaggtctccgatgaactttttcaagggggccccaactg
A0A2K6AI25_BCL2L2-      caacgcttcacccaggtctccgatgaacttttccaagggggccccaactg
A0A2K6AI25_BCL2L2-      caacgcttcacccaggtctccgatgaacttttccaagggggccccaactg
F7G4L5_BCL2L2-02        caacgcttcacccaggtctccgatgaacttttccaagggggccccaactg
F7G4L5_BCL2L2-01        caacgcttcacccaggtctccgatgaacttttccaagggggccccaactg
A0A2K5V0Q3_BCL2L2-      caacgcttcacccaggtctccgatgaacttttccaagggggccccaactg
A0A2K5V0Q3_BCL2L2-      caacgcttcacccaggtctccgatgaacttttccaagggggccccaactg
A0A2K5V0Q3_BCL2L2-      caacgcttcacccaggtctccgatgaacttttccaagggggccccaactg
A0A2K5V0Q3_BCL2L2-      caacgcttcacccaggtctccgatgaacttttccaagggggccccaactg
A0A2K5V0Q3_BCL2L2-      caacgcttcacccaggtctccgatgaacttttccaagggggccccaactg
A0A2K5V0Q3_BCL2L2-      caacgcttcacccaggtctccgatgaacttttccaagggggccccaactg
A0A2K5V0Q3_BCL2L2-      caacgcttcacccaggtctccgatgaacttttccaagggggccccaactg
G3V4B7_BCL2L2-08        caacgcttcacccaggtctccgatgaactttttcaagggggccccaactg
G3V4B7_BCL2L2-07        caacgcttcacccaggtctccgatgaactttttcaagggggccccaactg
G3V4B7_BCL2L2-06        caacgcttcacccaggtctccgatgaactttttcaagggggccccaactg
G3V4B7_BCL2L2-05        caacgcttcacccaggtctccgatgaactttttcaagggggccccaactg
G3V4B7_BCL2L2-04        caacgcttcacccaggtctccgatgaactttttcaagggggccccaactg
G3V4B7_BCL2L2-03        caacgcttcacccaggtctccgatgaactttttcaagggggccccaactg
G3V4B7_BCL2L2-02        caacgcttcacccaggtctccgatgaactttttcaagggggccccaactg
A0A2I2YPX6_BCL2L2-      caacgcttcacccaggtctccgatgaactttttcaagggggccccaactg
A0A2I2YPX6_BCL2L2-      caacgcttcacccaggtctccgatgaactttttcaagggggccccaactg
A0A2K5HEJ9_BCL2L2-      caacgcttcacccaggtctctgatgaacttttccaagggggccccaactg
A0A0D9RU30_BCL2L2-      caacgcttcacccaggtctccgatgaacttttccaagggggccccaactg
G3V4B7_BCL2L2-01        --------------------------------------------------
G3V4B7_BCL2L2-09        --------------------------------------------------
                                                                          

H3AAS7_BCL2L2-02        gggccgg---gtggtggcgctgttcgtcttcagcgcagcactctgtgtgg
H3AAS7_BCL2L2-01        gggccgg---gtggtggcgctgttcgtcttcagcgcagcactctgtgtgg
Q6GP82_BCL2L2-01        ggggcgt---atagttgcattttttgtttttggtgccgcactgtgtgctg
A0A8C5PJB3_BCL2L2-      gggccgc---gtggtggcattctttgtgtttggagctgctctctgtgcgg
A0A4X2LP96_BCL2L2-      gggccgt---cttgtggcattcttcgtctttggggcagcgctgtgtgcag
A0A5F8HG85_BCL2L2-      gccccgtgcccccccgggagcctccggccctgg------gcccggcgcag
A0A5F8HG85_BCL2L2-      gggccgt---cttgtggcattcttcgtctttggggcagcgctctgtgcag
A0A5F8HG85_BCL2L2-      gggccgt---cttgtggcattcttcgtctttggggcagcgctctgtgcag
F7G6M3_BCL2L2-01        gggccgg---ctggtggccttcttcgtgttcggggccgcgctctgcgccg
G1Q051_BCL2L2-01        gggttac---cttgtggccttctttgtctttggagctgctctgtgtgttg
G1TV33_BCL2L2-01        gggccgc---gtggtggccttctttgcctttggggccgcactgtgtgctg
D3Z5F7_BCL2L2-01        gggccgt---cttgtggcattctttgtctttggggctgccctgtgtgctg
G3V4B7_BCL2L2-10        gggccgc---cttgtagccttctttgtctttggggctgcactgtgtgctg
A0A6I9LUT0_BCL2L2-      gggccgt---cttgtggcattctttgtctttggggctgccttgtgtgctg
A0A8C3X592_BCL2L2-      gggccgc---cttgtggccttctttgtcttcggagctgcgctgtgtgctg
A0A3Q9B4M8_BCL2L2-      gggccgc---cttgtggccttctttgtcttcggagctgcactgtgtgctg
A0A7T8CLX7_BCL2L2-      gggccgc---cttgtggccttctttgtcttcggagctgcactgtgtgctg
A0A8D0TJQ9_BCL2L2-      gggccgc---cttgtggccttctttgtcttcggagctgcactgtgtgctg
A0A4X1SF60_BCL2L2-      gggccgc---cttgtggccttctttgtcttcggagctgcactgtgtgctg
A0A4X1SF63_BCL2L2-      gggccgc---cttgtggccttctttgtcttcggagctgcactgtgtgctg
A0A8C0Q5E6_BCL2L2-      gggccgt---cttgtggccttctttgtctttggagctgcactgtgtgctg
A0A8I3MNK9_BCL2L2-      gggccgt---cttgtggccttctttgtctttggagctgcactgtgtgctg
A0A8I3RSU6_BCL2L2-      gggccgt---cttgtggccttctttgtctttggagctgcactgtgtgctg
A0A673VAY7_BCL2L2-      gggccgc---cttgtggccttctttgtctttggagccgcgctatgtgctg
A0A2I2UAE3_BCL2L2-      gggccgc---cttgtggccttctttgtctttggagccgcactgtgtgctg
A0A8C8XCR9_BCL2L2-      gggccgc---cttgtggccttctttgtctttggagccgcactgtgtgctg
A0A8C9J3S1_BCL2L2-      gggccgc---cttgtggccttctttgtctttggagccgcactgtgtgctg
M3Y5X5_BCL2L2-01        gggccgc---cttgtggccttctttgtctttggagccgcactgtgtgctg
A0A8C7EW82_BCL2L2-      gggccgc---cttgtggccttctttgtctttggagccgcactgtgtgctg
A0A452SHI1_BCL2L2-      gggccgc---ctggtggccttctttgtctttggagccgcactgtgtgctg
A0A384DPS8_BCL2L2-      gggccgc---ctggtggccttctttgtctttggagccgcactgtgtgctg
A0A8C4LWK5_BCL2L2-      gggccgc---cttgtggccttctttgtctttggagccgcgctgtgtgctg
A0A8C6BK57_BCL2L2-      gggccgc---cttgtggctttctttgtctttggagccgcgctgtgtgctg
A0A8C9CXQ5_BCL2L2-      gggccgc---cttgtggctttctttgtctttggagccgcgctgtgtgctg
A0A8B8WSS7_BCL2L2-      gggccgc---cttgtggctttctttgtctttggagccgcgctgtgtgctg
W5QDH4_BCL2L2-02        gggtcgc---cttgtggccttctttgtctttggagccgcattgtgtgctg
A0A8C6CUC2_BCL2L2-      gggccgc---cttgtggccttctttgtctttggagccgcgttgtgtgctg
A0A452ECF0_BCL2L2-      gggtcgc---cttgtggccttctttgtctttggagccgcactgtgtgctg
A0A4W2D6A3_BCL2L2-      gggccgc---cttgtggccttctttgtctttggagccgcgttgtgtgctg
A0A4W2D6A3_BCL2L2-      gggccgc---cttgtggccttctttgtctttggagccgcgttgtgtgctg
A0A4W2GUJ7_BCL2L2-      gggccgc---cttgtggccttctttgtctttggagccgcgttgtgtgctg
A0A4W2GUJ7_BCL2L2-      gggccgc---cttgtggccttctttgtctttggagccgcgttgtgtgctg
A0A8B9WT05_BCL2L2-      gggccgc---cttgtggccttctttgtctttggagccgcgttgtgtgctg
A0A4W2D6A3_BCL2L2-      gggccgc---cttgtggccttctttgtctttggagccgcgttgtgtgctg
A0A4W2D6A3_BCL2L2-      gggccgc---cttgtggccttctttgtctttggagccgcgttgtgtgctg
A0A4W2GUJ7_BCL2L2-      gggccgc---cttgtggccttctttgtctttggagccgcgttgtgtgctg
A0A4W2GUJ7_BCL2L2-      gggccgc---cttgtggccttctttgtctttggagccgcgttgtgtgctg
Q05KI8_BCL2L2-01        gggccgc---cttgtggccttctttgtctttggagccgcgttgtgtgctg
A0A8C2VJ88_BCL2L2-      gggccgt---cttgtggccttctttgtctttggggctgccctgtgtgctg
A0A286XQQ9_BCL2L2-      gggccgt---cttgtggccttctttgtctttggcgctgccctgtgtgctg
A0A8C2VJ88_BCL2L2-      gggccgt---cttgtggccttctttgtctttggggctgccctgtgtgctg
A0A8D2APK0_BCL2L2-      gggccgt---cttgtggccttctttgtctttggggctgccctgtgtgctg
A0A287D9B3_BCL2L2-      gggtcgt---cttgtggccttctttgtctttggggctgccctgtgtgctg
A0A8D2HGM1_BCL2L2-      gggtcgt---cttgtggccttctttgtctttggggctgccctgtgtgctg
A0A287D9B3_BCL2L2-      gggtcgt---cttgtggccttctttgtctttggggctgccctgtgtgctg
A0A8C9PGU3_BCL2L2-      gggtcgt---cttgtggccttctttgtctttggggctgccctgtgtgctg
W5QDH4_BCL2L2-01        gggtcgc---cttgtggccttctttgtctttggagccgcattgtgtgctg
A0A4W2GUJ7_BCL2L2-      gggccgc---cttgtggccttctttgtctttggagccgcgttgtgtgctg
A0A4W2GUJ7_BCL2L2-      gggccgc---cttgtggccttctttgtctttggagccgcgttgtgtgctg
A0A4W2D6A3_BCL2L2-      gggccgc---cttgtggccttctttgtctttggagccgcgttgtgtgctg
A0A4W2GUJ7_BCL2L2-      gggccgc---cttgtggccttctttgtctttggagccgcgttgtgtgctg
A0A4W2D6A3_BCL2L2-      gggccgc---cttgtggccttctttgtctttggagccgcgttgtgtgctg
A0A4W2GUJ7_BCL2L2-      gggccgc---cttgtggccttctttgtctttggagccgcgttgtgtgctg
A0A4W2GUJ7_BCL2L2-      gggccgc---cttgtggccttctttgtctttggagccgcgttgtgtgctg
A0A4W2GUJ7_BCL2L2-      gggccgc---cttgtggccttctttgtctttggagccgcgttgtgtgctg
A0A5F5PML6_BCL2L2-      gggccgc---cttgtggccttctttgtctttggagccgcgctgtgtgctg
A0A5F5PML6_BCL2L2-      gggccgc---cttgtggccttctttgtctttggagccgcgctgtgtgctg
A0A8C5L5C6_BCL2L2-      gggccgc---ctggtagccttctttgtctttggggctgctctgtgtgctg
A0A8C0Q5E6_BCL2L2-      gggccgt---cttgtggccttctttgtctttggagctgcactgtgtgctg
A0A8I3MNK9_BCL2L2-      gggccgt---cttgtggccttctttgtctttggagctgcactgtgtgctg
A0A8I3RSU6_BCL2L2-      gggccgt---cttgtggccttctttgtctttggagctgcactgtgtgctg
A0A8I3MNK9_BCL2L2-      gggccgt---cttgtggccttctttgtctttggagctgcactgtgtgctg
A0A667I624_BCL2L2-      gggccgc---cttgtggccttctttgtctttggagccgcactgtgtgctg
G1LKF5_BCL2L2-01        gggccgc---ctggtggccttctttgtctttggagccgcactgtgtgctg
G1LKF5_BCL2L2-02        gggccgc---ctggtggccttctttgtctttggagccgcactgtgtgctg
A0A384DPS8_BCL2L2-      gggccgc---ctggtggccttctttgtctttggagccgcactgtgtgctg
A0A384DPS8_BCL2L2-      gggccgc---ctggtggccttctttgtctttggagccgcactgtgtgctg
A0A8C6RJE0_BCL2L2-      gggtcgt---cttgtggcattctttgtctttggggctgccttgtgtgctg
A0A671DWB3_BCL2L2-      -------------------------ggccctgggcctggctcgggagccc
A0A250YBR2_BCL2L2-      gggccgt---cttgtggccttctttgtctttggggctgccctgtgtgctg
A0A250YBR2_BCL2L2-      gggccgt---cttgtggccttctttgtctttggggctgccctgtgtgctg
O88996_BCL2L2-01        gggccgt---cttgtggcattctttgtctttggggctgccctgtgtgctg
Q7TS60_BCL2L2-01        gggccgt---cttgtggcattctttgtctttggggctgccctgtgtgctg
A0A671DWB3_BCL2L2-      gggccgc---cttgtggccttctttgtctttggagctgcactgtgtgctg
A0A8C6RJE0_BCL2L2-      gggtcgt---cttgtggcattctttgtctttggggctgccttgtgtgctg
A0A4W2D6A3_BCL2L2-      -------------------------ggccctgggcctggctcgggagccc
A0A4W2GUJ7_BCL2L2-      -------------------------ggccctgggcctggctcgggagccc
A0A4W2D6A3_BCL2L2-      -------------------------ggccctgggcctggctcgggagccc
A0A4W2GUJ7_BCL2L2-      -------------------------ggccctgggcctggctcgggagccc
A0A8C8YZD8_BCL2L2-      gggccgc---cttgtggccttcttcgtctttggggccgcactgtgtgctg
A0A8B7FJ73_BCL2L2-      gggccgc---cttgtggccttcttcgtctttggggctgcactgtgtgctg
A0A2K6GWM6_BCL2L2-      gggccgc---cttgtggccttcttcgtctttggggctgcactgtgtgctg
A0A8D0TJQ9_BCL2L2-      gggccgc---cttgtggccttctttgtcttcggagctgcactgtgtgctg
A0A482LX62_BCL2L2-      gggccgc---cttgtggccttctttgtcttcggagctgcactgtgtgctg
A0A4X1SF63_BCL2L2-      gggccgc---cttgtggccttctttgtcttcggagctgcactgtgtgctg
A0A4D6NWN1_BCL2L2-      gggccgc---cttgtggccttctttgtcttcggagctgcactgtgtgctg
A0A4X1SF60_BCL2L2-      gggccgc---cttgtggccttctttgtcttcggagctgcactgtgtgctg
A0A4X1SF63_BCL2L2-      gggccgc---cttgtggccttctttgtcttcggagctgcactgtgtgctg
A0A8D0TJQ9_BCL2L2-      gggccgc---cttgtggccttctttgtcttcggagctgcactgtgtgctg
A0A4X1SF60_BCL2L2-      gggccgc---cttgtggccttctttgtcttcggagctgcactgtgtgctg
A0A8D0TJQ9_BCL2L2-      gggccgc---cttgtggccttctttgtcttcggagctgcactgtgtgctg
H0XR82_BCL2L2-01        gggccgc---cttgtggccttcttcgtctttggggccgcactgtgtgctg
A0A4X1SF63_BCL2L2-      -------------------------ggccctgggcctggctcgggagccc
A0A4X1SF63_BCL2L2-      -------------------------ggccctgggcctggctcgggagccc
A0A8D0TJQ9_BCL2L2-      -------------------------ggccctgggcctggctcgggagccc
A0A8B7FJ73_BCL2L2-      gggccgc---cttgtggccttcttcgtctttggggctgcactgtgtgctg
A0A2K6GWM6_BCL2L2-      gggccgc---cttgtggccttcttcgtctttggggctgcactgtgtgctg
A0A5F5PML6_BCL2L2-      -------------------------ggccctgggcctggctcgggagccc
A0A8C8YZD8_BCL2L2-      -------------------------ggccctgggcctggctcgggagccc
A0A8B7FJ73_BCL2L2-      -------------------------ggccctgggcctggctcgggagccc
A0A8B7FJ73_BCL2L2-      --------------------------------------------------
A0A2K6GWM6_BCL2L2-      -------------------------ggccctggtcctggctcgggagccc
A0A2K6GWM6_BCL2L2-      --------------------------------------------------
A0A8C0Q5E6_BCL2L2-      -------------------------ggccctgggcctggctcgggagccc
A0A8I3MNK9_BCL2L2-      -------------------------ggccctgggcctggctcgggagccc
A0A8I3RSU6_BCL2L2-      -------------------------ggccctgggcctggctcgggagccc
A0A667I624_BCL2L2-      -------------------------ggccctgggcctggctcgggagccc
G1P3J2_BCL2L2-01        gggtcgc---cttgtggccttctttgtctttggagctgctctgtgtgctg
G3TMU7_BCL2L2-01        gggccgc---cttgtggccttctttgtctttggggctgctctgtgtgctg
A0A2K6TM77_BCL2L2-      gggccgc---cttgtagccttctttgtctttggggctgcactgtgtgctg
A0A2K6TM77_BCL2L2-      gggccgc---cttgtagccttctttgtctttggggctgcactgtgtgctg
A0A2K5CWY6_BCL2L2-      gggccgc---cttgtagccttctttgtctttggggctgcactgtgtgctg
A0A2K5CWY6_BCL2L2-      gggccgc---cttgtagccttctttgtctttggggctgcactgtgtgctg
A0A2K5CWY6_BCL2L2-      --------------------------------------------------
U3CRF8_BCL2L2-02        -------------------------ggccctgggcctggttcgggagccc
U3CRF8_BCL2L2-03        -------------------------ggccctgggcctggttcgggagccc
A0A2I3GEA7_BCL2L2-      -------------------------ggccctgggcctggttcgggagccc
A0A8I5U2F2_BCL2L2-      -------------------------ggccctgggcctggttcgggagccc
A0A2I2YPX6_BCL2L2-      -------------------------ggccctgggcctggttcgggagccc
A0A2I2YPX6_BCL2L2-      --------------------------------------------------
U3CRF8_BCL2L2-01        gggccgc---cttgtagccttctttgtctttggggctgcactgtgtgctg
A0A2K6TM77_BCL2L2-      --------------------------------------------------
A0A2K6TM77_BCL2L2-      gggccgc---cttgtagccttctttgtctttggggctgcactgtgtgctg
A0A2K5V0Q3_BCL2L2-      --------------------------------------------------
A0A2K6EA59_BCL2L2-      --------------------------------------------------
A0A2K6EA59_BCL2L2-      gggccgc---cttgtagccttctttgtctttggggctgcactgtgtgctg
A0A2K5MZX9_BCL2L2-      --------------------------------------------------
A0A2K5MZX9_BCL2L2-      gggccgc---cttgtagccttctttgtctttggggctgcactgtgtgctg
A0A2K5MZX9_BCL2L2-      -------------------------ggccctgggcctggttcgggagccc
A0A2K5V0Q3_BCL2L2-      --------------------------------------------------
F7G4L5_BCL2L2-03        -------------------------ggccctgggcctggttcgggagccc
A0A2K6EA59_BCL2L2-      -------------------------ggccctgggcctggttcgggagccc
A0A2K6AI25_BCL2L2-      --------------------------------------------------
A0A8D2FJU1_BCL2L2-      -------------------------ggccctgggcctggttcgggagccc
A0A2R9A2Q3_BCL2L2-      gggccgc---cttgtagccttctttgtctttggggctgcactgtgtgctg
A0A2R9A2Q3_BCL2L2-      --------------------------------------------------
A0A2K6RW35_BCL2L2-      --------------------------------------------------
A0A2K5HEJ9_BCL2L2-      --------------------------------------------------
A0A2K5HEJ9_BCL2L2-      gggccgc---cttgtagccttctttgtctttggggctgcactgtgtgctg
A0A8I5U2F2_BCL2L2-      gggccgc---cttgtagccttctttgtctttggggctgcactgtgtgctg
A0A2K5CWY6_BCL2L2-      gggccgc---cttgtagccttctttgtctttggggctgcactgtgtgctg
A0A8I5U2F2_BCL2L2-      gggccgc---cttgtagccttctttgtctttggggctgcactgtgtgctg
A0A2K6RW35_BCL2L2-      gggccgc---cttgtagccttctttgtctttggggctgcactgtgtgctg
A0A2K6RW35_BCL2L2-      gggccgc---cttgtagccttctttgtctttggggctgcactgtgtgctg
A0A2K6ME72_BCL2L2-      gggccgc---cttgtagccttctttgtctttggggctgcactgtgtgctg
A0A2R9A2Q3_BCL2L2-      gggccgc---cttgtagccttctttgtctttggggctgcactgtgtgctg
A0A2K5MZX9_BCL2L2-      gggccgc---cttgtagccttctttgtctttggggctgcactgtgtgctg
A0A2K6EA59_BCL2L2-      gggccgc---cttgtagccttctttgtctttggggctgcactgtgtgctg
A0A2K6RW35_BCL2L2-      gggccgc---cttgtagccttctttgtctttggggctgcactgtgtgctg
A0A2K6ME72_BCL2L2-      gggccgc---cttgtagccttctttgtctttggggctgcactgtgtgctg
A0A8D2FJU1_BCL2L2-      gggccgc---cttgtagccttctttgtctttggggctgcactgtgtgctg
A0A8D2FJU1_BCL2L2-      gggccgc---cttgtagccttctttgtctttggggctgcactgtgtgctg
A0A8C9H679_BCL2L2-      gggccgc---cttgtagccttctttgtctttggggctgcactgtgtgctg
A0A8C9H679_BCL2L2-      gggccgc---cttgtagccttctttgtctttggggctgcactgtgtgctg
A0A2I3MUE4_BCL2L2-      gggccgc---cttgtagccttctttgtctttggggctgcactgtgtgctg
A0A2I3GEA7_BCL2L2-      gggccgc---cttgtagccttctttgtctttggggctgcactgtgtgctg
A0A2I3GEA7_BCL2L2-      gggccgc---cttgtagccttctttgtctttggggctgcactgtgtgctg
A0A2K6AI25_BCL2L2-      gggccgc---cttgtagccttctttgtctttggggctgcactgtgtgctg
A0A2K6AI25_BCL2L2-      gggccgc---cttgtagccttctttgtctttggggctgcactgtgtgctg
F7G4L5_BCL2L2-02        gggccgc---cttgtagccttctttgtctttggggctgcactgtgtgctg
F7G4L5_BCL2L2-01        gggccgc---cttgtagccttctttgtctttggggctgcactgtgtgctg
A0A2K5V0Q3_BCL2L2-      gggccgc---cttgtagccttctttgtctttggggctgcactgtgtgctg
A0A2K5V0Q3_BCL2L2-      gggccgc---cttgtagccttctttgtctttggggctgcactgtgtgctg
A0A2K5V0Q3_BCL2L2-      gggccgc---cttgtagccttctttgtctttggggctgcactgtgtgctg
A0A2K5V0Q3_BCL2L2-      gggccgc---cttgtagccttctttgtctttggggctgcactgtgtgctg
A0A2K5V0Q3_BCL2L2-      gggccgc---cttgtagccttctttgtctttggggctgcactgtgtgctg
A0A2K5V0Q3_BCL2L2-      gggccgc---cttgtagccttctttgtctttggggctgcactgtgtgctg
A0A2K5V0Q3_BCL2L2-      gggccgc---cttgtagccttctttgtctttggggctgcactgtgtgctg
G3V4B7_BCL2L2-08        gggccgc---cttgtagccttctttgtctttggggctgcactgtgtgctg
G3V4B7_BCL2L2-07        gggccgc---cttgtagccttctttgtctttggggctgcactgtgtgctg
G3V4B7_BCL2L2-06        gggccgc---cttgtagccttctttgtctttggggctgcactgtgtgctg
G3V4B7_BCL2L2-05        gggccgc---cttgtagccttctttgtctttggggctgcactgtgtgctg
G3V4B7_BCL2L2-04        gggccgc---cttgtagccttctttgtctttggggctgcactgtgtgctg
G3V4B7_BCL2L2-03        gggccgc---cttgtagccttctttgtctttggggctgcactgtgtgctg
G3V4B7_BCL2L2-02        gggccgc---cttgtagccttctttgtctttggggctgcactgtgtgctg
A0A2I2YPX6_BCL2L2-      gggccgc---cttgtagccttctttgtctttggggctgcactgtgtgctg
A0A2I2YPX6_BCL2L2-      gggccgc---cttgtagccttctttgtctttggggctgcactgtgtgctg
A0A2K5HEJ9_BCL2L2-      gggccgc---cttgtagccttctttgtctttggggctgcactgtgtgctg
A0A0D9RU30_BCL2L2-      gggccgc---cttgtagccttctttgtctttggggctgcactgtgtgctg
G3V4B7_BCL2L2-01        --------------------------------------------------
G3V4B7_BCL2L2-09        --------------------------------------------------
                                                                          

H3AAS7_BCL2L2-02        agagcgtggataaggaaatggcttcgctggtgggacggattattgactgg
H3AAS7_BCL2L2-01        agagcgtggataaggaaatggcttcgctggtgggacggattattgactgg
Q6GP82_BCL2L2-01        agagtgtcaacaaggagatgtcccctcttctgccacggattcaagactgg
A0A8C5PJB3_BCL2L2-      aaagtgttaacaaggagatggctcgacttctaccgcagattcaggagtgg
A0A4X2LP96_BCL2L2-      agagcgtcaacaaagagatggaaccactggtgggacaggtgcaggactgg
A0A5F8HG85_BCL2L2-      gagcccccggcagtcaggaggag--------gaggaagagccgggcctgg
A0A5F8HG85_BCL2L2-      agagtgtcaacaaagagatggagccactggtgggacaggtgcaggactgg
A0A5F8HG85_BCL2L2-      agagtgtcaacaaagagatggagccactggtgggacaggtgcaggactgg
F7G6M3_BCL2L2-01        agagcgtcaacaaggagatggagcccctggtggggcaggtgcaggactgg
G1Q051_BCL2L2-01        agagtgtcaacaaggagatggagccacttgtgggacaagtacaggagtgg
G1TV33_BCL2L2-01        agagcgtcaacaaggagatggagcccctggtgggacaagtgcaggagtgg
D3Z5F7_BCL2L2-01        agagtgtcaacaaagaaatggagcctttggtgggacaagtgcaggattgg
G3V4B7_BCL2L2-10        agagtgtcaacaaggagatggaaccactggtgggacaagtgcaggagtgg
A0A6I9LUT0_BCL2L2-      aaagtgtcaacaaagaaatggagcccctggtgggacaagtgcaggattgg
A0A8C3X592_BCL2L2-      agagtgtcaacaaggagatggagccacttgtgggacaagtgcaggagtgg
A0A3Q9B4M8_BCL2L2-      agagtgtcaataaggagatggagccactcgtgggacaagtgccggagtgg
A0A7T8CLX7_BCL2L2-      agagtgtcaataaggagatggagccactcgtgggacaagtgccggagtgg
A0A8D0TJQ9_BCL2L2-      agagtgtcaataaggagatggagccactcgtgggacaagtgcaggagtgg
A0A4X1SF60_BCL2L2-      agagtgtcaataaggagatggagccactcgtgggacaagtgcaggagtgg
A0A4X1SF63_BCL2L2-      agagtgtcaataaggagatggagccactcgtgggacaagtgcaggagtgg
A0A8C0Q5E6_BCL2L2-      agagtgtcaacaaagagatggagccacttgtgggacaagtgcaagagtgg
A0A8I3MNK9_BCL2L2-      agagtgtcaacaaagagatggagccacttgtgggacaagtgcaagagtgg
A0A8I3RSU6_BCL2L2-      agagtgtcaacaaagagatggagccacttgtgggacaagtgcaagagtgg
A0A673VAY7_BCL2L2-      agagtgtcaacaaggagatggagccacttgtgggacaagtgcaagagtgg
A0A2I2UAE3_BCL2L2-      agagtgtcaacaaggagatggagccacttgtgggacaagtgcaagagtgg
A0A8C8XCR9_BCL2L2-      agagtgtcaacaaggagatggagccacttgtgggacaagtgcaagagtgg
A0A8C9J3S1_BCL2L2-      agagtgtcaacaaggagatggagccacttgtgggacaagtgcaagagtgg
M3Y5X5_BCL2L2-01        agagtgtcaacaaagagatggagccacttgtgggccaagtgcaagagtgg
A0A8C7EW82_BCL2L2-      agagtgtcaacaaagagatggagccacttgtgggccaagtgcaagagtgg
A0A452SHI1_BCL2L2-      agagtgtcaacaaagagatggagccacttgtgggacaagtgcaagagtgg
A0A384DPS8_BCL2L2-      agagtgtcaacaaagagatggagccacttgtgggacaagtgcaagagtgg
A0A8C4LWK5_BCL2L2-      agagtgtcaacaaggagatggagccacttgtgggacaagtgcaggagtgg
A0A8C6BK57_BCL2L2-      agagtgtcaacaaggagatggagccacttgtgggacaagtgcaggagtgg
A0A8C9CXQ5_BCL2L2-      agagtgtcaacaaggagatggagccacttgtgggacaagtgcaggagtgg
A0A8B8WSS7_BCL2L2-      agagtgtcaacaaggagatggagccacttgtgggacaagtgcaggagtgg
W5QDH4_BCL2L2-02        agagtgtcaacaaggagatggagccacttgtgggacaagtgcaggagtgg
A0A8C6CUC2_BCL2L2-      agagtgtcaacaaggagatggagccacttgtgggacaagtgcaggagtgg
A0A452ECF0_BCL2L2-      agagtgtcaacaaggagatggagccacttgtgggacaagtgcaggagtgg
A0A4W2D6A3_BCL2L2-      agagtgtcaacaaggagatggagccacttgtgggacaagtgcaggagtgg
A0A4W2D6A3_BCL2L2-      agagtgtcaacaaggagatggagccacttgtgggacaagtgcaggagtgg
A0A4W2GUJ7_BCL2L2-      agagtgtcaacaaggagatggagccacttgtgggacaagtgcaggagtgg
A0A4W2GUJ7_BCL2L2-      agagtgtcaacaaggagatggagccacttgtgggacaagtgcaggagtgg
A0A8B9WT05_BCL2L2-      agagtgtcaacaaggagatggagccacttgtgggacaagtgcaggagtgg
A0A4W2D6A3_BCL2L2-      agagtgtcaacaaggagatggagccacttgtgggacaagtgcaggagtgg
A0A4W2D6A3_BCL2L2-      agagtgtcaacaaggagatggagccacttgtgggacaagtgcaggagtgg
A0A4W2GUJ7_BCL2L2-      agagtgtcaacaaggagatggagccacttgtgggacaagtgcaggagtgg
A0A4W2GUJ7_BCL2L2-      agagtgtcaacaaggagatggagccacttgtgggacaagtgcaggagtgg
Q05KI8_BCL2L2-01        agagtgtcaacaaggagatggagccacttgtgggacaagtgcaggagtgg
A0A8C2VJ88_BCL2L2-      agagtgtcaacaaagagatggaaccactggtgggccaagtgcaggagtgg
A0A286XQQ9_BCL2L2-      agagtgtcaacaaagagatgcaaccactggtgggccaagtgcaggagtgg
A0A8C2VJ88_BCL2L2-      agagtgtcaacaaagagatggaaccactggtgggccaagtgcaggagtgg
A0A8D2APK0_BCL2L2-      agagtgtcaacaaagagatggagccactggtgggacaagtgcaggagtgg
A0A287D9B3_BCL2L2-      agagtgtcaacaaagagatggagccactggtgggacaagtgcaggagtgg
A0A8D2HGM1_BCL2L2-      agagtgtcaacaaagagatggagccactggtgggacaagtgcaggagtgg
A0A287D9B3_BCL2L2-      agagtgtcaacaaagagatggagccactggtgggacaagtgcaggagtgg
A0A8C9PGU3_BCL2L2-      agagtgtcaacaaagagatggagccactggtgggacaagtgcaggagtgg
W5QDH4_BCL2L2-01        agagtgtcaacaaggagatggagccacttgtgggacaagtgcaggagtgg
A0A4W2GUJ7_BCL2L2-      agagtgtcaacaaggagatggagccacttgtgggacaagtgcaggagtgg
A0A4W2GUJ7_BCL2L2-      agagtgtcaacaaggagatggagccacttgtgggacaagtgcaggagtgg
A0A4W2D6A3_BCL2L2-      agagtgtcaacaaggagatggagccacttgtgggacaagtgcaggagtgg
A0A4W2GUJ7_BCL2L2-      agagtgtcaacaaggagatggagccacttgtgggacaagtgcaggagtgg
A0A4W2D6A3_BCL2L2-      agagtgtcaacaaggagatggagccacttgtgggacaagtgcaggagtgg
A0A4W2GUJ7_BCL2L2-      agagtgtcaacaaggagatggagccacttgtgggacaagtgcaggagtgg
A0A4W2GUJ7_BCL2L2-      agagtgtcaacaaggagatggagccacttgtgggacaagtgcaggagtgg
A0A4W2GUJ7_BCL2L2-      agagtgtcaacaaggagatggagccacttgtgggacaagtgcaggagtgg
A0A5F5PML6_BCL2L2-      agagtgtcaacaaggagatggagccacttgtgggacaagtgcaggagtgg
A0A5F5PML6_BCL2L2-      agagtgtcaacaaggagatggagccacttgtgggacaagtgcaggagtgg
A0A8C5L5C6_BCL2L2-      agagtgtcaacaaagagatggagccactggtgggacaagtacaggagtgg
A0A8C0Q5E6_BCL2L2-      agagtgtcaacaaagagatggagccacttgtgggacaagtgcaagagtgg
A0A8I3MNK9_BCL2L2-      agagtgtcaacaaagagatggagccacttgtgggacaagtgcaagagtgg
A0A8I3RSU6_BCL2L2-      agagtgtcaacaaagagatggagccacttgtgggacaagtgcaagagtgg
A0A8I3MNK9_BCL2L2-      agagtgtcaacaaagagatggagccacttgtgggacaagtgcaagagtgg
A0A667I624_BCL2L2-      agagtgtcaacaaggagatggagccacttgtgggacaagtgcaagagtgg
G1LKF5_BCL2L2-01        agagtgtcaacaaagagatggaaccacttgtgggacaagtgcaagagtgg
G1LKF5_BCL2L2-02        agagtgtcaacaaagagatggaaccacttgtgggacaagtgcaagagtgg
A0A384DPS8_BCL2L2-      agagtgtcaacaaagagatggagccacttgtgggacaagtgcaagagtgg
A0A384DPS8_BCL2L2-      agagtgtcaacaaagagatggagccacttgtgggacaagtgcaagagtgg
A0A8C6RJE0_BCL2L2-      agagtgtcaacaaagagatggagccactggtgggacaagtgcaggattgg
A0A671DWB3_BCL2L2-      ccggcagccaggaggaggaggaggagc--------------cgggactgg
A0A250YBR2_BCL2L2-      agagcatcaacaaagagatggaaccactggtgggacaagtacaggagtgg
A0A250YBR2_BCL2L2-      agagcatcaacaaagagatggaaccactggtgggacaagtacaggagtgg
O88996_BCL2L2-01        agagtgtcaacaaagaaatggagccattggtgggacaagtgcaggattgg
Q7TS60_BCL2L2-01        agagtgtcaacaaagaaatggagccattggtgggacaagtgcaggattgg
A0A671DWB3_BCL2L2-      agagtgtcaacaaggagatggagccacttgtgggacaagtgcaggagtgg
A0A8C6RJE0_BCL2L2-      agagtgtcaacaaagagatggagccactggtgggacaagtgcaggattgg
A0A4W2D6A3_BCL2L2-      ccggcaatcaggaggaggaggaggagt--------------cgggactgg
A0A4W2GUJ7_BCL2L2-      ccggcaatcaggaggaggaggaggagt--------------cgggactgg
A0A4W2D6A3_BCL2L2-      ccggcaatcaggaggaggaggaggagt--------------cgggactgg
A0A4W2GUJ7_BCL2L2-      ccggcaatcaggaggaggaggaggagt--------------cgggactgg
A0A8C8YZD8_BCL2L2-      agagcgtcaacaaggagatggagccactggtgggacaagtgcaggagtgg
A0A8B7FJ73_BCL2L2-      agagtgtcaacaaggagatggagccactggtgggacaagtgcaggagtgg
A0A2K6GWM6_BCL2L2-      agagtgtcaacaaggagatggagccactggtgggacaagtgcaggagtgg
A0A8D0TJQ9_BCL2L2-      agagtgtcaataaggagatggagccactcgtgggacaagtgcaggagtgg
A0A482LX62_BCL2L2-      agagtgtcaataaggagatggagccactcgtgggacaagtgcaggagtgg
A0A4X1SF63_BCL2L2-      agagtgtcaataaggagatggagccactcgtgggacaagtgcaggagtgg
A0A4D6NWN1_BCL2L2-      agagtgtcaataaggagatggagccactcgtgggacaagtgcaggagtgg
A0A4X1SF60_BCL2L2-      agagtgtcaataaggagatggagccactcgtgggacaagtgcaggagtgg
A0A4X1SF63_BCL2L2-      agagtgtcaataaggagatggagccactcgtgggacaagtgcaggagtgg
A0A8D0TJQ9_BCL2L2-      agagtgtcaataaggagatggagccactcgtgggacaagtgcaggagtgg
A0A4X1SF60_BCL2L2-      agagtgtcaataaggagatggagccactcgtgggacaagtgcaggagtgg
A0A8D0TJQ9_BCL2L2-      agagtgtcaataaggagatggagccactcgtgggacaagtgcaggagtgg
H0XR82_BCL2L2-01        agagtgtcaacaaggagatggagccactggtgggacaagtgcaggagtgg
A0A4X1SF63_BCL2L2-      ccggcagccaggaggaggaggaggagc--------------cgggactgg
A0A4X1SF63_BCL2L2-      ccggcagccaggaggaggaggaggagc--------------cgggactgg
A0A8D0TJQ9_BCL2L2-      ccggcagccaggaggaggaggaggagc--------------cgggactgg
A0A8B7FJ73_BCL2L2-      agagtgtcaacaaggagatggagccactggtgggacaagtgcaggagtgg
A0A2K6GWM6_BCL2L2-      agagtgtcaacaaggagatggagccactggtgggacaagtgcaggagtgg
A0A5F5PML6_BCL2L2-      ccggcagccaggaggaggaggaggagc--------------cgggactgg
A0A8C8YZD8_BCL2L2-      ccggcagccaggaggaggaggaggagc--------------cgggactgg
A0A8B7FJ73_BCL2L2-      cgggcagccaggaggaggaggaggagc--------------cgggactgg
A0A8B7FJ73_BCL2L2-      -------ccaggaggaggaggaggagc--------------cgggactgg
A0A2K6GWM6_BCL2L2-      ccggcagccaggaggaggaggaggagc--------------cgggactgg
A0A2K6GWM6_BCL2L2-      -------ccaggaggaggaggaggagc--------------cgggactgg
A0A8C0Q5E6_BCL2L2-      ccggcagccaggaggaggaggaggagc--------------cgggactgg
A0A8I3MNK9_BCL2L2-      ccggcagccaggaggaggaggaggagc--------------cgggactgg
A0A8I3RSU6_BCL2L2-      ccggcagccaggaggaggaggaggagc--------------cgggactgg
A0A667I624_BCL2L2-      ccgg--gcca-gaggaggaggaggagc--------------cgggactgg
G1P3J2_BCL2L2-01        agagtgtcaacaaggagatggagccacttgtgggacaagtacaggagtgg
G3TMU7_BCL2L2-01        agagtgtcaacaaggagatggagccactggtgggacaagtgcaggagtgg
A0A2K6TM77_BCL2L2-      agagtgtcaacaaggagatggaaccactggtgggacaagtgcaggagtgg
A0A2K6TM77_BCL2L2-      agagtgtcaacaaggagatggaaccactggtgggacaagtgcaggagtgg
A0A2K5CWY6_BCL2L2-      agagtgtcaacaaggagatggaaccactggtgggacaagtgcaggagtgg
A0A2K5CWY6_BCL2L2-      agagtgtcaacaaggagatggaaccactggtgggacaagtgcaggagtgg
A0A2K5CWY6_BCL2L2-      --------------------gaggagc--------------cgggattgg
U3CRF8_BCL2L2-02        ccggcagtcaagaggaggaggaggagc--------------cgggactgg
U3CRF8_BCL2L2-03        ccggcagtcaagaggaggaggaggagc--------------cgggactgg
A0A2I3GEA7_BCL2L2-      ccggcagccaagaggaggaggaggagc--------------cgggactgg
A0A8I5U2F2_BCL2L2-      ccggcagccaagaggaggaggaggagc--------------cgggactgg
A0A2I2YPX6_BCL2L2-      ccggcagccaagaggaggaggaggagc--------------cgggactgg
A0A2I2YPX6_BCL2L2-      -------ccaagaggaggaggaggagc--------------cgggactgg
U3CRF8_BCL2L2-01        agagtgtcaacaaggagatggaaccactggtgggacaagtgcaggagtgg
A0A2K6TM77_BCL2L2-      --------------------------------------------------
A0A2K6TM77_BCL2L2-      agagtgtcaacaaggagatggaaccactggtgggacaagtgcaggagtgg
A0A2K5V0Q3_BCL2L2-      --------------------------------------------------
A0A2K6EA59_BCL2L2-      -------ccaagaggaggaggaggagc--------------cgggactgg
A0A2K6EA59_BCL2L2-      agagtgtcaacaaggagatggaaccactggtgggacaagtgcaggagtgg
A0A2K5MZX9_BCL2L2-      -------ccaagaggaggaggaggagc--------------cgggactgg
A0A2K5MZX9_BCL2L2-      agagtgtcaacaaggagatggaaccactggtgggacaagtgcaggagtgg
A0A2K5MZX9_BCL2L2-      ccggcagccaagaggaggaggaggagc--------------cgggactgg
A0A2K5V0Q3_BCL2L2-      --------------------------------------------------
F7G4L5_BCL2L2-03        ccggcagccaagaggaggaggaggagc--------------cgggactgg
A0A2K6EA59_BCL2L2-      ccggcagccaagaggaggaggaggagc--------------cgggactgg
A0A2K6AI25_BCL2L2-      --------------------------------------------------
A0A8D2FJU1_BCL2L2-      ccggcagccaagaggaggaggaggagc--------------cgggactgg
A0A2R9A2Q3_BCL2L2-      agagtgtcaacaaggagatggaaccactggtgggacaagtgcaggagtgg
A0A2R9A2Q3_BCL2L2-      --------------------------------------------------
A0A2K6RW35_BCL2L2-      --------------------------------------------------
A0A2K5HEJ9_BCL2L2-      --------------------------------------------------
A0A2K5HEJ9_BCL2L2-      agagtgtcaacaaggagatggaaccactggtgggacaagtgcaggagtgg
A0A8I5U2F2_BCL2L2-      agagtgtcaacaaggagatggaaccactggtgggacaagtgcaggagtgg
A0A2K5CWY6_BCL2L2-      agagtgtcaacaaggagatggaaccactggtgggacaagtgcaggagtgg
A0A8I5U2F2_BCL2L2-      agagtgtcaacaaggagatggaaccactggtgggacaagtgcaggagtgg
A0A2K6RW35_BCL2L2-      agagtgtcaacaaggagatggaaccactggtgggacaagtgcaggagtgg
A0A2K6RW35_BCL2L2-      agagtgtcaacaaggagatggaaccactggtgggacaagtgcaggagtgg
A0A2K6ME72_BCL2L2-      agagtgtcaacaaggagatggaaccactggtgggacaagtgcaggagtgg
A0A2R9A2Q3_BCL2L2-      agagtgtcaacaaggagatggaaccactggtgggacaagtgcaggagtgg
A0A2K5MZX9_BCL2L2-      agagtgtcaacaaggagatggaaccactggtgggacaagtgcaggagtgg
A0A2K6EA59_BCL2L2-      agagtgtcaacaaggagatggaaccactggtgggacaagtgcaggagtgg
A0A2K6RW35_BCL2L2-      agagtgtcaacaaggagatggaaccactggtgggacaagtgcaggagtgg
A0A2K6ME72_BCL2L2-      agagtgtcaacaaggagatggaaccactggtgggacaagtgcaggagtgg
A0A8D2FJU1_BCL2L2-      agagtgtcaacaaggagatggaaccactggtgggacaagtgcaggagtgg
A0A8D2FJU1_BCL2L2-      agagtgtcaacaaggagatggaaccactggtgggacaagtgcaggagtgg
A0A8C9H679_BCL2L2-      agagtgtcaacaaggagatggaaccactggtgggacaagtgcaggagtgg
A0A8C9H679_BCL2L2-      agagtgtcaacaaggagatggaaccactggtgggacaagtgcaggagtgg
A0A2I3MUE4_BCL2L2-      agagtgtcaacaaggagatggaaccactggtgggacaagtgcaggagtgg
A0A2I3GEA7_BCL2L2-      agagtgtcaacaaggagatggaaccactggtgggacaagtgcaggagtgg
A0A2I3GEA7_BCL2L2-      agagtgtcaacaaggagatggaaccactggtgggacaagtgcaggagtgg
A0A2K6AI25_BCL2L2-      agagtgtcaacaaggagatggaaccactggtgggacaagtgcaggagtgg
A0A2K6AI25_BCL2L2-      agagtgtcaacaaggagatggaaccactggtgggacaagtgcaggagtgg
F7G4L5_BCL2L2-02        agagtgtcaacaaggagatggaaccactggtgggacaagtgcaggagtgg
F7G4L5_BCL2L2-01        agagtgtcaacaaggagatggaaccactggtgggacaagtgcaggagtgg
A0A2K5V0Q3_BCL2L2-      agagtgtcaacaaggagatggaaccactggtgggacaagtgcaggagtgg
A0A2K5V0Q3_BCL2L2-      agagtgtcaacaaggagatggaaccactggtgggacaagtgcaggagtgg
A0A2K5V0Q3_BCL2L2-      agagtgtcaacaaggagatggaaccactggtgggacaagtgcaggagtgg
A0A2K5V0Q3_BCL2L2-      agagtgtcaacaaggagatggaaccactggtgggacaagtgcaggagtgg
A0A2K5V0Q3_BCL2L2-      agagtgtcaacaaggagatggaaccactggtgggacaagtgcaggagtgg
A0A2K5V0Q3_BCL2L2-      agagtgtcaacaaggagatggaaccactggtgggacaagtgcaggagtgg
A0A2K5V0Q3_BCL2L2-      agagtgtcaacaaggagatggaaccactggtgggacaagtgcaggagtgg
G3V4B7_BCL2L2-08        agagtgtcaacaaggagatggaaccactggtgggacaagtgcaggagtgg
G3V4B7_BCL2L2-07        agagtgtcaacaaggagatggaaccactggtgggacaagtgcaggagtgg
G3V4B7_BCL2L2-06        agagtgtcaacaaggagatggaaccactggtgggacaagtgcaggagtgg
G3V4B7_BCL2L2-05        agagtgtcaacaaggagatggaaccactggtgggacaagtgcaggagtgg
G3V4B7_BCL2L2-04        agagtgtcaacaaggagatggaaccactggtgggacaagtgcaggagtgg
G3V4B7_BCL2L2-03        agagtgtcaacaaggagatggaaccactggtgggacaagtgcaggagtgg
G3V4B7_BCL2L2-02        agagtgtcaacaaggagatggaaccactggtgggacaagtgcaggagtgg
A0A2I2YPX6_BCL2L2-      agagtgtcaacaaggagatggaaccactggtgggacaagtgcaggagtgg
A0A2I2YPX6_BCL2L2-      agagtgtcaacaaggagatggaaccactggtgggacaagtgcaggagtgg
A0A2K5HEJ9_BCL2L2-      agagtgtcaacaaggagatggaaccactggtgggacaagtgcaggagtgg
A0A0D9RU30_BCL2L2-      agagtgtcaacaaggagatggaaccactggtgggacaagtgcaggagtgg
G3V4B7_BCL2L2-01        --------------------------------------------------
G3V4B7_BCL2L2-09        --------------------------------------------------
                                                                          

H3AAS7_BCL2L2-02        acagtaacttatgtagagagcagccttcaggattggatcaaccacagtgg
H3AAS7_BCL2L2-01        acagtaacttatgtagagagcagccttcaggattggatcaaccacagtgg
Q6GP82_BCL2L2-01        atggtgacatatctggagacaaacctgagaggctggattcagagcaatgg
A0A8C5PJB3_BCL2L2-      atggtgacctatcttgaaacgcacctgagagactggatgcagagcaatgg
A0A4X2LP96_BCL2L2-      atggtgacctacctagagacccagctggcagattggatccacagcagcgg
A0A5F8HG85_BCL2L2-      tcgagggcgacccgggggacggcgctatc-------------------ga
A0A5F8HG85_BCL2L2-      atggtgacctacctagagacacagctggcagactggatccacagcagtgg
A0A5F8HG85_BCL2L2-      atggtgacctacctagagacacagctggcagactggatccacagcagtgg
F7G6M3_BCL2L2-01        atggtggcctacctggacacccagctggccgactggatccgcagcagcgg
G1Q051_BCL2L2-01        acggtggcctacctggagatgcggctggctgactggatccacagtattgg
G1TV33_BCL2L2-01        atggtgacctacctggagacgcagctggccggctggatccacagcaccgg
D3Z5F7_BCL2L2-01        atggtggcctacctggagacacgtctggctgactggatccacagcagtgg
G3V4B7_BCL2L2-10        atggtggcctacctggagacgcagctggctgactggatccacagcagtgg
A0A6I9LUT0_BCL2L2-      atggtggcctacctggagacgcgcctggccgactggatccacagcagtgg
A0A8C3X592_BCL2L2-      atggtgacctacctggagacgcggctagccgactggatccacagcagtgg
A0A3Q9B4M8_BCL2L2-      atggtgacctacctggagacacggctggccgactggatccacagcagtgg
A0A7T8CLX7_BCL2L2-      atggtgacctacctggagacacggctggccgactggatccacagcagtgg
A0A8D0TJQ9_BCL2L2-      atggtgacctacctggagacacggctggccgactggatccacagcagtgg
A0A4X1SF60_BCL2L2-      atggtgacctacctggagacacggctggccgactggatccacagcagtgg
A0A4X1SF63_BCL2L2-      atggtgacctacctggagacacggctggccgactggatccacagcagtgg
A0A8C0Q5E6_BCL2L2-      atggtggcctacctggagacacggctggccgactggatccacagcagtgg
A0A8I3MNK9_BCL2L2-      atggtggcctacctggagacacggctggccgactggatccacagcagtgg
A0A8I3RSU6_BCL2L2-      atggtggcctacctggagacacggctggccgactggatccacagcagtgg
A0A673VAY7_BCL2L2-      atggtggcctacctggagacacggctggctgactggatccacagcagtgg
A0A2I2UAE3_BCL2L2-      atggtggcctacctggagacacggctggccgactggattcacagcagtgg
A0A8C8XCR9_BCL2L2-      atggtggcctacctggagacacggctggccgactggatccacagcagtgg
A0A8C9J3S1_BCL2L2-      atggtggcctacctggagacacggctggccgactggatccacagcagtgg
M3Y5X5_BCL2L2-01        atggtggcctacctggagacgcggctggccgactggatccacagcagtgg
A0A8C7EW82_BCL2L2-      atggtggcctacctggagacgcggctggccgactggatccacagcagtgg
A0A452SHI1_BCL2L2-      atggtggcctacctggagacacggctggctgactggatccacagcagtgg
A0A384DPS8_BCL2L2-      atggtggcctacctggagacacggctggctgactggatccacagcagtgg
A0A8C4LWK5_BCL2L2-      atggtggcctacctggagactcggctggccgactggatccacagcagtgg
A0A8C6BK57_BCL2L2-      atggtggcctacctggagacgcggctggccgactggatccacagcagcgg
A0A8C9CXQ5_BCL2L2-      atggtggcctacctggagacgcggctggccgactggatccacagcagcgg
A0A8B8WSS7_BCL2L2-      atggtggcctacctggagacgcggctggccgactggatccacagcagcgg
W5QDH4_BCL2L2-02        atggtggcctacctggagacgcggctggctgactggatccacagcagtgg
A0A8C6CUC2_BCL2L2-      atggtggcctacctggagacgcgactggctgactggatccacagcagcgg
A0A452ECF0_BCL2L2-      atggtggcctacctggagacgcggctggctgactggatccacagcagtgg
A0A4W2D6A3_BCL2L2-      atggtggcctacctggagacgaggctggctgactggatccacagcagtgg
A0A4W2D6A3_BCL2L2-      atggtggcctacctggagacgaggctggctgactggatccacagcagtgg
A0A4W2GUJ7_BCL2L2-      atggtggcctacctggagacgaggctggctgactggatccacagcagtgg
A0A4W2GUJ7_BCL2L2-      atggtggcctacctggagacgaggctggctgactggatccacagcagtgg
A0A8B9WT05_BCL2L2-      atggtggcctacctggagacgaggctggctgactggatccacagcagtgg
A0A4W2D6A3_BCL2L2-      atggtggcctacctggagacgaggctggctgactggatccacagcagtgg
A0A4W2D6A3_BCL2L2-      atggtggcctacctggagacgaggctggctgactggatccacagcagtgg
A0A4W2GUJ7_BCL2L2-      atggtggcctacctggagacgaggctggctgactggatccacagcagtgg
A0A4W2GUJ7_BCL2L2-      atggtggcctacctggagacgaggctggctgactggatccacagcagtgg
Q05KI8_BCL2L2-01        atggtggcctacctggagacgaggctggctgactggatccacagcagtgg
A0A8C2VJ88_BCL2L2-      atggtggcctacctggagacgcgcctggccgactggatccacagcagtgg
A0A286XQQ9_BCL2L2-      atggtggcctacctggagacgcgcctggccgactggatccacagcagtgg
A0A8C2VJ88_BCL2L2-      atggtggcctacctggagacgcgcctggccgactggatccacagcagtgg
A0A8D2APK0_BCL2L2-      atggtggcctacctggagacacgcctggctgactggatccacagcagtgg
A0A287D9B3_BCL2L2-      atggtggcctacctggagacgcggctggctgactggatccacagcagtgg
A0A8D2HGM1_BCL2L2-      atggtggcctacctggagacgcggctggctgactggatccacagcagtgg
A0A287D9B3_BCL2L2-      atggtggcctacctggagacgcggctggctgactggatccacagcagtgg
A0A8C9PGU3_BCL2L2-      atggtggcctacctggagacgcggctggctgactggatccacagcagtgg
W5QDH4_BCL2L2-01        atggtggcctacctggagacgcggctggctgactggatccacagcagtgg
A0A4W2GUJ7_BCL2L2-      atggtggcctacctggagacgaggctggctgactggatccacagcagtgg
A0A4W2GUJ7_BCL2L2-      atggtggcctacctggagacgaggctggctgactggatccacagcagtgg
A0A4W2D6A3_BCL2L2-      atggtggcctacctggagacgaggctggctgactggatccacagcagtgg
A0A4W2GUJ7_BCL2L2-      atggtggcctacctggagacgaggctggctgactggatccacagcagtgg
A0A4W2D6A3_BCL2L2-      atggtggcctacctggagacgaggctggctgactggatccacagcagtgg
A0A4W2GUJ7_BCL2L2-      atggtggcctacctggagacgaggctggctgactggatccacagcagtgg
A0A4W2GUJ7_BCL2L2-      atggtggcctacctggagacgaggctggctgactggatccacagcagtgg
A0A4W2GUJ7_BCL2L2-      atggtggcctacctggagacgaggctggctgactggatccacagcagtgg
A0A5F5PML6_BCL2L2-      atggtggcctacctggagactcggctggccgactggatccacagcagtgg
A0A5F5PML6_BCL2L2-      atggtggcctacctggagactcggctggccgactggatccacagcagtgg
A0A8C5L5C6_BCL2L2-      atggtggcctacctggagacgcgcctggctgactggatccacagcagtgg
A0A8C0Q5E6_BCL2L2-      atggtggcctacctggagacacggctggccgactggatccacagcagtgg
A0A8I3MNK9_BCL2L2-      atggtggcctacctggagacacggctggccgactggatccacagcagtgg
A0A8I3RSU6_BCL2L2-      atggtggcctacctggagacacggctggccgactggatccacagcagtgg
A0A8I3MNK9_BCL2L2-      atggtggcctacctggagacacggctggccgactggatccacagcagtgg
A0A667I624_BCL2L2-      atggtggcctacctggagacacggctggccgactggattcacagcagtgg
G1LKF5_BCL2L2-01        atggtggcctacctggagacacggctggctgactggatccacagcagtgg
G1LKF5_BCL2L2-02        atggtggcctacctggagacacggctggctgactggatccacagcagtgg
A0A384DPS8_BCL2L2-      atggtggcctacctggagacacggctggctgactggatccacagcagtgg
A0A384DPS8_BCL2L2-      atggtggcctacctggagacacggctggctgactggatccacagcagtgg
A0A8C6RJE0_BCL2L2-      atggtgacctacctggagacgcgcctggctgactggatccacagcagtgg
A0A671DWB3_BCL2L2-      tggagagtgacccgggggacggcgc-------------------cattga
A0A250YBR2_BCL2L2-      atggtggcctacctggagacacgcctagccgactggatccacagcagtgg
A0A250YBR2_BCL2L2-      atggtggcctacctggagacacgcctagccgactggatccacagcagtgg
O88996_BCL2L2-01        atggtgacctacctggagacacgcttggctgactggatccacagcagtgg
Q7TS60_BCL2L2-01        atggtgacctacctggagacacgcttggctgactggatccacagcagtgg
A0A671DWB3_BCL2L2-      atggtggcctacctggagacacggctagctgactggatccacagcagtgg
A0A8C6RJE0_BCL2L2-      atggtgacctacctggagacgcgcctggctgactggatccacagcagtgg
A0A4W2D6A3_BCL2L2-      tcgagggtgacccgggggacggcgc-------------------cattga
A0A4W2GUJ7_BCL2L2-      tcgagggtgacccgggggacggcgc-------------------cattga
A0A4W2D6A3_BCL2L2-      tcgagggtgacccgggggacggcgc-------------------cattga
A0A4W2GUJ7_BCL2L2-      tcgagggtgacccgggggacggcgc-------------------cattga
A0A8C8YZD8_BCL2L2-      atggtgacctacctggacacacggctggccgactggatccacagcagcgg
A0A8B7FJ73_BCL2L2-      atggtggcctacctggagacacggctggccgactggatccacagcagtgg
A0A2K6GWM6_BCL2L2-      atggtggcctacctggagacacggctggccgactggatccacagcagtgg
A0A8D0TJQ9_BCL2L2-      atggtgacctacctggagacacggctggccgactggatccacagcagtgg
A0A482LX62_BCL2L2-      atggtgacctacctggagacacggctggccgactggatccacagcagcgc
A0A4X1SF63_BCL2L2-      atggtgacctacctggagacacggctggccgactggatccacagcagtgg
A0A4D6NWN1_BCL2L2-      atggtgacctacctggagtcacggctggccgactggatccacagcagtgg
A0A4X1SF60_BCL2L2-      atggtgacctacctggagacacggctggccgactggatccacagcagtgg
A0A4X1SF63_BCL2L2-      atggtgacctacctggagacacggctggccgactggatccacagcagtgg
A0A8D0TJQ9_BCL2L2-      atggtgacctacctggagacacggctggccgactggatccacagcagtgg
A0A4X1SF60_BCL2L2-      atggtgacctacctggagacacggctggccgactggatccacagcagtgg
A0A8D0TJQ9_BCL2L2-      atggtgacctacctggagacacggctggccgactggatccacagcagtgg
H0XR82_BCL2L2-01        atggtagcctacctggagacacggctggctgactggatccatagcagtgg
A0A4X1SF63_BCL2L2-      tcgagggtgacccgggggacggcgc-------------------cattga
A0A4X1SF63_BCL2L2-      tcgagggtgacccgggggacggcgc-------------------cattga
A0A8D0TJQ9_BCL2L2-      tcgagggtgacccgggggacggcgc-------------------cattga
A0A8B7FJ73_BCL2L2-      atggtggcctacctggagacacggctggccgactggatccacagcagtgg
A0A2K6GWM6_BCL2L2-      atggtggcctacctggagacacggctggccgactggatccacagcagtgg
A0A5F5PML6_BCL2L2-      tcgagggtgacccgggggacggcgc-------------------cattga
A0A8C8YZD8_BCL2L2-      tcgagggcgacccgggggacggcgc-------------------cattga
A0A8B7FJ73_BCL2L2-      tcgagggtgacccgggggacggcgc-------------------cattga
A0A8B7FJ73_BCL2L2-      tcgagggtgacccgggggacggcgc-------------------cattga
A0A2K6GWM6_BCL2L2-      tcgagggtgacccgggggacggcgc-------------------cattga
A0A2K6GWM6_BCL2L2-      tcgagggtgacccgggggacggcgc-------------------cattga
A0A8C0Q5E6_BCL2L2-      tcgagggtgacccgggggacggcgc-------------------cattga
A0A8I3MNK9_BCL2L2-      tcgagggtgacccgggggacggcgc-------------------cattga
A0A8I3RSU6_BCL2L2-      tcgagggtgacccgggggacggcgc-------------------cattga
A0A667I624_BCL2L2-      tcgagggtgacccgggggacggcgc-------------------cattga
G1P3J2_BCL2L2-01        atggtggcctacctggagacgcggctggccgactggatccacagtagtgg
G3TMU7_BCL2L2-01        atggtggtctacctggagacgcggctggctgactggatccacagcagtgg
A0A2K6TM77_BCL2L2-      atggtggcctacctggagacgcggctggccgactggatccacagcagtgg
A0A2K6TM77_BCL2L2-      atggtggcctacctggagacgcggctggccgactggatccacagcagtgg
A0A2K5CWY6_BCL2L2-      atggtggcctacctggagacgcggctggccgactggatccacagcagtgg
A0A2K5CWY6_BCL2L2-      atggtggcctacctggagacgcggctggccgactggatccacagcagtgg
A0A2K5CWY6_BCL2L2-      tcgagggtgacccgggggacggcgc-------------------cattga
U3CRF8_BCL2L2-02        tcgagggtgacccgggggacggcgc-------------------cattga
U3CRF8_BCL2L2-03        tcgagggtgacccgggggacggcgc-------------------cattga
A0A2I3GEA7_BCL2L2-      tcgagggtgacccgggggacggcgc-------------------cattga
A0A8I5U2F2_BCL2L2-      tcgagggtgacccgggggacggcgc-------------------cattga
A0A2I2YPX6_BCL2L2-      tcgagggtgacccgggggacggcgc-------------------cattga
A0A2I2YPX6_BCL2L2-      tcgagggtgacccgggggacggcgc-------------------cattga
U3CRF8_BCL2L2-01        atggtggcctacctggagacgcggctggccgactggatccacagcagtgg
A0A2K6TM77_BCL2L2-      --------------------------------------------------
A0A2K6TM77_BCL2L2-      atggtggcctacctggagacgcggctggccgactggatccacagcagtgg
A0A2K5V0Q3_BCL2L2-      --------------------------------------------------
A0A2K6EA59_BCL2L2-      tcgagggtgacccgggggacggcgc-------------------cattga
A0A2K6EA59_BCL2L2-      atggtggcctacctggagacgcggctggctgactggatccacagcagtgg
A0A2K5MZX9_BCL2L2-      tcgagggtgacccgggggacggcgc-------------------cattga
A0A2K5MZX9_BCL2L2-      atggtggcctacctggagacgcggctggctgactggatccacagcagtgg
A0A2K5MZX9_BCL2L2-      tcgagggtgacccgggggacggcgc-------------------cattga
A0A2K5V0Q3_BCL2L2-      --------------------------------------------------
F7G4L5_BCL2L2-03        tcgagggtgacccgggggacggcgc-------------------cattga
A0A2K6EA59_BCL2L2-      tcgagggtgacccgggggacggcgc-------------------cattga
A0A2K6AI25_BCL2L2-      --------------------------------------------------
A0A8D2FJU1_BCL2L2-      tcgagggtgacccgggggacggcgc-------------------cattga
A0A2R9A2Q3_BCL2L2-      atggtggcctacctggagacgcggctggctgactggatccacagcagtgg
A0A2R9A2Q3_BCL2L2-      --------------------------------------------------
A0A2K6RW35_BCL2L2-      --------------------------------------------------
A0A2K5HEJ9_BCL2L2-      --------------------------------------------------
A0A2K5HEJ9_BCL2L2-      atggtggcctacctggagacgcggctggctgactggatccacagcagtgg
A0A8I5U2F2_BCL2L2-      atggtggcctacctggagacgcggctggctgactggatccacagcagtgg
A0A2K5CWY6_BCL2L2-      atggtggcctacctggagacgcggctggccgactggatccacagcagtgg
A0A8I5U2F2_BCL2L2-      atggtggcctacctggagacgcggctggctgactggatccacagcagtgg
A0A2K6RW35_BCL2L2-      atggtggcctacctggagacgcggctggctgactggatccacagcagtgg
A0A2K6RW35_BCL2L2-      atggtggcctacctggagacgcggctggctgactggatccacagcagtgg
A0A2K6ME72_BCL2L2-      atggtggcctacctggagacgcggctggctgactggatccacagcagtgg
A0A2R9A2Q3_BCL2L2-      atggtggcctacctggagacgcggctggctgactggatccacagcagtgg
A0A2K5MZX9_BCL2L2-      atggtggcctacctggagacgcggctggctgactggatccacagcagtgg
A0A2K6EA59_BCL2L2-      atggtggcctacctggagacgcggctggctgactggatccacagcagtgg
A0A2K6RW35_BCL2L2-      atggtggcctacctggagacgcggctggctgactggatccacagcagtgg
A0A2K6ME72_BCL2L2-      atggtggcctacctggagacgcggctggctgactggatccacagcagtgg
A0A8D2FJU1_BCL2L2-      atggtggcctacctggagacgcggctggctgactggatccacagcagtgg
A0A8D2FJU1_BCL2L2-      atggtggcctacctggagacgcggctggctgactggatccacagcagtgg
A0A8C9H679_BCL2L2-      atggtggcctacctggagacgcggctggctgactggatccacagcagtgg
A0A8C9H679_BCL2L2-      atggtggcctacctggagacgcggctggctgactggatccacagcagtgg
A0A2I3MUE4_BCL2L2-      atggtggcctacctggagacgcggctggctgactggatccacagcagtgg
A0A2I3GEA7_BCL2L2-      atggtggcctacttggagacgcggctggctgactggatccacagcagtgg
A0A2I3GEA7_BCL2L2-      atggtggcctacttggagacgcggctggctgactggatccacagcagtgg
A0A2K6AI25_BCL2L2-      atggtggcctacctggagacgcggctggctgactggatccacagcagtgg
A0A2K6AI25_BCL2L2-      atggtggcctacctggagacgcggctggctgactggatccacagcagtgg
F7G4L5_BCL2L2-02        atggtggcctacctggagacgcggctggctgactggatccacagcagtgg
F7G4L5_BCL2L2-01        atggtggcctacctggagacgcggctggctgactggatccacagcagtgg
A0A2K5V0Q3_BCL2L2-      atggtggcctacctggagacgcggctggctgactggatccacagcagtgg
A0A2K5V0Q3_BCL2L2-      atggtggcctacctggagacgcggctggctgactggatccacagcagtgg
A0A2K5V0Q3_BCL2L2-      atggtggcctacctggagacgcggctggctgactggatccacagcagtgg
A0A2K5V0Q3_BCL2L2-      atggtggcctacctggagacgcggctggctgactggatccacagcagtgg
A0A2K5V0Q3_BCL2L2-      atggtggcctacctggagacgcggctggctgactggatccacagcagtgg
A0A2K5V0Q3_BCL2L2-      atggtggcctacctggagacgcggctggctgactggatccacagcagtgg
A0A2K5V0Q3_BCL2L2-      atggtggcctacctggagacgcggctggctgactggatccacagcagtgg
G3V4B7_BCL2L2-08        atggtggcctacctggagacgcagctggctgactggatccacagcagtgg
G3V4B7_BCL2L2-07        atggtggcctacctggagacgcagctggctgactggatccacagcagtgg
G3V4B7_BCL2L2-06        atggtggcctacctggagacgcagctggctgactggatccacagcagtgg
G3V4B7_BCL2L2-05        atggtggcctacctggagacgcagctggctgactggatccacagcagtgg
G3V4B7_BCL2L2-04        atggtggcctacctggagacgcagctggctgactggatccacagcagtgg
G3V4B7_BCL2L2-03        atggtggcctacctggagacgcagctggctgactggatccacagcagtgg
G3V4B7_BCL2L2-02        atggtggcctacctggagacgcagctggctgactggatccacagcagtgg
A0A2I2YPX6_BCL2L2-      atggtggcctacctggagacgcggctggctgactggatccacagcagtgg
A0A2I2YPX6_BCL2L2-      atggtggcctacctggagacgcggctggctgactggatccacagcagtgg
A0A2K5HEJ9_BCL2L2-      atggtggcctacctggagacgcggctggctgactggatccacagcagtgg
A0A0D9RU30_BCL2L2-      atggtggcctacctggagacgcggctggctgactggatccacagcagtgg
G3V4B7_BCL2L2-01        --------------------------------------------------
G3V4B7_BCL2L2-09        --------------------------------------------------
                                                                          

H3AAS7_BCL2L2-02        aggatgg-------------------------------------------
H3AAS7_BCL2L2-01        aggatgg-------------------------------------------
Q6GP82_BCL2L2-01        aggctgg-------------------------------------------
A0A8C5PJB3_BCL2L2-      tggatgg-------------------------------------------
A0A4X2LP96_BCL2L2-      gggctgg-------------------------------------------
A0A5F8HG85_BCL2L2-      ggacccg-------------------------------------------
A0A5F8HG85_BCL2L2-      gggctgg-------------------------------------------
A0A5F8HG85_BCL2L2-      gggctgg-------------------------------------------
F7G6M3_BCL2L2-01        gggctgg-------------------------------------------
G1Q051_BCL2L2-01        gggctgg-------------------------------------------
G1TV33_BCL2L2-01        gggctgg-------------------------------------------
D3Z5F7_BCL2L2-01        gggctgg-------------------------------------------
G3V4B7_BCL2L2-10        gggctgg-------------------------------------------
A0A6I9LUT0_BCL2L2-      gggctgg-------------------------------------------
A0A8C3X592_BCL2L2-      gggctgg-------------------------------------------
A0A3Q9B4M8_BCL2L2-      gggctgg-------------------------------------------
A0A7T8CLX7_BCL2L2-      gggctgg-------------------------------------------
A0A8D0TJQ9_BCL2L2-      gggctgg-------------------------------------------
A0A4X1SF60_BCL2L2-      gggctgg-------------------------------------------
A0A4X1SF63_BCL2L2-      gggctgg-------------------------------------------
A0A8C0Q5E6_BCL2L2-      gggctgg-------------------------------------------
A0A8I3MNK9_BCL2L2-      gggctgg-------------------------------------------
A0A8I3RSU6_BCL2L2-      gggctgg-------------------------------------------
A0A673VAY7_BCL2L2-      gggctgg-------------------------------------------
A0A2I2UAE3_BCL2L2-      gggctgg-------------------------------------------
A0A8C8XCR9_BCL2L2-      gggctgg-------------------------------------------
A0A8C9J3S1_BCL2L2-      gggctgg-------------------------------------------
M3Y5X5_BCL2L2-01        gggctgg-------------------------------------------
A0A8C7EW82_BCL2L2-      gggctgg-------------------------------------------
A0A452SHI1_BCL2L2-      gggctgg-------------------------------------------
A0A384DPS8_BCL2L2-      gggctgg-------------------------------------------
A0A8C4LWK5_BCL2L2-      aggctgg-------------------------------------------
A0A8C6BK57_BCL2L2-      gggctgg-------------------------------------------
A0A8C9CXQ5_BCL2L2-      gggctgg-------------------------------------------
A0A8B8WSS7_BCL2L2-      gggctgg-------------------------------------------
W5QDH4_BCL2L2-02        gggctgg-------------------------------------------
A0A8C6CUC2_BCL2L2-      gggctgg-------------------------------------------
A0A452ECF0_BCL2L2-      gggctgg-------------------------------------------
A0A4W2D6A3_BCL2L2-      gggctgg-------------------------------------------
A0A4W2D6A3_BCL2L2-      gggctgg-------------------------------------------
A0A4W2GUJ7_BCL2L2-      gggctgg-------------------------------------------
A0A4W2GUJ7_BCL2L2-      gggctgg-------------------------------------------
A0A8B9WT05_BCL2L2-      gggctgg-------------------------------------------
A0A4W2D6A3_BCL2L2-      gggctgg-------------------------------------------
A0A4W2D6A3_BCL2L2-      gggctgg-------------------------------------------
A0A4W2GUJ7_BCL2L2-      gggctgg-------------------------------------------
A0A4W2GUJ7_BCL2L2-      gggctgg-------------------------------------------
Q05KI8_BCL2L2-01        gggctgg-------------------------------------------
A0A8C2VJ88_BCL2L2-      gggctgg-------------------------------------------
A0A286XQQ9_BCL2L2-      gggctgg-------------------------------------------
A0A8C2VJ88_BCL2L2-      gggctgg-------------------------------------------
A0A8D2APK0_BCL2L2-      gggctgg-------------------------------------------
A0A287D9B3_BCL2L2-      gggctgg-------------------------------------------
A0A8D2HGM1_BCL2L2-      gggctgg-------------------------------------------
A0A287D9B3_BCL2L2-      gggctgg-------------------------------------------
A0A8C9PGU3_BCL2L2-      gggctgg-------------------------------------------
W5QDH4_BCL2L2-01        gggctg--------------------------------------------
A0A4W2GUJ7_BCL2L2-      gggctg--------------------------------------------
A0A4W2GUJ7_BCL2L2-      gggctg--------------------------------------------
A0A4W2D6A3_BCL2L2-      gggctg--------------------------------------------
A0A4W2GUJ7_BCL2L2-      gggctg--------------------------------------------
A0A4W2D6A3_BCL2L2-      gggctg--------------------------------------------
A0A4W2GUJ7_BCL2L2-      gggctg--------------------------------------------
A0A4W2GUJ7_BCL2L2-      gggctggttctcccagaccagtgaagctgagatggttcatgaagtatttt
A0A4W2GUJ7_BCL2L2-      gggctggttctcccagaccagtgaagctgagatggttcatgaagtatttt
A0A5F5PML6_BCL2L2-      aggctgg-------------------------------------------
A0A5F5PML6_BCL2L2-      aggctgg-------------------------------------------
A0A8C5L5C6_BCL2L2-      gggctgg-------------------------------------------
A0A8C0Q5E6_BCL2L2-      gggctgg-------------------------------------------
A0A8I3MNK9_BCL2L2-      gggctgg-------------------------------------------
A0A8I3RSU6_BCL2L2-      gggctgg-------------------------------------------
A0A8I3MNK9_BCL2L2-      gggctgg-------------------------------------------
A0A667I624_BCL2L2-      gggctgg-------------------------------------------
G1LKF5_BCL2L2-01        gggctgg-------------------------------------------
G1LKF5_BCL2L2-02        gggctgg-------------------------------------------
A0A384DPS8_BCL2L2-      gggctgg-------------------------------------------
A0A384DPS8_BCL2L2-      gggctgg-------------------------------------------
A0A8C6RJE0_BCL2L2-      gggctgg-------------------------------------------
A0A671DWB3_BCL2L2-      ggacccg-------------------------------------------
A0A250YBR2_BCL2L2-      gggctgg-------------------------------------------
A0A250YBR2_BCL2L2-      gggctgg-------------------------------------------
O88996_BCL2L2-01        gggctgg-------------------------------------------
Q7TS60_BCL2L2-01        gggctgg-------------------------------------------
A0A671DWB3_BCL2L2-      gggctgg-------------------------------------------
A0A8C6RJE0_BCL2L2-      gggctgg-------------------------------------------
A0A4W2D6A3_BCL2L2-      ggacccg-------------------------------------------
A0A4W2GUJ7_BCL2L2-      ggacccg-------------------------------------------
A0A4W2D6A3_BCL2L2-      ggacccg-------------------------------------------
A0A4W2GUJ7_BCL2L2-      ggacccg-------------------------------------------
A0A8C8YZD8_BCL2L2-      gggctgg-------------------------------------------
A0A8B7FJ73_BCL2L2-      gggctgg-------------------------------------------
A0A2K6GWM6_BCL2L2-      gggctgg-------------------------------------------
A0A8D0TJQ9_BCL2L2-      gggctgg-------------------------------------------
A0A482LX62_BCL2L2-      --------------------------------------------------
A0A4X1SF63_BCL2L2-      gggctgg-------------------------------------------
A0A4D6NWN1_BCL2L2-      gggctgg-------------------------------------------
A0A4X1SF60_BCL2L2-      gggctgg-------------------------------------------
A0A4X1SF63_BCL2L2-      gggctgg-------------------------------------------
A0A8D0TJQ9_BCL2L2-      gggctgg-------------------------------------------
A0A4X1SF60_BCL2L2-      gggctgg-------------------------------------------
A0A8D0TJQ9_BCL2L2-      gggctgg-------------------------------------------
H0XR82_BCL2L2-01        tggctgg-------------------------------------------
A0A4X1SF63_BCL2L2-      ggacccg-------------------------------------------
A0A4X1SF63_BCL2L2-      ggacccg-------------------------------------------
A0A8D0TJQ9_BCL2L2-      ggacccg-------------------------------------------
A0A8B7FJ73_BCL2L2-      gggctgg-------------------------------------------
A0A2K6GWM6_BCL2L2-      gggctgg-------------------------------------------
A0A5F5PML6_BCL2L2-      ggacccg-------------------------------------------
A0A8C8YZD8_BCL2L2-      ggacccg-------------------------------------------
A0A8B7FJ73_BCL2L2-      ggacccg-------------------------------------------
A0A8B7FJ73_BCL2L2-      ggacccg-------------------------------------------
A0A2K6GWM6_BCL2L2-      ggacccg-------------------------------------------
A0A2K6GWM6_BCL2L2-      ggacccg-------------------------------------------
A0A8C0Q5E6_BCL2L2-      ggacccg-------------------------------------------
A0A8I3MNK9_BCL2L2-      ggacccg-------------------------------------------
A0A8I3RSU6_BCL2L2-      ggacccg-------------------------------------------
A0A667I624_BCL2L2-      ggacccg-------------------------------------------
G1P3J2_BCL2L2-01        gggctgg-------------------------------------------
G3TMU7_BCL2L2-01        gggctgg-------------------------------------------
A0A2K6TM77_BCL2L2-      gggctgg-------------------------------------------
A0A2K6TM77_BCL2L2-      gggctgg-------------------------------------------
A0A2K5CWY6_BCL2L2-      gggctgg-------------------------------------------
A0A2K5CWY6_BCL2L2-      gggctgg-------------------------------------------
A0A2K5CWY6_BCL2L2-      ggacccg-------------------------------------------
U3CRF8_BCL2L2-02        ggacccg-------------------------------------------
U3CRF8_BCL2L2-03        ggacccg-------------------------------------------
A0A2I3GEA7_BCL2L2-      ggacccg-------------------------------------------
A0A8I5U2F2_BCL2L2-      ggacccg-------------------------------------------
A0A2I2YPX6_BCL2L2-      ggacccg-------------------------------------------
A0A2I2YPX6_BCL2L2-      ggacccg-------------------------------------------
U3CRF8_BCL2L2-01        gggctgg-------------------------------------------
A0A2K6TM77_BCL2L2-      --------------------------------------------------
A0A2K6TM77_BCL2L2-      gggctgg-------------------------------------------
A0A2K5V0Q3_BCL2L2-      --------------------------------------------------
A0A2K6EA59_BCL2L2-      ggacccg-------------------------------------------
A0A2K6EA59_BCL2L2-      gggctgg-------------------------------------------
A0A2K5MZX9_BCL2L2-      ggacccg-------------------------------------------
A0A2K5MZX9_BCL2L2-      gggctgg-------------------------------------------
A0A2K5MZX9_BCL2L2-      ggacccg-------------------------------------------
A0A2K5V0Q3_BCL2L2-      --------------------------------------------------
F7G4L5_BCL2L2-03        ggacccg-------------------------------------------
A0A2K6EA59_BCL2L2-      ggacccg-------------------------------------------
A0A2K6AI25_BCL2L2-      --------------------------------------------------
A0A8D2FJU1_BCL2L2-      ggacccg-------------------------------------------
A0A2R9A2Q3_BCL2L2-      gggctgg-------------------------------------------
A0A2R9A2Q3_BCL2L2-      --------------------------------------------------
A0A2K6RW35_BCL2L2-      --------------------------------------------------
A0A2K5HEJ9_BCL2L2-      --------------------------------------------------
A0A2K5HEJ9_BCL2L2-      gggctgg-------------------------------------------
A0A8I5U2F2_BCL2L2-      gggctggttatcccagatcactgaagctgagatggctgatgaagtaattt
A0A2K5CWY6_BCL2L2-      gggctgg-------------------------------------------
A0A8I5U2F2_BCL2L2-      gggctggttatcccagatcactgaagctgagatggctgatgaagtaattt
A0A2K6RW35_BCL2L2-      gggctgg-------------------------------------------
A0A2K6RW35_BCL2L2-      gggctgg-------------------------------------------
A0A2K6ME72_BCL2L2-      gggctgg-------------------------------------------
A0A2R9A2Q3_BCL2L2-      gggctgg-------------------------------------------
A0A2K5MZX9_BCL2L2-      gggctgg-------------------------------------------
A0A2K6EA59_BCL2L2-      gggctgg-------------------------------------------
A0A2K6RW35_BCL2L2-      gggctgg-------------------------------------------
A0A2K6ME72_BCL2L2-      gggctgg-------------------------------------------
A0A8D2FJU1_BCL2L2-      gggctgg-------------------------------------------
A0A8D2FJU1_BCL2L2-      gggctggttatcccagatcactgaagctgagatggctgatgaagtaattt
A0A8C9H679_BCL2L2-      gggctgg-------------------------------------------
A0A8C9H679_BCL2L2-      gggctggttatcccagatcactgaagctgagatggctgatgaagtaattt
A0A2I3MUE4_BCL2L2-      gggctgg-------------------------------------------
A0A2I3GEA7_BCL2L2-      gggctgg-------------------------------------------
A0A2I3GEA7_BCL2L2-      gggctgg-------------------------------------------
A0A2K6AI25_BCL2L2-      gggctgg-------------------------------------------
A0A2K6AI25_BCL2L2-      gggctgg-------------------------------------------
F7G4L5_BCL2L2-02        gggctgg-------------------------------------------
F7G4L5_BCL2L2-01        gggctgg-------------------------------------------
A0A2K5V0Q3_BCL2L2-      gggctggttatcccagatcactgaagctgagatggctgatgaagtaattt
A0A2K5V0Q3_BCL2L2-      gggctgg-------------------------------------------
A0A2K5V0Q3_BCL2L2-      gggctggttatcccagatcactgaagctgagatggctgatgaagtaattt
A0A2K5V0Q3_BCL2L2-      gggctggttatcccagatcactgaagctgagatggctgatgaagtaattt
A0A2K5V0Q3_BCL2L2-      gggctggttatcccagatcactgaagctgagatggctgatgaagtaattt
A0A2K5V0Q3_BCL2L2-      gggctggttatcccagatcactgaagctgagatggctgatgaagtaattt
A0A2K5V0Q3_BCL2L2-      gggctgg-------------------------------------------
G3V4B7_BCL2L2-08        gggctgg-------------------------------------------
G3V4B7_BCL2L2-07        gggctgg-------------------------------------------
G3V4B7_BCL2L2-06        gggctgg-------------------------------------------
G3V4B7_BCL2L2-05        gggctgg-------------------------------------------
G3V4B7_BCL2L2-04        gggctgg-------------------------------------------
G3V4B7_BCL2L2-03        gggctgg-------------------------------------------
G3V4B7_BCL2L2-02        gggctgg-------------------------------------------
A0A2I2YPX6_BCL2L2-      gggctgg-------------------------------------------
A0A2I2YPX6_BCL2L2-      gggctgg-------------------------------------------
A0A2K5HEJ9_BCL2L2-      gggctgg-------------------------------------------
A0A0D9RU30_BCL2L2-      gggctgg-------------------------------------------
G3V4B7_BCL2L2-01        --------------------------------------------------
G3V4B7_BCL2L2-09        --------------------------------------------------
                                                                          

H3AAS7_BCL2L2-02        --------------------------------------------------
H3AAS7_BCL2L2-01        --------------------------------------------------
Q6GP82_BCL2L2-01        --------------------------------------------------
A0A8C5PJB3_BCL2L2-      --------------------------------------------------
A0A4X2LP96_BCL2L2-      --------------------------------------------------
A0A5F8HG85_BCL2L2-      --------------------------------------------------
A0A5F8HG85_BCL2L2-      --------------------------------------------------
A0A5F8HG85_BCL2L2-      --------------------------------------------------
F7G6M3_BCL2L2-01        --------------------------------------------------
G1Q051_BCL2L2-01        --------------------------------------------------
G1TV33_BCL2L2-01        --------------------------------------------------
D3Z5F7_BCL2L2-01        --------------------------------------------------
G3V4B7_BCL2L2-10        --------------------------------------------------
A0A6I9LUT0_BCL2L2-      --------------------------------------------------
A0A8C3X592_BCL2L2-      --------------------------------------------------
A0A3Q9B4M8_BCL2L2-      --------------------------------------------------
A0A7T8CLX7_BCL2L2-      --------------------------------------------------
A0A8D0TJQ9_BCL2L2-      --------------------------------------------------
A0A4X1SF60_BCL2L2-      --------------------------------------------------
A0A4X1SF63_BCL2L2-      --------------------------------------------------
A0A8C0Q5E6_BCL2L2-      --------------------------------------------------
A0A8I3MNK9_BCL2L2-      --------------------------------------------------
A0A8I3RSU6_BCL2L2-      --------------------------------------------------
A0A673VAY7_BCL2L2-      --------------------------------------------------
A0A2I2UAE3_BCL2L2-      --------------------------------------------------
A0A8C8XCR9_BCL2L2-      --------------------------------------------------
A0A8C9J3S1_BCL2L2-      --------------------------------------------------
M3Y5X5_BCL2L2-01        --------------------------------------------------
A0A8C7EW82_BCL2L2-      --------------------------------------------------
A0A452SHI1_BCL2L2-      --------------------------------------------------
A0A384DPS8_BCL2L2-      --------------------------------------------------
A0A8C4LWK5_BCL2L2-      --------------------------------------------------
A0A8C6BK57_BCL2L2-      --------------------------------------------------
A0A8C9CXQ5_BCL2L2-      --------------------------------------------------
A0A8B8WSS7_BCL2L2-      --------------------------------------------------
W5QDH4_BCL2L2-02        --------------------------------------------------
A0A8C6CUC2_BCL2L2-      --------------------------------------------------
A0A452ECF0_BCL2L2-      --------------------------------------------------
A0A4W2D6A3_BCL2L2-      --------------------------------------------------
A0A4W2D6A3_BCL2L2-      --------------------------------------------------
A0A4W2GUJ7_BCL2L2-      --------------------------------------------------
A0A4W2GUJ7_BCL2L2-      --------------------------------------------------
A0A8B9WT05_BCL2L2-      --------------------------------------------------
A0A4W2D6A3_BCL2L2-      --------------------------------------------------
A0A4W2D6A3_BCL2L2-      --------------------------------------------------
A0A4W2GUJ7_BCL2L2-      --------------------------------------------------
A0A4W2GUJ7_BCL2L2-      --------------------------------------------------
Q05KI8_BCL2L2-01        --------------------------------------------------
A0A8C2VJ88_BCL2L2-      --------------------------------------------------
A0A286XQQ9_BCL2L2-      --------------------------------------------------
A0A8C2VJ88_BCL2L2-      --------------------------------------------------
A0A8D2APK0_BCL2L2-      --------------------------------------------------
A0A287D9B3_BCL2L2-      --------------------------------------------------
A0A8D2HGM1_BCL2L2-      --------------------------------------------------
A0A287D9B3_BCL2L2-      --------------------------------------------------
A0A8C9PGU3_BCL2L2-      --------------------------------------------------
W5QDH4_BCL2L2-01        --------------------------------------------------
A0A4W2GUJ7_BCL2L2-      --------------------------------------------------
A0A4W2GUJ7_BCL2L2-      --------------------------------------------------
A0A4W2D6A3_BCL2L2-      --------------------------------------------------
A0A4W2GUJ7_BCL2L2-      --------------------------------------------------
A0A4W2D6A3_BCL2L2-      --------------------------------------------------
A0A4W2GUJ7_BCL2L2-      --------------------------------------------------
A0A4W2GUJ7_BCL2L2-      tcggtgaaattttaagcaactgtgactctgctccaagttctcctgttcct
A0A4W2GUJ7_BCL2L2-      tcggtgaaattttaagcaactgtgactctgctccaagttctcctgttcct
A0A5F5PML6_BCL2L2-      --------------------------------------------------
A0A5F5PML6_BCL2L2-      --------------------------------------------------
A0A8C5L5C6_BCL2L2-      --------------------------------------------------
A0A8C0Q5E6_BCL2L2-      --------------------------------------------------
A0A8I3MNK9_BCL2L2-      --------------------------------------------------
A0A8I3RSU6_BCL2L2-      --------------------------------------------------
A0A8I3MNK9_BCL2L2-      --------------------------------------------------
A0A667I624_BCL2L2-      --------------------------------------------------
G1LKF5_BCL2L2-01        --------------------------------------------------
G1LKF5_BCL2L2-02        --------------------------------------------------
A0A384DPS8_BCL2L2-      --------------------------------------------------
A0A384DPS8_BCL2L2-      --------------------------------------------------
A0A8C6RJE0_BCL2L2-      --------------------------------------------------
A0A671DWB3_BCL2L2-      --------------------------------------------------
A0A250YBR2_BCL2L2-      --------------------------------------------------
A0A250YBR2_BCL2L2-      --------------------------------------------------
O88996_BCL2L2-01        --------------------------------------------------
Q7TS60_BCL2L2-01        --------------------------------------------------
A0A671DWB3_BCL2L2-      --------------------------------------------------
A0A8C6RJE0_BCL2L2-      --------------------------------------------------
A0A4W2D6A3_BCL2L2-      --------------------------------------------------
A0A4W2GUJ7_BCL2L2-      --------------------------------------------------
A0A4W2D6A3_BCL2L2-      --------------------------------------------------
A0A4W2GUJ7_BCL2L2-      --------------------------------------------------
A0A8C8YZD8_BCL2L2-      --------------------------------------------------
A0A8B7FJ73_BCL2L2-      --------------------------------------------------
A0A2K6GWM6_BCL2L2-      --------------------------------------------------
A0A8D0TJQ9_BCL2L2-      --------------------------------------------------
A0A482LX62_BCL2L2-      --------------------------------------------------
A0A4X1SF63_BCL2L2-      --------------------------------------------------
A0A4D6NWN1_BCL2L2-      --------------------------------------------------
A0A4X1SF60_BCL2L2-      --------------------------------------------------
A0A4X1SF63_BCL2L2-      --------------------------------------------------
A0A8D0TJQ9_BCL2L2-      --------------------------------------------------
A0A4X1SF60_BCL2L2-      --------------------------------------------------
A0A8D0TJQ9_BCL2L2-      --------------------------------------------------
H0XR82_BCL2L2-01        --------------------------------------------------
A0A4X1SF63_BCL2L2-      --------------------------------------------------
A0A4X1SF63_BCL2L2-      --------------------------------------------------
A0A8D0TJQ9_BCL2L2-      --------------------------------------------------
A0A8B7FJ73_BCL2L2-      --------------------------------------------------
A0A2K6GWM6_BCL2L2-      --------------------------------------------------
A0A5F5PML6_BCL2L2-      --------------------------------------------------
A0A8C8YZD8_BCL2L2-      --------------------------------------------------
A0A8B7FJ73_BCL2L2-      --------------------------------------------------
A0A8B7FJ73_BCL2L2-      --------------------------------------------------
A0A2K6GWM6_BCL2L2-      --------------------------------------------------
A0A2K6GWM6_BCL2L2-      --------------------------------------------------
A0A8C0Q5E6_BCL2L2-      --------------------------------------------------
A0A8I3MNK9_BCL2L2-      --------------------------------------------------
A0A8I3RSU6_BCL2L2-      --------------------------------------------------
A0A667I624_BCL2L2-      --------------------------------------------------
G1P3J2_BCL2L2-01        --------------------------------------------------
G3TMU7_BCL2L2-01        --------------------------------------------------
A0A2K6TM77_BCL2L2-      --------------------------------------------------
A0A2K6TM77_BCL2L2-      --------------------------------------------------
A0A2K5CWY6_BCL2L2-      --------------------------------------------------
A0A2K5CWY6_BCL2L2-      --------------------------------------------------
A0A2K5CWY6_BCL2L2-      --------------------------------------------------
U3CRF8_BCL2L2-02        --------------------------------------------------
U3CRF8_BCL2L2-03        --------------------------------------------------
A0A2I3GEA7_BCL2L2-      --------------------------------------------------
A0A8I5U2F2_BCL2L2-      --------------------------------------------------
A0A2I2YPX6_BCL2L2-      --------------------------------------------------
A0A2I2YPX6_BCL2L2-      --------------------------------------------------
U3CRF8_BCL2L2-01        --------------------------------------------------
A0A2K6TM77_BCL2L2-      --------------------------------------------------
A0A2K6TM77_BCL2L2-      --------------------------------------------------
A0A2K5V0Q3_BCL2L2-      --------------------------------------------------
A0A2K6EA59_BCL2L2-      --------------------------------------------------
A0A2K6EA59_BCL2L2-      --------------------------------------------------
A0A2K5MZX9_BCL2L2-      --------------------------------------------------
A0A2K5MZX9_BCL2L2-      --------------------------------------------------
A0A2K5MZX9_BCL2L2-      --------------------------------------------------
A0A2K5V0Q3_BCL2L2-      --------------------------------------------------
F7G4L5_BCL2L2-03        --------------------------------------------------
A0A2K6EA59_BCL2L2-      --------------------------------------------------
A0A2K6AI25_BCL2L2-      --------------------------------------------------
A0A8D2FJU1_BCL2L2-      --------------------------------------------------
A0A2R9A2Q3_BCL2L2-      --------------------------------------------------
A0A2R9A2Q3_BCL2L2-      --------------------------------------------------
A0A2K6RW35_BCL2L2-      --------------------------------------------------
A0A2K5HEJ9_BCL2L2-      --------------------------------------------------
A0A2K5HEJ9_BCL2L2-      --------------------------------------------------
A0A8I5U2F2_BCL2L2-      gcagtgaaattttaagcgactgtgactctgctccaagttccccagatcct
A0A2K5CWY6_BCL2L2-      --------------------------------------------------
A0A8I5U2F2_BCL2L2-      gcagtgaaattttaagcgactgtgactctgctccaagttccccagatcct
A0A2K6RW35_BCL2L2-      --------------------------------------------------
A0A2K6RW35_BCL2L2-      --------------------------------------------------
A0A2K6ME72_BCL2L2-      --------------------------------------------------
A0A2R9A2Q3_BCL2L2-      --------------------------------------------------
A0A2K5MZX9_BCL2L2-      --------------------------------------------------
A0A2K6EA59_BCL2L2-      --------------------------------------------------
A0A2K6RW35_BCL2L2-      --------------------------------------------------
A0A2K6ME72_BCL2L2-      --------------------------------------------------
A0A8D2FJU1_BCL2L2-      --------------------------------------------------
A0A8D2FJU1_BCL2L2-      gcagtgaaattttaagcgactgtgactctgctccaagttccccagatctc
A0A8C9H679_BCL2L2-      --------------------------------------------------
A0A8C9H679_BCL2L2-      gcagtgaaattttaagcgactgtgactctgctccaagttccccagatctc
A0A2I3MUE4_BCL2L2-      --------------------------------------------------
A0A2I3GEA7_BCL2L2-      --------------------------------------------------
A0A2I3GEA7_BCL2L2-      --------------------------------------------------
A0A2K6AI25_BCL2L2-      --------------------------------------------------
A0A2K6AI25_BCL2L2-      --------------------------------------------------
F7G4L5_BCL2L2-02        --------------------------------------------------
F7G4L5_BCL2L2-01        --------------------------------------------------
A0A2K5V0Q3_BCL2L2-      gcagtgaaattttaagcgactgtgactctgctccaagttccccagatctc
A0A2K5V0Q3_BCL2L2-      --------------------------------------------------
A0A2K5V0Q3_BCL2L2-      gcagtgaaattttaagcgactgtgactctgctccaagttccccagatctc
A0A2K5V0Q3_BCL2L2-      gcagtgaaattttaagcgactgtgactctgctccaagttccccagatctc
A0A2K5V0Q3_BCL2L2-      gcagtgaaattttaagcgactgtgactctgctccaagttccccagatctc
A0A2K5V0Q3_BCL2L2-      gcagtgaaattttaagcgactgtgactctgctccaagttccccagatctc
A0A2K5V0Q3_BCL2L2-      --------------------------------------------------
G3V4B7_BCL2L2-08        --------------------------------------------------
G3V4B7_BCL2L2-07        --------------------------------------------------
G3V4B7_BCL2L2-06        --------------------------------------------------
G3V4B7_BCL2L2-05        --------------------------------------------------
G3V4B7_BCL2L2-04        --------------------------------------------------
G3V4B7_BCL2L2-03        --------------------------------------------------
G3V4B7_BCL2L2-02        --------------------------------------------------
A0A2I2YPX6_BCL2L2-      --------------------------------------------------
A0A2I2YPX6_BCL2L2-      --------------------------------------------------
A0A2K5HEJ9_BCL2L2-      --------------------------------------------------
A0A0D9RU30_BCL2L2-      --------------------------------------------------
G3V4B7_BCL2L2-01        --------------------------------------------------
G3V4B7_BCL2L2-09        --------------------------------------------------
                                                                          

H3AAS7_BCL2L2-02        agt---------gctttcgtgtg-------tctgtatgggaat----ggt
H3AAS7_BCL2L2-01        agt---------gctttcgtgtg-------tctgtatgggaat----ggt
Q6GP82_BCL2L2-01        aat---------ggatttctaac-------tctatatggggat----ggt
A0A8C5PJB3_BCL2L2-      aat---------ggattcctggc-------tctatatggcgat----ggt
A0A4X2LP96_BCL2L2-      g------cgga----attcacgg-------ctctgtacggg-g----atg
A0A5F8HG85_BCL2L2-      gag---ctggaggccatcaaagc-------ccgagtaagggag----atg
A0A5F8HG85_BCL2L2-      gag---ctggaggccatcaaagc-------ccgagtaagggag----atg
A0A5F8HG85_BCL2L2-      gag---ctggaggccatcaaagc-------ccgagtaagggag----atg
F7G6M3_BCL2L2-01        gcg---------gagttcacggc-------cctgtacggggac----ggg
G1Q051_BCL2L2-01        gca---------gagttcacagc-------tctatacgggaac-------
G1TV33_BCL2L2-01        gcg---------gagttcacagc-------tctgtacggggat----cgg
D3Z5F7_BCL2L2-01        gag---ctagaagcgatcaaagc-------tcgagtcagggag----atg
G3V4B7_BCL2L2-10        gcg---------gagttcacagc-------tctatacggggac----ggg
A0A6I9LUT0_BCL2L2-      gcg---------gagttcacagc-------tctgtacggggac----ggg
A0A8C3X592_BCL2L2-      gcg---------gagttcacagc-------tctatacggggac----ggg
A0A3Q9B4M8_BCL2L2-      gcg---------gagttcacagc-------tctatacggggac----ggg
A0A7T8CLX7_BCL2L2-      gcg---------gagttcacagc-------tctatacggggac----ggg
A0A8D0TJQ9_BCL2L2-      gcg---------gagttcacagc-------tctatacggggac----ggg
A0A4X1SF60_BCL2L2-      gcg---------gagttcacagc-------tctatacggggac----ggg
A0A4X1SF63_BCL2L2-      gcg---------gagttcacagc-------tctatacggggac----ggg
A0A8C0Q5E6_BCL2L2-      gcg---------gagttcacagc-------tctatacggggac----ggg
A0A8I3MNK9_BCL2L2-      gcg---------gagttcacagc-------tctatacggggac----ggg
A0A8I3RSU6_BCL2L2-      gcg---------gagttcacagc-------tctatacggggac----ggg
A0A673VAY7_BCL2L2-      gcg---------gagttcacagc-------tctatacggggac----ggg
A0A2I2UAE3_BCL2L2-      gcg---------gagttcacagc-------tctatacggggac----ggg
A0A8C8XCR9_BCL2L2-      gcg---------gagttcacagc-------tctatacggggac----ggg
A0A8C9J3S1_BCL2L2-      gcg---------gagttcacagc-------tctatacggggac----ggg
M3Y5X5_BCL2L2-01        gcg---------gagttcacagc-------tctatacggggac----ggg
A0A8C7EW82_BCL2L2-      gcg---------gagttcacagc-------tctatacggggac----ggg
A0A452SHI1_BCL2L2-      gcg---------gagttcacagc-------tctatacggggac----ggg
A0A384DPS8_BCL2L2-      gcg---------gagttcacagc-------tctatacggggac----ggg
A0A8C4LWK5_BCL2L2-      gcg---------gagttcacagc-------tctatacggggac----ggg
A0A8C6BK57_BCL2L2-      gcg---------gagttcacagc-------tctatacggggac----ggg
A0A8C9CXQ5_BCL2L2-      gcg---------gagttcacagc-------tctatacggggac----ggg
A0A8B8WSS7_BCL2L2-      gcg---------gagttcacagc-------tctatacggggac----ggg
W5QDH4_BCL2L2-02        gcg---------gagttcacagc-------tctatacggggac----ggg
A0A8C6CUC2_BCL2L2-      gcg---------gagttcacagc-------tctatacggggac----ggg
A0A452ECF0_BCL2L2-      gcg---------gagttcacagc-------tctatacggggac----ggg
A0A4W2D6A3_BCL2L2-      gcg---------gagttcacagc-------tctatacggggac----ggg
A0A4W2D6A3_BCL2L2-      gcg---------gagttcacagc-------tctatacggggac----ggg
A0A4W2GUJ7_BCL2L2-      gcg---------gagttcacagc-------tctatacggggac----ggg
A0A4W2GUJ7_BCL2L2-      gcg---------gagttcacagc-------tctatacggggac----ggg
A0A8B9WT05_BCL2L2-      gcg---------gagttcacagc-------tctatacggggac----ggg
A0A4W2D6A3_BCL2L2-      gcg---------gagttcacagc-------tctatacggggac----ggg
A0A4W2D6A3_BCL2L2-      gcg---------gagttcacagc-------tctatacggggac----ggg
A0A4W2GUJ7_BCL2L2-      gcg---------gagttcacagc-------tctatacggggac----ggg
A0A4W2GUJ7_BCL2L2-      gcg---------gagttcacagc-------tctatacggggac----ggg
Q05KI8_BCL2L2-01        gcg---------gagttcacagc-------tctatacggggtc----ggg
A0A8C2VJ88_BCL2L2-      cc--------------------c-------tctgca--------------
A0A286XQQ9_BCL2L2-      gcg---------gagttcacagc-------tctatacggggac----ggg
A0A8C2VJ88_BCL2L2-      gcg---------gagttcacagc-------tctatacggggac----ggg
A0A8D2APK0_BCL2L2-      gcg---------gagttcacagc-------tctatacggggac----ggg
A0A287D9B3_BCL2L2-      -------------------ctgt-------tctccagggggaatatgggg
A0A8D2HGM1_BCL2L2-      gcg---------gagttcacagc-------tctatacggggac----ggg
A0A287D9B3_BCL2L2-      gcg---------gagttcacagc-------tctatacggggac----ggg
A0A8C9PGU3_BCL2L2-      gcg---------gagttcacagc-------tctatacggggac----ggg
W5QDH4_BCL2L2-01        --ggagctggaagcgatcaaagc-------tcgagttagggag----atg
A0A4W2GUJ7_BCL2L2-      --ggagctggaagcgatcaaagc-------tcgagttagggag----atg
A0A4W2GUJ7_BCL2L2-      --ggagctggaagcgatcaaagc-------tcgagttagggag----atg
A0A4W2D6A3_BCL2L2-      --ggagctggaagcgatcaaagc-------tcgagttagggag----atg
A0A4W2GUJ7_BCL2L2-      --ggagctggaagcgatcaaagc-------tcgagttagggag----atg
A0A4W2D6A3_BCL2L2-      --ggagctggaagcgatcaaagc-------tcgagttagggag----atg
A0A4W2GUJ7_BCL2L2-      --ggagctggaagcgatcaaagc-------tcgagttagggag----atg
A0A4W2GUJ7_BCL2L2-      gaggagctggaagcgatcaaagc-------tcgagttagggag----atg
A0A4W2GUJ7_BCL2L2-      gaggagctggaagcgatcaaagc-------tcgagttagggag----atg
A0A5F5PML6_BCL2L2-      gag---ctggaagcgatcaaagc-------tcgagtcagggag----atg
A0A5F5PML6_BCL2L2-      gag---ctggaagcgatcaaagc-------tcgagtcagggag----atg
A0A8C5L5C6_BCL2L2-      gcg---------gagttcacagc-------tctatacggggac----ggg
A0A8C0Q5E6_BCL2L2-      gag---ctggaagcgatcaaagc-------tcgagtcagggag----atg
A0A8I3MNK9_BCL2L2-      gag---ctggaagcgatcaaagc-------tcgagtcagggag----atg
A0A8I3RSU6_BCL2L2-      gag---ctggaagcgatcaaagc-------tcgagtcagggag----atg
A0A8I3MNK9_BCL2L2-      gag---ctggaagcgatcaaagc-------tcgagtcagggag----atg
A0A667I624_BCL2L2-      gag---ctggaagcgatcaaagc-------tcgagtcagggag----atg
G1LKF5_BCL2L2-01        gag---ctggaagcgatcaaagc-------tcgagtcagggag----atg
G1LKF5_BCL2L2-02        gag---ctggaagcgatcaaagc-------tcgagtcagggag----atg
A0A384DPS8_BCL2L2-      gag---ctggaagcgatcaaagc-------tcgagtcagggag----atg
A0A384DPS8_BCL2L2-      gag---ctggaagcgatcaaagc-------tcgagtcagggag----atg
A0A8C6RJE0_BCL2L2-      gag---ctagaagcgatcaaagc-------tcgagtcagggag----atg
A0A671DWB3_BCL2L2-      gag---ctggaagcgattaaagc-------gcgagtcagggag----atg
A0A250YBR2_BCL2L2-      gcg---------gagttcacagc-------tctgtacggggac----ggg
A0A250YBR2_BCL2L2-      gcg---------gagttcacagc-------tctgtacggggac----ggg
O88996_BCL2L2-01        gcg---------gagttcacagc-------tctatacggggac----ggg
Q7TS60_BCL2L2-01        gcg---------gagttcacagc-------tctatacggggac----ggg
A0A671DWB3_BCL2L2-      gag---ctggaagcgattaaagc-------gcgagtcagggag----atg
A0A8C6RJE0_BCL2L2-      gcg---------gagttcacagc-------tctatacggggac----ggg
A0A4W2D6A3_BCL2L2-      gag---ctggaagcgatcaaagc-------tcgagttagggag----atg
A0A4W2GUJ7_BCL2L2-      gag---ctggaagcgatcaaagc-------tcgagttagggag----atg
A0A4W2D6A3_BCL2L2-      gag---ctggaagcgatcaaagc-------tcgagttagggag----atg
A0A4W2GUJ7_BCL2L2-      gag---ctggaagcgatcaaagc-------tcgagttagggag----atg
A0A8C8YZD8_BCL2L2-      gag---ctggaagccatcaaagc-------tcgggtcagggag----atg
A0A8B7FJ73_BCL2L2-      gag---ctggaagctatcaaagc-------tcgggtcagggag----atg
A0A2K6GWM6_BCL2L2-      gag---ctggaagccatcaaagc-------tcgggtcagggag----atg
A0A8D0TJQ9_BCL2L2-      gta--------------caaagtgt-----tctaaaagtgaac----caa
A0A482LX62_BCL2L2-      ------------------------------ttcacccaggtct----ctg
A0A4X1SF63_BCL2L2-      gag---ctggaagcgatcaaagc-------tcgagtcagggag----atg
A0A4D6NWN1_BCL2L2-      gag---ctggaagcgatcaaagc-------tcgagtcagggag----atg
A0A4X1SF60_BCL2L2-      gag---ctggaagcgatcaaagc-------tcgagtcagggag----atg
A0A4X1SF63_BCL2L2-      gag---ctggaagcgatcaaagc-------tcgagtcagggag----atg
A0A8D0TJQ9_BCL2L2-      gag---ctggaagcgatcaaagc-------tcgagtcagggag----atg
A0A4X1SF60_BCL2L2-      gag---ctggaagcgatcaaagc-------tcgagtcagggag----atg
A0A8D0TJQ9_BCL2L2-      gag---ctggaagcgatcaaagc-------tcgagtcagggag----atg
H0XR82_BCL2L2-01        gcg---------gagttcacagc-------tctatacggggac----ggg
A0A4X1SF63_BCL2L2-      gag---ctggaagcgatcaaagc-------tcgagtcagggag----atg
A0A4X1SF63_BCL2L2-      gag---ctggaagcgatcaaagc-------tcgagtcagggag----atg
A0A8D0TJQ9_BCL2L2-      gag---ctggaagcgatcaaagc-------tcgagtcagggag----atg
A0A8B7FJ73_BCL2L2-      gcg---------gagttcacagc-------tctatacggggac----ggg
A0A2K6GWM6_BCL2L2-      gcg---------gagttcacagc-------tctatacggggac----ggg
A0A5F5PML6_BCL2L2-      gag---ctggaagcgatcaaagc-------tcgagtcagggag----atg
A0A8C8YZD8_BCL2L2-      gag---ctggaagccatcaaagc-------tcgggtcagggag----atg
A0A8B7FJ73_BCL2L2-      gag---ctggaagctatcaaagc-------tcgggtcagggag----atg
A0A8B7FJ73_BCL2L2-      gag---ctggaagctatcaaagc-------tcgggtcagggag----atg
A0A2K6GWM6_BCL2L2-      gag---ctggaagccatcaaagc-------tcgggtcagggag----atg
A0A2K6GWM6_BCL2L2-      gag---ctggaagccatcaaagc-------tcgggtcagggag----atg
A0A8C0Q5E6_BCL2L2-      gag---ctggaagcgatcaaagc-------tcgagtcagggag----atg
A0A8I3MNK9_BCL2L2-      gag---ctggaagcgatcaaagc-------tcgagtcagggag----atg
A0A8I3RSU6_BCL2L2-      gag---ctggaagcgatcaaagc-------tcgagtcagggag----atg
A0A667I624_BCL2L2-      gag---ctggaagcgatcaaagc-------tcgagtcagggag----atg
G1P3J2_BCL2L2-01        gcg---------gagttcacagc-------tctatacggggac----ggg
G3TMU7_BCL2L2-01        gcg---------gagttcacagc-------tctatacggggac----ggg
A0A2K6TM77_BCL2L2-      gcg---------gagttcacagc-------tctatacggggac----ggg
A0A2K6TM77_BCL2L2-      gcg---------gagttcacagc-------tctatacggggac----ggg
A0A2K5CWY6_BCL2L2-      gcg---------gagttcacagc-------tctatacggggac----ggg
A0A2K5CWY6_BCL2L2-      gcg---------gagttcacagc-------tctatacggggac----ggg
A0A2K5CWY6_BCL2L2-      gag---ctggaagctatcaaagc-------tcgagtcagggag----atg
U3CRF8_BCL2L2-02        gag---ctggaagctatcaaagc-------tcgagtcagggag----atg
U3CRF8_BCL2L2-03        gag---ctggaagctatcaaagc-------tcgagtcagggag----atg
A0A2I3GEA7_BCL2L2-      gag---ctggaagctatcaaagc-------tcgagtcagggag----atg
A0A8I5U2F2_BCL2L2-      gag---ctggaagctatcaaagc-------tcgagtcagggag----atg
A0A2I2YPX6_BCL2L2-      gag---ctggaagctatcaaagc-------tcgagtcagggag----atg
A0A2I2YPX6_BCL2L2-      gag---ctggaagctatcaaagc-------tcgagtcagggag----atg
U3CRF8_BCL2L2-01        gag---ctggaagctatcaaagc-------tcgagtcagggag----atg
A0A2K6TM77_BCL2L2-      -----------------------------------------------atg
A0A2K6TM77_BCL2L2-      gag---ctggaagctatcaaagc-------tcgagtcagggag----atg
A0A2K5V0Q3_BCL2L2-      -----------------------------------------------atg
A0A2K6EA59_BCL2L2-      gag---ctggaagctatcaaagc-------tcgagtcagggag----atg
A0A2K6EA59_BCL2L2-      gag---ctggaagctatcaaagc-------tcgagtcagggag----atg
A0A2K5MZX9_BCL2L2-      gag---ctggaagctatcaaagc-------tcgagtcagggag----atg
A0A2K5MZX9_BCL2L2-      gag---ctggaagctatcaaagc-------tcgagtcagggag----atg
A0A2K5MZX9_BCL2L2-      gag---ctggaagctatcaaagc-------tcgagtcagggag----atg
A0A2K5V0Q3_BCL2L2-      --------------------------------------------------
F7G4L5_BCL2L2-03        gag---ctggaagctatcaaagc-------tcgagtcagggag----atg
A0A2K6EA59_BCL2L2-      gag---ctggaagctatcaaagc-------tcgagtcagggag----atg
A0A2K6AI25_BCL2L2-      -----------------------------------------------atg
A0A8D2FJU1_BCL2L2-      gag---ctggaagctatcaaagc-------tcgagtcagggag----atg
A0A2R9A2Q3_BCL2L2-      gag---ctggaagctatcaaagc-------tcgagtcagggag----atg
A0A2R9A2Q3_BCL2L2-      -----------------------------------------------atg
A0A2K6RW35_BCL2L2-      -----------------------------------------------atg
A0A2K5HEJ9_BCL2L2-      -----------------------------------------------atg
A0A2K5HEJ9_BCL2L2-      gag---ctggaagctatcaaagc-------tcgagtcagggag----atg
A0A8I5U2F2_BCL2L2-      gag----------------caac---------------------------
A0A2K5CWY6_BCL2L2-      gag---ctggaagctatcaaagc-------tcgagtcagggag----atg
A0A8I5U2F2_BCL2L2-      gaggagctggaagctatcaaagc-------tcgagtcagggag----atg
A0A2K6RW35_BCL2L2-      gcg---------gagttcacagc-------tctatacggggac----ggg
A0A2K6RW35_BCL2L2-      gcg---------gagttcacagc-------tctatacggggac----ggg
A0A2K6ME72_BCL2L2-      gcg---------gagttcacagc-------tctatacggggac----ggg
A0A2R9A2Q3_BCL2L2-      gcg---------gagttcacagc-------tctatacggggac----ggg
A0A2K5MZX9_BCL2L2-      gcg---------gagttcacagc-------tctatacggggac----ggg
A0A2K6EA59_BCL2L2-      gcg---------gagttcacagc-------tctatacggggac----ggg
A0A2K6RW35_BCL2L2-      gag---ctggaagctatcaaagc-------tcgagtcagggag----atg
A0A2K6ME72_BCL2L2-      gag---ctggaagctatcaaagc-------tcgagtcagggag----atg
A0A8D2FJU1_BCL2L2-      gcg---------gagttcacagc-------tctatacggggac----ggg
A0A8D2FJU1_BCL2L2-      gaggagctggaagctatcaaagc-------tcgagtcagggag----atg
A0A8C9H679_BCL2L2-      gcg---------gagttcacagc-------tctatacggggac----ggg
A0A8C9H679_BCL2L2-      gag-----------------------------------------------
A0A2I3MUE4_BCL2L2-      gcg---------gagttcacagc-------tctatacggggac----ggg
A0A2I3GEA7_BCL2L2-      gcg---------gagttcacagc-------tctatacggggac----ggg
A0A2I3GEA7_BCL2L2-      gag---ctggaagctatcaaagc-------tcgagtcagggag----atg
A0A2K6AI25_BCL2L2-      gag---ctggaagctatcaaagc-------tcgagtcagggag----atg
A0A2K6AI25_BCL2L2-      gcg---------gagttcacagc-------tctatacggggac----ggg
F7G4L5_BCL2L2-02        gag---ctggaagctatcaaagc-------tcgagtcagggag----atg
F7G4L5_BCL2L2-01        gcg---------gagttcacagc-------tctatacggggac----ggg
A0A2K5V0Q3_BCL2L2-      gag------------tttgaagccgggcagtccgttcgggggc----aag
A0A2K5V0Q3_BCL2L2-      ---gagctggaagctatcaaagc-------tcgagtcagggag----atg
A0A2K5V0Q3_BCL2L2-      gaggagctggaagctatcaaagc-------tcgagtcagggag----atg
A0A2K5V0Q3_BCL2L2-      gaggagctggaagctatcaaagc-------tcgagtcagggag----atg
A0A2K5V0Q3_BCL2L2-      gaggagctggaagctatcaaagc-------tcgagtcagggag----atg
A0A2K5V0Q3_BCL2L2-      gaggagctggaagctatcaaagc-------tcgagtcagggag----atg
A0A2K5V0Q3_BCL2L2-      gcg---------gagttcacagc-------tctatacggggac----ggg
G3V4B7_BCL2L2-08        gcg---------gagttcacagc-------tctatacggggac----ggg
G3V4B7_BCL2L2-07        gtaagaagcttctcaattgccgc-------tctgca--------------
G3V4B7_BCL2L2-06        gcg---------gagttcacagc-------tctatacggggac----ggg
G3V4B7_BCL2L2-05        gcg---------gagttcacagc-------tctatacggggac----ggg
G3V4B7_BCL2L2-04        gtatggag---cacactcttcac-------cctaccc-------------
G3V4B7_BCL2L2-03        gcg---------gagttcacagc-------tctatacggggac----ggg
G3V4B7_BCL2L2-02        gcg---------gagttcacagc-------tctatacggggac----ggg
A0A2I2YPX6_BCL2L2-      gcg---------gagttcacagc-------tctatacggggac----ggg
A0A2I2YPX6_BCL2L2-      gagctgga---agctatcaaagc-------tcgagtcagggag----atg
A0A2K5HEJ9_BCL2L2-      gcg---------gagttcacagc-------tctatacggggac----ggg
A0A0D9RU30_BCL2L2-      gcg---------gagttcacagc-------tctatacggggac----ggg
G3V4B7_BCL2L2-01        --------------------------------------------------
G3V4B7_BCL2L2-09        --------------------------------------------------
                                                                          

H3AAS7_BCL2L2-02        g-------------------------------------------------
H3AAS7_BCL2L2-01        g-------------------------------------------------
Q6GP82_BCL2L2-01        g-------------------------------------------------
A0A8C5PJB3_BCL2L2-      g-------------------------------------------------
A0A4X2LP96_BCL2L2-      gggccctggaggaggcaaggcgtctgcggga-----------------gg
A0A5F8HG85_BCL2L2-      ga-----ggaagaggcagagaaattgaaggagcttcagaacgag-gtgga
A0A5F8HG85_BCL2L2-      ga-----ggaagaggcagagaaattgaaggagcttcagaacgag-gtgga
A0A5F8HG85_BCL2L2-      ga-----ggaagaggcagagaaattgaaggagcttcagaacgag-gtgga
F7G6M3_BCL2L2-01        g-------------------------------------------------
G1Q051_BCL2L2-01        --------------------------------------------------
G1TV33_BCL2L2-01        g-------------------------------------------------
D3Z5F7_BCL2L2-01        ga-----ggaagaggctgagaagctaaaggagctacaaaacgag-gtaga
G3V4B7_BCL2L2-10        g-------------------------------------------------
A0A6I9LUT0_BCL2L2-      g-------------------------------------------------
A0A8C3X592_BCL2L2-      g-------------------------------------------------
A0A3Q9B4M8_BCL2L2-      g-------------------------------------------------
A0A7T8CLX7_BCL2L2-      g-------------------------------------------------
A0A8D0TJQ9_BCL2L2-      g-------------------------------------------------
A0A4X1SF60_BCL2L2-      g-------------------------------------------------
A0A4X1SF63_BCL2L2-      g-------------------------------------------------
A0A8C0Q5E6_BCL2L2-      g-------------------------------------------------
A0A8I3MNK9_BCL2L2-      g-------------------------------------------------
A0A8I3RSU6_BCL2L2-      g-------------------------------------------------
A0A673VAY7_BCL2L2-      g-------------------------------------------------
A0A2I2UAE3_BCL2L2-      g-------------------------------------------------
A0A8C8XCR9_BCL2L2-      g-------------------------------------------------
A0A8C9J3S1_BCL2L2-      g-------------------------------------------------
M3Y5X5_BCL2L2-01        g-------------------------------------------------
A0A8C7EW82_BCL2L2-      g-------------------------------------------------
A0A452SHI1_BCL2L2-      g-------------------------------------------------
A0A384DPS8_BCL2L2-      g-------------------------------------------------
A0A8C4LWK5_BCL2L2-      g-------------------------------------------------
A0A8C6BK57_BCL2L2-      g-------------------------------------------------
A0A8C9CXQ5_BCL2L2-      g-------------------------------------------------
A0A8B8WSS7_BCL2L2-      g-------------------------------------------------
W5QDH4_BCL2L2-02        g-------------------------------------------------
A0A8C6CUC2_BCL2L2-      g-------------------------------------------------
A0A452ECF0_BCL2L2-      g-------------------------------------------------
A0A4W2D6A3_BCL2L2-      g-------------------------------------------------
A0A4W2D6A3_BCL2L2-      g-------------------------------------------------
A0A4W2GUJ7_BCL2L2-      g-------------------------------------------------
A0A4W2GUJ7_BCL2L2-      g-------------------------------------------------
A0A8B9WT05_BCL2L2-      g-------------------------------------------------
A0A4W2D6A3_BCL2L2-      g-------------------------------------------------
A0A4W2D6A3_BCL2L2-      g-------------------------------------------------
A0A4W2GUJ7_BCL2L2-      g-------------------------------------------------
A0A4W2GUJ7_BCL2L2-      g-------------------------------------------------
Q05KI8_BCL2L2-01        g-------------------------------------------------
A0A8C2VJ88_BCL2L2-      --------------------------------------------------
A0A286XQQ9_BCL2L2-      g-------------------------------------------------
A0A8C2VJ88_BCL2L2-      g-------------------------------------------------
A0A8D2APK0_BCL2L2-      g-------------------------------------------------
A0A287D9B3_BCL2L2-      g-------------------------------------------------
A0A8D2HGM1_BCL2L2-      g-------------------------------------------------
A0A287D9B3_BCL2L2-      g-------------------------------------------------
A0A8C9PGU3_BCL2L2-      g-------------------------------------------------
W5QDH4_BCL2L2-01        ga-----ggaagaagctgagaagctaaaggagctacagaacgag-gtaga
A0A4W2GUJ7_BCL2L2-      ga-----ggaagaagctgagaagctaaaggagctacagaacgag-gtaga
A0A4W2GUJ7_BCL2L2-      ga-----ggaagaagctgagaagctaaaggagctacagaacgag-gtaga
A0A4W2D6A3_BCL2L2-      ga-----ggaagaagctgagaagctaaaggagctacagaacgag-gtaga
A0A4W2GUJ7_BCL2L2-      ga-----ggaagaagctgagaagctaaaggagctacagaacgag-gtaga
A0A4W2D6A3_BCL2L2-      ga-----ggaagaagctgagaagctaaaggagctacagaacgag-gtaga
A0A4W2GUJ7_BCL2L2-      ga-----ggaagaagctgagaagctaaaggagctacagaacgag-gtaga
A0A4W2GUJ7_BCL2L2-      ga-----ggaagaagctgagaagctaaaggagctacagaacgag-gtaga
A0A4W2GUJ7_BCL2L2-      ga-----ggaagaagctgagaagctaaaggagctacagaacgag-gtaga
A0A5F5PML6_BCL2L2-      ga-----ggaagaggctgagaagctaaaagagctacagaacgag-gttga
A0A5F5PML6_BCL2L2-      ga-----ggaagaggctgagaagctaaaagagctacagaacgag-gttga
A0A8C5L5C6_BCL2L2-      g-------------------------------------------------
A0A8C0Q5E6_BCL2L2-      ga-----ggaagaagctgagaagttaaaggagctacagaacgag-gtaga
A0A8I3MNK9_BCL2L2-      ga-----ggaagaagctgagaagttaaaggagctacagaacgag-gtaga
A0A8I3RSU6_BCL2L2-      ga-----ggaagaagctgagaagttaaaggagctacagaacgag-gtaga
A0A8I3MNK9_BCL2L2-      ga-----ggaagaagctgagaagttaaaggagctacagaacgag-gtaga
A0A667I624_BCL2L2-      ga-----ggaagaagccgagaagctaaaggagctacagaacgag-gtaga
G1LKF5_BCL2L2-01        ga-----ggaagaagctgagaagctaaaggagctacagaacgag-gtaga
G1LKF5_BCL2L2-02        ga-----ggaagaagctgagaagctaaaggagctacagaacgag-gtaga
A0A384DPS8_BCL2L2-      ga-----ggaagaagctgagaagctaaaggagctacagaacgag-gtaga
A0A384DPS8_BCL2L2-      ga-----ggaagaagctgagaagctaaaggagctacagaacgag-gtaga
A0A8C6RJE0_BCL2L2-      ga-----ggaagaggccgagaagctaaaggagctacagaacgag-gtgga
A0A671DWB3_BCL2L2-      ga-----ggaagaagctgaaaagctaaaggagctacagaacgag-gtaga
A0A250YBR2_BCL2L2-      g-------------------------------------------------
A0A250YBR2_BCL2L2-      g-------------------------------------------------
O88996_BCL2L2-01        g-------------------------------------------------
Q7TS60_BCL2L2-01        g-------------------------------------------------
A0A671DWB3_BCL2L2-      ga-----ggaagaagctgaaaagctaaaggagctacagaacgag-gtaga
A0A8C6RJE0_BCL2L2-      g-------------------------------------------------
A0A4W2D6A3_BCL2L2-      ga-----ggaagaagctgagaagctaaaggagctacagaacgag-gtaga
A0A4W2GUJ7_BCL2L2-      ga-----ggaagaagctgagaagctaaaggagctacagaacgag-gtaga
A0A4W2D6A3_BCL2L2-      ga-----ggaagaagctgagaagctaaaggagctacagaacgag-gtaga
A0A4W2GUJ7_BCL2L2-      ga-----ggaagaagctgagaagctaaaggagctacagaacgag-gtaga
A0A8C8YZD8_BCL2L2-      ga-----ggaagaagctgagaagctaaaggagctacagaacgag-gtaga
A0A8B7FJ73_BCL2L2-      ga-----ggaagaagctgagaagctaaaagagctacagaacgag-gtaga
A0A2K6GWM6_BCL2L2-      ga-----ggaagaagctgagaagttaaaagagctacagaacgag-gtaga
A0A8D0TJQ9_BCL2L2-      g-------------------------------------------------
A0A482LX62_BCL2L2-      at-----gaactcttccaaggag---------------------------
A0A4X1SF63_BCL2L2-      ga-----ggaagaagctgagaagctaaaggagctacagaacgaa-gtaga
A0A4D6NWN1_BCL2L2-      ga-----ggaagaagctgagaagctaaaggagctacagaacgaa-gtaga
A0A4X1SF60_BCL2L2-      ga-----ggaagaagctgagaagctaaaggagctacagaacgaa-gtaga
A0A4X1SF63_BCL2L2-      ga-----ggaagaagctgagaagctaaaggagctacagaacgaa-gtaga
A0A8D0TJQ9_BCL2L2-      ga-----ggaagaagctgagaagctaaaggagctacagaacgaa-gtaga
A0A4X1SF60_BCL2L2-      ga-----ggaagaagctgagaagctaaaggagctacagaacgaa-gtaga
A0A8D0TJQ9_BCL2L2-      ga-----ggaagaagctgagaagctaaaggagctacagaacgaa-gtaga
H0XR82_BCL2L2-01        g-------------------------------------------------
A0A4X1SF63_BCL2L2-      ga-----ggaagaagctgagaagctaaaggagctacagaacgaa-gtaga
A0A4X1SF63_BCL2L2-      ga-----ggaagaagctgagaagctaaaggagctacagaacgaa-gtaga
A0A8D0TJQ9_BCL2L2-      ga-----ggaagaagctgagaagctaaaggagctacagaacgaa-gtaga
A0A8B7FJ73_BCL2L2-      g-------------------------------------------------
A0A2K6GWM6_BCL2L2-      g-------------------------------------------------
A0A5F5PML6_BCL2L2-      ga-----ggaagaggctgagaagctaaaagagctacagaacgag-gttga
A0A8C8YZD8_BCL2L2-      ga-----ggaagaagctgagaagctaaaggagctacagaacgag-gtaga
A0A8B7FJ73_BCL2L2-      ga-----ggaagaagctgagaagctaaaagagctacagaacgag-gtaga
A0A8B7FJ73_BCL2L2-      ga-----ggaagaagctgagaagctaaaagagctacagaacgag-gtaga
A0A2K6GWM6_BCL2L2-      ga-----ggaagaagctgagaagttaaaagagctacagaacgag-gtaga
A0A2K6GWM6_BCL2L2-      ga-----ggaagaagctgagaagttaaaagagctacagaacgag-gtaga
A0A8C0Q5E6_BCL2L2-      ga-----ggaagaagctgagaagttaaaggagctacagaacgag-gtaga
A0A8I3MNK9_BCL2L2-      ga-----ggaagaagctgagaagttaaaggagctacagaacgag-gtaga
A0A8I3RSU6_BCL2L2-      ga-----ggaagaagctgagaagttaaaggagctacagaacgag-gtaga
A0A667I624_BCL2L2-      ga-----ggaagaagccgagaagctaaaggagctacagaacgag-gtaga
G1P3J2_BCL2L2-01        g-------------------------------------------------
G3TMU7_BCL2L2-01        g-------------------------------------------------
A0A2K6TM77_BCL2L2-      g-------------------------------------------------
A0A2K6TM77_BCL2L2-      g-------------------------------------------------
A0A2K5CWY6_BCL2L2-      g-------------------------------------------------
A0A2K5CWY6_BCL2L2-      g-------------------------------------------------
A0A2K5CWY6_BCL2L2-      ga-----ggaagaagctgagaagctaaaagaactacagaacgag-gtaga
U3CRF8_BCL2L2-02        ga-----ggaagaagctgagaagctaaaggaactacagaacgag-gtaga
U3CRF8_BCL2L2-03        ga-----ggaagaagctgagaagctaaaggaactacagaacgag-gtaga
A0A2I3GEA7_BCL2L2-      ga-----ggaagaagctgagaagctaaaggagctacagaacgag-gtaga
A0A8I5U2F2_BCL2L2-      ga-----ggaagaagccgagaagctaaaggagctacagaacgag-gtaga
A0A2I2YPX6_BCL2L2-      ga-----ggaagaagctgagaagctaaaggagctacagaacgag-gtaga
A0A2I2YPX6_BCL2L2-      ga-----ggaagaagctgagaagctaaaggagctacagaacgag-gtaga
U3CRF8_BCL2L2-01        ga-----ggaagaagctgagaagctaaaggaactacagaacgag-gtaga
A0A2K6TM77_BCL2L2-      ga-----ggaagaagctgagaagctaaaggaactacagaacgag-gtaga
A0A2K6TM77_BCL2L2-      ga-----ggaagaagctgagaagctaaaggaactacagaacgag-gtaga
A0A2K5V0Q3_BCL2L2-      ga-----ggaagaagctgagaagctaaaggagctacagaacgag-gtaga
A0A2K6EA59_BCL2L2-      ga-----ggaagaagctgagaagctaaaggagctacagaacgag-gtaga
A0A2K6EA59_BCL2L2-      ga-----ggaagaagctgagaagctaaaggagctacagaacgag-gtaga
A0A2K5MZX9_BCL2L2-      ga-----ggaagaagctgagaagctaaaggagctacagaacgag-gtaga
A0A2K5MZX9_BCL2L2-      ga-----ggaagaagctgagaagctaaaggagctacagaacgag-gtaga
A0A2K5MZX9_BCL2L2-      ga-----ggaagaagctgagaagctaaaggagctacagaacgag-gtaga
A0A2K5V0Q3_BCL2L2-      --------------------------------------------------
F7G4L5_BCL2L2-03        ga-----ggaagaagctgagaagctaaaggagctacagaacgag-gtaga
A0A2K6EA59_BCL2L2-      ga-----ggaagaagctgagaagctaaaggagctacagaacgag-gtaga
A0A2K6AI25_BCL2L2-      ga-----ggaagaagctgagaagctaaaggagctacagaacgag-gtaga
A0A8D2FJU1_BCL2L2-      ga-----ggaagaagctgagaagctaaaggagctacagaacgag-gtaga
A0A2R9A2Q3_BCL2L2-      ga-----ggaagaagctgagaagctaaaggagctacagaacgag-gtaga
A0A2R9A2Q3_BCL2L2-      ga-----ggaagaagctgagaagctaaaggagctacagaacgag-gtaga
A0A2K6RW35_BCL2L2-      ga-----ggaagaagctgagaagctaaaggagctacagaacgag-gtaga
A0A2K5HEJ9_BCL2L2-      ga-----ggaagaagctgagaagctaaaggagctacagaacgag-gtaga
A0A2K5HEJ9_BCL2L2-      ga-----ggaagaagctgagaagctaaaggagctacagaacgag-gtaga
A0A8I5U2F2_BCL2L2-      --------------------------------------------------
A0A2K5CWY6_BCL2L2-      ga-----ggaagaagctgagaagctaaaagaactacagaacgag-gtaga
A0A8I5U2F2_BCL2L2-      ga-----ggaagaagccgagaagctaaaggagctacagaacgag-gtaga
A0A2K6RW35_BCL2L2-      g-------------------------------------------------
A0A2K6RW35_BCL2L2-      g-------------------------------------------------
A0A2K6ME72_BCL2L2-      g-------------------------------------------------
A0A2R9A2Q3_BCL2L2-      g-------------------------------------------------
A0A2K5MZX9_BCL2L2-      g-------------------------------------------------
A0A2K6EA59_BCL2L2-      g-------------------------------------------------
A0A2K6RW35_BCL2L2-      ga-----ggaagaagctgagaagctaaaggagctacagaacgag-gtaga
A0A2K6ME72_BCL2L2-      ga-----ggaagaagctgagaagctaaaggagctacagaacgag-gtaga
A0A8D2FJU1_BCL2L2-      g-------------------------------------------------
A0A8D2FJU1_BCL2L2-      ga-----ggaagaagctgagaagctaaaggagctacagaacgag-gtaga
A0A8C9H679_BCL2L2-      g-------------------------------------------------
A0A8C9H679_BCL2L2-      --------------------------------------------------
A0A2I3MUE4_BCL2L2-      g-------------------------------------------------
A0A2I3GEA7_BCL2L2-      g-------------------------------------------------
A0A2I3GEA7_BCL2L2-      ga-----ggaagaagctgagaagctaaaggagctacagaacgag-gtaga
A0A2K6AI25_BCL2L2-      ga-----ggaagaagctgagaagctaaaggagctacagaacgag-gtaga
A0A2K6AI25_BCL2L2-      g-------------------------------------------------
F7G4L5_BCL2L2-02        ga-----ggaagaagctgagaagctaaaggagctacagaacgag-gtaga
F7G4L5_BCL2L2-01        g-------------------------------------------------
A0A2K5V0Q3_BCL2L2-      g-----------------------ttcacctgtcacgaaacgagtgtcac
A0A2K5V0Q3_BCL2L2-      ga-----ggaagaagctgagaagctaaaggagctacagaacgag-gtaga
A0A2K5V0Q3_BCL2L2-      ga-----ggaagaagctgagaagctaaaggagctacagaacgag-gtaga
A0A2K5V0Q3_BCL2L2-      ga-----ggaagaagctgagaagctaaaggagctacagaacgag-gtaga
A0A2K5V0Q3_BCL2L2-      ga-----ggaagaagctgagaagctaaaggagctacagaacgag-gtaga
A0A2K5V0Q3_BCL2L2-      ga-----ggaagaagctgagaagctaaaggagctacagaacgag-gtaga
A0A2K5V0Q3_BCL2L2-      g-------------------------------------------------
G3V4B7_BCL2L2-08        g-------------------------------------------------
G3V4B7_BCL2L2-07        --------------------------------------------------
G3V4B7_BCL2L2-06        g-------------------------------------------------
G3V4B7_BCL2L2-05        g-------------------------------------------------
G3V4B7_BCL2L2-04        --------------------------------------------------
G3V4B7_BCL2L2-03        g-------------------------------------------------
G3V4B7_BCL2L2-02        g-------------------------------------------------
A0A2I2YPX6_BCL2L2-      g-------------------------------------------------
A0A2I2YPX6_BCL2L2-      ga-----ggaagaagctgagaagctaaaggagctacagaacgag-gtaga
A0A2K5HEJ9_BCL2L2-      g-------------------------------------------------
A0A0D9RU30_BCL2L2-      g-------------------------------------------------
G3V4B7_BCL2L2-01        --------------------------------------------------
G3V4B7_BCL2L2-09        --------------------------------------------------
                                                                          

H3AAS7_BCL2L2-02        ---------------------------------cagtgggcggagccagg
H3AAS7_BCL2L2-01        ---------------------------------cagtgggcggagccagg
Q6GP82_BCL2L2-01        ---------------------------------ccatagaagaagccagg
A0A8C5PJB3_BCL2L2-      ---------------------------------ctatagaagaggctcga
A0A4X2LP96_BCL2L2-      ggaac---tgggcctcagt------gcgaacagtgctaac----------
A0A5F8HG85_BCL2L2-      gaaacagatgaacatgagtccacccccaggcaatgctggcccagtgatca
A0A5F8HG85_BCL2L2-      gaaacagatgaacatgagtccacccccaggcaatgctggcccagtgatca
A0A5F8HG85_BCL2L2-      gaaacagatgaacatgagtccacccccaggcaatgctggcccagtgatca
F7G6M3_BCL2L2-01        ---------------------------------ccctggaggacgcccgg
G1Q051_BCL2L2-01        --------------------------------------------------
G1TV33_BCL2L2-01        ---------------------------------ccctggaggaggcgcgg
D3Z5F7_BCL2L2-01        gaagcagatgaatatgagtccacccccaggcaatgctggcccagtgatca
G3V4B7_BCL2L2-10        ---------------------------------ccctggaggaggcgcgg
A0A6I9LUT0_BCL2L2-      ---------------------------------ccctggaggaggcgcgg
A0A8C3X592_BCL2L2-      ---------------------------------ccctggaggaggcgcgg
A0A3Q9B4M8_BCL2L2-      ---------------------------------ccctggaggaggcgcgg
A0A7T8CLX7_BCL2L2-      ---------------------------------ccctggaggaggcgcgg
A0A8D0TJQ9_BCL2L2-      ---------------------------------ccctggaggaggcgcgg
A0A4X1SF60_BCL2L2-      ---------------------------------ccctggaggaggcgcgg
A0A4X1SF63_BCL2L2-      ---------------------------------ccctggaggaggcgcgg
A0A8C0Q5E6_BCL2L2-      ---------------------------------ccctggaggaggcgcgg
A0A8I3MNK9_BCL2L2-      ---------------------------------ccctggaggaggcgcgg
A0A8I3RSU6_BCL2L2-      ---------------------------------ccctggaggaggcgcgg
A0A673VAY7_BCL2L2-      ---------------------------------ccctggaggaggcgcgg
A0A2I2UAE3_BCL2L2-      ---------------------------------ccctggaggaggcgcgg
A0A8C8XCR9_BCL2L2-      ---------------------------------ccctggaggaggcgcgg
A0A8C9J3S1_BCL2L2-      ---------------------------------ccctggaggaggcgcgg
M3Y5X5_BCL2L2-01        ---------------------------------ccctggaggaggcgcgg
A0A8C7EW82_BCL2L2-      ---------------------------------ccctggaggaggcgcgg
A0A452SHI1_BCL2L2-      ---------------------------------ccctggaggaggcgcgg
A0A384DPS8_BCL2L2-      ---------------------------------ccctggaggaggcgcgg
A0A8C4LWK5_BCL2L2-      ---------------------------------ccctggaggaggcgcgg
A0A8C6BK57_BCL2L2-      ---------------------------------ccctggaggaggcgcgg
A0A8C9CXQ5_BCL2L2-      ---------------------------------ccctggaggaggcgcgg
A0A8B8WSS7_BCL2L2-      ---------------------------------ccctggaggaggcgcgg
W5QDH4_BCL2L2-02        ---------------------------------ccctggaggaggcgcgg
A0A8C6CUC2_BCL2L2-      ---------------------------------ccctggaggaggcacgg
A0A452ECF0_BCL2L2-      ---------------------------------ccctggaggaggcgcgg
A0A4W2D6A3_BCL2L2-      ---------------------------------ccctggaggaggcgcgg
A0A4W2D6A3_BCL2L2-      ---------------------------------ccctggaggaggcgcgg
A0A4W2GUJ7_BCL2L2-      ---------------------------------ccctggaggaggcgcgg
A0A4W2GUJ7_BCL2L2-      ---------------------------------ccctggaggaggcgcgg
A0A8B9WT05_BCL2L2-      ---------------------------------ccctggaggaggcgcgg
A0A4W2D6A3_BCL2L2-      ---------------------------------ccctggaggaggcgcgg
A0A4W2D6A3_BCL2L2-      ---------------------------------ccctggaggaggcgcgg
A0A4W2GUJ7_BCL2L2-      ---------------------------------ccctggaggaggcgcgg
A0A4W2GUJ7_BCL2L2-      ---------------------------------ccctggaggaggcgcgg
Q05KI8_BCL2L2-01        ---------------------------------ccctggaggaggcgcgg
A0A8C2VJ88_BCL2L2-      --------------------------------------------------
A0A286XQQ9_BCL2L2-      ---------------------------------ccctggaggaggcgcgg
A0A8C2VJ88_BCL2L2-      ---------------------------------ccctggaggaggcgcgg
A0A8D2APK0_BCL2L2-      ---------------------------------ccctggaggaggcacgg
A0A287D9B3_BCL2L2-      ---------------------------------ctctga-------ttgg
A0A8D2HGM1_BCL2L2-      ---------------------------------ccctggaggaggcacgg
A0A287D9B3_BCL2L2-      ---------------------------------ccctggaggaggcacgg
A0A8C9PGU3_BCL2L2-      ---------------------------------ccctggaggaggcacgg
W5QDH4_BCL2L2-01        gaagcagatgaatatgagtccacctccgggcaatgctggcccagtgatca
A0A4W2GUJ7_BCL2L2-      gaagcagatgaatatgagtccacctccgggcaatgctggcccagtgatca
A0A4W2GUJ7_BCL2L2-      gaagcagatgaatatgagtccacctccgggcaatgctggcccagtgatca
A0A4W2D6A3_BCL2L2-      gaagcagatgaatatgagtccacctccgggcaatgctggcccagtgatca
A0A4W2GUJ7_BCL2L2-      gaagcagatgaatatgagtccacctccgggcaatgctggcccagtgatca
A0A4W2D6A3_BCL2L2-      gaagcagatgaatatgagtccacctccgggcaatgctggcccagtgatca
A0A4W2GUJ7_BCL2L2-      gaagcagatgaatatgagtccacctccgggcaatgctggcccagtgatca
A0A4W2GUJ7_BCL2L2-      gaagcagatgaatatgagtccacctccgggcaatgctggcccagtgatca
A0A4W2GUJ7_BCL2L2-      gaagcagatgaatatgagtccacctccgggcaatgctggcccagtgatca
A0A5F5PML6_BCL2L2-      gaagcagatgaatatgagtccacctccaggcaatgctggcccagtgatca
A0A5F5PML6_BCL2L2-      gaagcagatgaatatgagtccacctccaggcaatgctggcccagtgatca
A0A8C5L5C6_BCL2L2-      ---------------------------------ccctggaggaggcgcgg
A0A8C0Q5E6_BCL2L2-      gaaacagatgaatatgagtccacctccaggcaatgctggcccagtgatca
A0A8I3MNK9_BCL2L2-      gaaacagatgaatatgagtccacctccaggcaatgctggcccagtgatca
A0A8I3RSU6_BCL2L2-      gaaacagatgaatatgagtccacctccaggcaatgctggcccagtgatca
A0A8I3MNK9_BCL2L2-      gaaacagatgaatatgagtccacctccaggcaatgctggcccagtgatca
A0A667I624_BCL2L2-      gaaacagatgaatatgagtccacctccaggcaatgctggcccagtgatca
G1LKF5_BCL2L2-01        gaaacagatgaatatgagtccacctccaggcaatgctggcccagtgatca
G1LKF5_BCL2L2-02        gaaacagatgaatatgagtccacctccaggcaatgctggcccagtgatca
A0A384DPS8_BCL2L2-      gaaacagatgaatatgagtccacctccaggcaatgctggcccagtgatca
A0A384DPS8_BCL2L2-      gaaacagatgaatatgagtccacctccaggcaatgctggcccagtgatca
A0A8C6RJE0_BCL2L2-      gaagcagatgaatatgagtccacccccaggcaatgctggcccagtgatta
A0A671DWB3_BCL2L2-      gaagcagatgaatatgagtccacctccaggcaatgctggcccagtgatta
A0A250YBR2_BCL2L2-      ---------------------------------ccctggaggaggcgcgg
A0A250YBR2_BCL2L2-      ---------------------------------ccctggaggaggcgcgg
O88996_BCL2L2-01        ---------------------------------ccctggaggaggcacgg
Q7TS60_BCL2L2-01        ---------------------------------ccctggaggaggcacgg
A0A671DWB3_BCL2L2-      gaagcagatgaatatgagtccacctccaggcaatgctggcccagtgatta
A0A8C6RJE0_BCL2L2-      ---------------------------------ccctggaggaggcgcgg
A0A4W2D6A3_BCL2L2-      gaagcagatgaatatgagtccacctccgggcaatgctggcccagtgatca
A0A4W2GUJ7_BCL2L2-      gaagcagatgaatatgagtccacctccgggcaatgctggcccagtgatca
A0A4W2D6A3_BCL2L2-      gaagcagatgaatatgagtccacctccgggcaatgctggcccagtgatca
A0A4W2GUJ7_BCL2L2-      gaagcagatgaatatgagtccacctccgggcaatgctggcccagtgatca
A0A8C8YZD8_BCL2L2-      gaagcagatgaatatgagtccacctccaggcaatgctggcccagtgatca
A0A8B7FJ73_BCL2L2-      gaagcagatgaatatgagtccacctccaggcaatgctggcccagtgatta
A0A2K6GWM6_BCL2L2-      gaagcagatgaatatgagtccacctccaggcaatgctggtccagtgatca
A0A8D0TJQ9_BCL2L2-      --------------------------------------------------
A0A482LX62_BCL2L2-      ------gccccaactggggccgccttgtggccttctt-------------
A0A4X1SF63_BCL2L2-      gaagcagatgaatatgagtccaccaccaggcaatgctggcccagttatca
A0A4D6NWN1_BCL2L2-      gaagcagatgaatatgagtccaccaccaggcaatgctggcccagttatca
A0A4X1SF60_BCL2L2-      gaagcagatgaatatgagtccaccaccaggcaatgctggcccagttatca
A0A4X1SF63_BCL2L2-      gaagcagatgaatatgagtccaccaccaggcaatgctggcccagttatca
A0A8D0TJQ9_BCL2L2-      gaagcagatgaatatgagtccaccaccaggcaatgctggcccagttatca
A0A4X1SF60_BCL2L2-      gaagcagatgaatatgagtccaccaccaggcaatgctggcccagttatca
A0A8D0TJQ9_BCL2L2-      gaagcagatgaatatgagtccaccaccaggcaatgctggcccagttatca
H0XR82_BCL2L2-01        ---------------------------------ccctggaggaggctcgg
A0A4X1SF63_BCL2L2-      gaagcagatgaatatgagtccaccaccaggcaatgctggcccagttatca
A0A4X1SF63_BCL2L2-      gaagcagatgaatatgagtccaccaccaggcaatgctggcccagttatca
A0A8D0TJQ9_BCL2L2-      gaagcagatgaatatgagtccaccaccaggcaatgctggcccagttatca
A0A8B7FJ73_BCL2L2-      ---------------------------------ccctggaggaggcgcgg
A0A2K6GWM6_BCL2L2-      ---------------------------------ccctggaggaggcgcgg
A0A5F5PML6_BCL2L2-      gaagcagatgaatatgagtccacctccaggcaatgctggcccagtgatca
A0A8C8YZD8_BCL2L2-      gaagcagatgaatatgagtccacctccaggcaatgctggcccagtgatca
A0A8B7FJ73_BCL2L2-      gaagcagatgaatatgagtccacctccaggcaatgctggcccagtgatta
A0A8B7FJ73_BCL2L2-      gaagcagatgaatatgagtccacctccaggcaatgctggcccagtgatta
A0A2K6GWM6_BCL2L2-      gaagcagatgaatatgagtccacctccaggcaatgctggtccagtgatca
A0A2K6GWM6_BCL2L2-      gaagcagatgaatatgagtccacctccaggcaatgctggtccagtgatca
A0A8C0Q5E6_BCL2L2-      gaaacagatgaatatgagtccacctccaggcaatgctggcccagtgatca
A0A8I3MNK9_BCL2L2-      gaaacagatgaatatgagtccacctccaggcaatgctggcccagtgatca
A0A8I3RSU6_BCL2L2-      gaaacagatgaatatgagtccacctccaggcaatgctggcccagtgatca
A0A667I624_BCL2L2-      gaaacagatgaatatgagtccacctccaggcaatgctggcccagtgatca
G1P3J2_BCL2L2-01        ---------------------------------ccctggaggaggctcga
G3TMU7_BCL2L2-01        ---------------------------------ccctggaggaggcacgg
A0A2K6TM77_BCL2L2-      ---------------------------------ccctggaggaggcgcgg
A0A2K6TM77_BCL2L2-      ---------------------------------ccctggaggaggcgcgg
A0A2K5CWY6_BCL2L2-      ---------------------------------ccctggaggaggcgcgg
A0A2K5CWY6_BCL2L2-      ---------------------------------ccctggaggaggcgcgg
A0A2K5CWY6_BCL2L2-      gaagcagatgaatatgagtccacctccaggcaatgctggcccagtgatca
U3CRF8_BCL2L2-02        gaagcagatgaatatgagtccacctccaggcaatgctggcccagtgatca
U3CRF8_BCL2L2-03        gaagcagatgaatatgagtccacctccaggcaatgctggcccagtgatca
A0A2I3GEA7_BCL2L2-      gaagcagatgaatatgagtccacctccaggcaatgctggcccagtgatca
A0A8I5U2F2_BCL2L2-      gaagcagatgaatatgagtccacctccaggcaatgctggcccagtgatca
A0A2I2YPX6_BCL2L2-      gaagcagatgaatatgagtccacctccaggcaatgctggaccagtgatca
A0A2I2YPX6_BCL2L2-      gaagcagatgaatatgagtccacctccaggcaatgctggaccagtgatca
U3CRF8_BCL2L2-01        gaagcagatgaatatgagtccacctccaggcaatgctggcccagtgatca
A0A2K6TM77_BCL2L2-      gaagcagatgaatatgagtccacctccaggcaatgctggaccagtgatca
A0A2K6TM77_BCL2L2-      gaagcagatgaatatgagtccacctccaggcaatgctggaccagtgatca
A0A2K5V0Q3_BCL2L2-      gaagcagatgaatatgagtccacctccaggcaatgctggcccagtgatca
A0A2K6EA59_BCL2L2-      gaagcagatgaatatgagtccacctccaggcaatgctggcccagtgatca
A0A2K6EA59_BCL2L2-      gaagcagatgaatatgagtccacctccaggcaatgctggcccagtgatca
A0A2K5MZX9_BCL2L2-      gaagcagatgaatatgagtccacctccaggcaatgctggcccagtgatca
A0A2K5MZX9_BCL2L2-      gaagcagatgaatatgagtccacctccaggcaatgctggcccagtgatca
A0A2K5MZX9_BCL2L2-      gaagcagatgaatatgagtccacctccaggcaatgctggcccagtgatca
A0A2K5V0Q3_BCL2L2-      -------------------------------------------------a
F7G4L5_BCL2L2-03        gaagcagatgaatatgagtccacctccaggcaatgctggcccagtgatca
A0A2K6EA59_BCL2L2-      gaagcagatgaatatgagtccacctccaggcaatgctggcccagtgatca
A0A2K6AI25_BCL2L2-      gaagcagatgaatatgagtccacctccaggcaatgctggcccagtgatca
A0A8D2FJU1_BCL2L2-      gaagcagatgaatatgagtccacctccaggcaatgctggcccagtgatca
A0A2R9A2Q3_BCL2L2-      gaagcagatgaatatgagtccaccaccaggcaatgctggcccagtgatca
A0A2R9A2Q3_BCL2L2-      gaagcagatgaatatgagtccaccaccaggcaatgctggcccagtgatca
A0A2K6RW35_BCL2L2-      gaagcagatgaatatgagtccacctccaggcaatgctggcccagtgatca
A0A2K5HEJ9_BCL2L2-      gaagcagatgaatatgagtccacctccaggcaatgctggcccagtgatca
A0A2K5HEJ9_BCL2L2-      gaagcagatgaatatgagtccacctccaggcaatgctggcccagtgatca
A0A8I5U2F2_BCL2L2-      ----------------------------------------------atcc
A0A2K5CWY6_BCL2L2-      gaagcagatgaatatgagtccacctccaggcaatgctggcccagtgatca
A0A8I5U2F2_BCL2L2-      gaagcagatgaatatgagtccacctccaggcaatgctggcccagtgatca
A0A2K6RW35_BCL2L2-      ---------------------------------ccctggaggaggcgcgg
A0A2K6RW35_BCL2L2-      ---------------------------------ccctggaggaggcgcgg
A0A2K6ME72_BCL2L2-      ---------------------------------ccctggaggaggcgcgg
A0A2R9A2Q3_BCL2L2-      ---------------------------------ccctggaggaggcgcgg
A0A2K5MZX9_BCL2L2-      ---------------------------------ccctggaggaggcgcgg
A0A2K6EA59_BCL2L2-      ---------------------------------ccctggaggaggcgcgg
A0A2K6RW35_BCL2L2-      gaagcagatgaatatgagtccacctccaggcaatgctggcccagtgatca
A0A2K6ME72_BCL2L2-      gaagcagatgaatatgagtccacctccaggcaatgctggcccagtgatca
A0A8D2FJU1_BCL2L2-      ---------------------------------ccctggaggaggcgcgg
A0A8D2FJU1_BCL2L2-      gaagcagatgaatatgagtccacctccaggcaatgctggcccagtgatca
A0A8C9H679_BCL2L2-      ---------------------------------ccctggaggaggcgcgg
A0A8C9H679_BCL2L2-      --------------------------------------------------
A0A2I3MUE4_BCL2L2-      ---------------------------------ccctggaggaggcgcgg
A0A2I3GEA7_BCL2L2-      ---------------------------------ccctggaggaggcgcgg
A0A2I3GEA7_BCL2L2-      gaagcagatgaatatgagtccacctccaggcaatgctggcccagtgatca
A0A2K6AI25_BCL2L2-      gaagcagatgaatatgagtccacctccaggcaatgctggcccagtgatca
A0A2K6AI25_BCL2L2-      ---------------------------------ccctggaggaggcgcgg
F7G4L5_BCL2L2-02        gaagcagatgaatatgagtccacctccaggcaatgctggcccagtgatca
F7G4L5_BCL2L2-01        ---------------------------------ccctggaggaggcgcgg
A0A2K5V0Q3_BCL2L2-      tccttcgaatctcgcgagccaatcagcatctgagactgggcca-------
A0A2K5V0Q3_BCL2L2-      gaagcagatgaatatgagtccacctccaggcaatgctggcccagtgatca
A0A2K5V0Q3_BCL2L2-      gaagcagatgaatatgagtccacctccaggcaatgctggcccagtgatca
A0A2K5V0Q3_BCL2L2-      gaagcagatgaatatgagtccacctccaggcaatgctggcccagtgatca
A0A2K5V0Q3_BCL2L2-      gaagcagatgaatatgagtccacctccaggcaatgctggcccagtgatca
A0A2K5V0Q3_BCL2L2-      gaagcagatgaatatgagtccacctccaggcaatgctggcccagtgatca
A0A2K5V0Q3_BCL2L2-      ---------------------------------ccctggaggaggcgcgg
G3V4B7_BCL2L2-08        ---------------------------------ccctggaggaggcgcgg
G3V4B7_BCL2L2-07        --------------------------------------------------
G3V4B7_BCL2L2-06        ---------------------------------ccctggaggaggcgcgg
G3V4B7_BCL2L2-05        ---------------------------------ccctggaggaggcgcgg
G3V4B7_BCL2L2-04        --------------------------------------------------
G3V4B7_BCL2L2-03        ---------------------------------ccctggaggaggcgcgg
G3V4B7_BCL2L2-02        ---------------------------------ccctggaggaggcgcgg
A0A2I2YPX6_BCL2L2-      ---------------------------------ccctggaggaggcgcgg
A0A2I2YPX6_BCL2L2-      gaagcagatgaatatgagtccacctccaggcaatgctggaccagtgatca
A0A2K5HEJ9_BCL2L2-      ---------------------------------ccctggaggaggcgcgg
A0A0D9RU30_BCL2L2-      ---------------------------------ccctggaggaggcgcgg
G3V4B7_BCL2L2-01        --------------------------------------------------
G3V4B7_BCL2L2-09        --------------------------------------------------
                                                                          

H3AAS7_BCL2L2-02        aggtttcaggaaggctactggt---------------catccatgaagac
H3AAS7_BCL2L2-01        aggtttcaggaaggctactggt---------------catccatgaagac
Q6GP82_BCL2L2-01        aggcaacgtgaggggaattggg---------------catcactgaagac
A0A8C5PJB3_BCL2L2-      agacagcgtgaagggaattggg---------------cctcactgaagac
A0A4X2LP96_BCL2L2-      -------------------aggggctg-------------------tggc
A0A5F8HG85_BCL2L2-      tgtccattgaggagaagatggaggctgatgcccgatccatctatgtaggc
A0A5F8HG85_BCL2L2-      tgtccattgaggagaagatggaggctgatgcccgatccatctatgtaggc
A0A5F8HG85_BCL2L2-      tgtccattgaggagaagatggaggctgatgcccgatccatctatgtaggc
F7G6M3_BCL2L2-01        cgcctgcgggagggcaactggg---------------cctccgtccggac
G1Q051_BCL2L2-01        ------------------tggg---------------cctcagtgaggac
G1TV33_BCL2L2-01        cgtctgcgggaggggacctggg---------------cgtcagtgaggac
D3Z5F7_BCL2L2-01        tgtctcttgaggagaagatggaggctgatgcccgctctatctacgttggc
G3V4B7_BCL2L2-10        cgtctgcgggaggggaactggg---------------catcagtgaggac
A0A6I9LUT0_BCL2L2-      cggctgcgggaggggaactggg---------------catcagtgaggac
A0A8C3X592_BCL2L2-      cgtctgcgggaggggaactggg---------------cctcagtgaggac
A0A3Q9B4M8_BCL2L2-      cgtctgcgggaggggaactggg---------------cctcagtgaggac
A0A7T8CLX7_BCL2L2-      cgtctgcgggaggggaactggg---------------cctcagtgaggac
A0A8D0TJQ9_BCL2L2-      cgtctgcgggaggggaactggg---------------cctcagtgaggac
A0A4X1SF60_BCL2L2-      cgtctgcgggaggggaactggg---------------cctcagtgaggac
A0A4X1SF63_BCL2L2-      cgtctgcgggaggggaactggg---------------cctcagtgaggac
A0A8C0Q5E6_BCL2L2-      cgtctgcgggaggggaactggg---------------cctcagtgaggac
A0A8I3MNK9_BCL2L2-      cgtctgcgggaggggaactggg---------------cctcagtgaggac
A0A8I3RSU6_BCL2L2-      cgtctgcgggaggggaactggg---------------cctcagtgaggac
A0A673VAY7_BCL2L2-      cgtctgcgggaggggaactggg---------------cctcagtgaggac
A0A2I2UAE3_BCL2L2-      cgtctgcgggaggggaactggg---------------cctcagtgaggac
A0A8C8XCR9_BCL2L2-      cgtctgcgggaggggaactggg---------------cctcagtgaggac
A0A8C9J3S1_BCL2L2-      cgtctgcgggaggggaactggg---------------cctcagtgaggac
M3Y5X5_BCL2L2-01        cgtctgcgggaggggaactggg---------------cctcagtgaggac
A0A8C7EW82_BCL2L2-      cgtctgcgggaggggaactggg---------------cctcagtgaggac
A0A452SHI1_BCL2L2-      cgtctgcgggaggggaactggg---------------cctcagtgaggac
A0A384DPS8_BCL2L2-      cgtctgcgggaggggaactggg---------------cctcagtgaggac
A0A8C4LWK5_BCL2L2-      cgtctgcgggaggggaactggg---------------cctcagtgaggac
A0A8C6BK57_BCL2L2-      cgtctgcgggaggggaactggg---------------cctcagtgaggac
A0A8C9CXQ5_BCL2L2-      cgtctgcgggaggggaactggg---------------cctcagtgaggac
A0A8B8WSS7_BCL2L2-      cgtctgcgggaggggaactggg---------------cctcagtgaggac
W5QDH4_BCL2L2-02        cgtctgcgggaggggaactggg---------------cttcagtgaggac
A0A8C6CUC2_BCL2L2-      cgtctgcgggaggggaactggg---------------cctcagtgaggac
A0A452ECF0_BCL2L2-      cgtctgcgggaggggaactggg---------------cctcagtgaggac
A0A4W2D6A3_BCL2L2-      cgtctgcgggaggggaactggg---------------cttcagtgaggac
A0A4W2D6A3_BCL2L2-      cgtctgcgggaggggaactggg---------------cttcagtgaggac
A0A4W2GUJ7_BCL2L2-      cgtctgcgggaggggaactggg---------------cttcagtgaggac
A0A4W2GUJ7_BCL2L2-      cgtctgcgggaggggaactggg---------------cttcagtgaggac
A0A8B9WT05_BCL2L2-      cgtctgcgggaggggaactggg---------------cttcagtgaggac
A0A4W2D6A3_BCL2L2-      cgtctgcgggaggggaactggg---------------cttcagtgaggac
A0A4W2D6A3_BCL2L2-      cgtctgcgggaggggaactggg---------------cttcagtgaggac
A0A4W2GUJ7_BCL2L2-      cgtctgcgggaggggaactggg---------------cttcagtgaggac
A0A4W2GUJ7_BCL2L2-      cgtctgcgggaggggaactggg---------------cttcagtgaggac
Q05KI8_BCL2L2-01        cgtctgcgggaggggaactggg---------------cttcagtgaggac
A0A8C2VJ88_BCL2L2-      --------------aagctgat---------------ctccagggggaa-
A0A286XQQ9_BCL2L2-      cgtctgcgggaggggaactggg---------------catcagtgaggac
A0A8C2VJ88_BCL2L2-      cgtctgcgggaggggaactggg---------------catcagtgaggac
A0A8D2APK0_BCL2L2-      cgtctgcgggaggggaactggg---------------catcagtgaggac
A0A287D9B3_BCL2L2-      aggctgggacagctgtgctggg---------------aa-----------
A0A8D2HGM1_BCL2L2-      cgtctgcgggaggggaactggg---------------catcagtgaggac
A0A287D9B3_BCL2L2-      cgtctgcgggaggggaactggg---------------catcagtgaggac
A0A8C9PGU3_BCL2L2-      cgtctgcgggaggggaactggg---------------catcagtgaggac
W5QDH4_BCL2L2-01        tgtccattgaggagaagatggaggctgatgcccgttccatctatgttggc
A0A4W2GUJ7_BCL2L2-      tgtccattgaggagaagatggaggctgatgcccgttccatctatgttggc
A0A4W2GUJ7_BCL2L2-      tgtccattgaggagaagatggaggctgatgcccgttccatctatgttggc
A0A4W2D6A3_BCL2L2-      tgtccattgaggagaagatggaggctgatgcccgttccatctatgttggc
A0A4W2GUJ7_BCL2L2-      tgtccattgaggagaagatggaggctgatgcccgttccatctatgttggc
A0A4W2D6A3_BCL2L2-      tgtccattgaggagaagatggaggctgatgcccgttccatctatgttggc
A0A4W2GUJ7_BCL2L2-      tgtccattgaggagaagatggaggctgatgcccgttccatctatgttggc
A0A4W2GUJ7_BCL2L2-      tgtccattgaggagaagatggaggctgatgcccgttccatctatgttggc
A0A4W2GUJ7_BCL2L2-      tgtccattgaggagaagatggaggctgatgcccgttccatctatgttggc
A0A5F5PML6_BCL2L2-      tgtccattgaggagaagatggaggctgatgctcgttccatctatgttggc
A0A5F5PML6_BCL2L2-      tgtccattgaggagaagatggaggctgatgctcgttccatctatgttggc
A0A8C5L5C6_BCL2L2-      cgtctgcgggaggggaactggg---------------catcagtgaggac
A0A8C0Q5E6_BCL2L2-      tgtccattgaagagaagatggaggctgatgcccgttccatttatgttggc
A0A8I3MNK9_BCL2L2-      tgtccattgaagagaagatggaggctgatgcccgttccatttatgttggc
A0A8I3RSU6_BCL2L2-      tgtccattgaagagaagatggaggctgatgcccgttccatttatgttggc
A0A8I3MNK9_BCL2L2-      tgtccattgaagagaagatggaggctgatgcccgttccatttatgttggc
A0A667I624_BCL2L2-      tgtccattgaagagaagatggaggctgatgcccgttccatttatgttggc
G1LKF5_BCL2L2-01        tgtctattgaagagaagatggaggctgatgcccgttccatctatgttggc
G1LKF5_BCL2L2-02        tgtctattgaagagaagatggaggctgatgcccgttccatctatgttggc
A0A384DPS8_BCL2L2-      tgtctattgaagagaagatggaggctgatgcccgttccatctatgttggc
A0A384DPS8_BCL2L2-      tgtctattgaagagaagatggaggctgatgcccgttccatctatgttggc
A0A8C6RJE0_BCL2L2-      tgtctattgaggagaagatggaggctgatgcccgctctatctatgttggc
A0A671DWB3_BCL2L2-      tgtctattgaggagaagatggaggctgatgcccgttccatctatgttggc
A0A250YBR2_BCL2L2-      cgcctgcgggaggggaactggg---------------catcagtgaggac
A0A250YBR2_BCL2L2-      cgcctgcgggaggggaactggg---------------catcagtgaggac
O88996_BCL2L2-01        cgtctgcgggaggggaactggg---------------catcagtgaggac
Q7TS60_BCL2L2-01        cgtctgcgggaggggaactggg---------------catcagtgaggac
A0A671DWB3_BCL2L2-      tgtctattgaggagaagatggaggctgatgcccgttccatctatgttggc
A0A8C6RJE0_BCL2L2-      cgtctgcgggaggggaactggg---------------catcagtgaggac
A0A4W2D6A3_BCL2L2-      tgtccattgaggagaagatggaggctgatgcccgttccatctatgttggc
A0A4W2GUJ7_BCL2L2-      tgtccattgaggagaagatggaggctgatgcccgttccatctatgttggc
A0A4W2D6A3_BCL2L2-      tgtccattgaggagaagatggaggctgatgcccgttccatctatgttggc
A0A4W2GUJ7_BCL2L2-      tgtccattgaggagaagatggaggctgatgcccgttccatctatgttggc
A0A8C8YZD8_BCL2L2-      tgtccattgaagagaaaatggaggctgatgcccgttccatctacgttggc
A0A8B7FJ73_BCL2L2-      tgtccattgaagagaaaatggaggctgatgcccgttccatctatgttggc
A0A2K6GWM6_BCL2L2-      tgtccattgaagagaaaatggaggctgatgcccgttccatctatgttggc
A0A8D0TJQ9_BCL2L2-      ------cagaatggaaattaag----------------------------
A0A482LX62_BCL2L2-      tgtcttcggagctgca----------------------ctgtgtgctgag
A0A4X1SF63_BCL2L2-      tgtccattgaggagaagatggaggcagatgcccgatctatctatgttggc
A0A4D6NWN1_BCL2L2-      tgtccattgaggagaagatggaggcagatgcccgatctatctatgttggc
A0A4X1SF60_BCL2L2-      tgtccattgaggagaagatggaggcagatgcccgatctatctatgttggc
A0A4X1SF63_BCL2L2-      tgtccattgaggagaagatggaggcagatgcccgatctatctatgttggc
A0A8D0TJQ9_BCL2L2-      tgtccattgaggagaagatggaggcagatgcccgatctatctatgttggc
A0A4X1SF60_BCL2L2-      tgtccattgaggagaagatggaggcagatgcccgatctatctatgttggc
A0A8D0TJQ9_BCL2L2-      tgtccattgaggagaagatggaggcagatgcccgatctatctatgttggc
H0XR82_BCL2L2-01        cgtctgcgggaggggaactggg---------------catcagtgaggac
A0A4X1SF63_BCL2L2-      tgtccattgaggagaagatggaggcagatgcccgatctatctatgttggc
A0A4X1SF63_BCL2L2-      tgtccattgaggagaagatggaggcagatgcccgatctatctatgttggc
A0A8D0TJQ9_BCL2L2-      tgtccattgaggagaagatggaggcagatgcccgatctatctatgttggc
A0A8B7FJ73_BCL2L2-      cgtctgcgggaggggaactggg---------------catcagtgaggac
A0A2K6GWM6_BCL2L2-      cgtctgcgggaggggaactggg---------------catcagtgaggac
A0A5F5PML6_BCL2L2-      tgtccattgaggagaagatggaggctgatgctcgttccatctatgttggc
A0A8C8YZD8_BCL2L2-      tgtccattgaagagaaaatggaggctgatgcccgttccatctacgttggc
A0A8B7FJ73_BCL2L2-      tgtccattgaagagaaaatggaggctgatgcccgttccatctatgttggc
A0A8B7FJ73_BCL2L2-      tgtccattgaagagaaaatggaggctgatgcccgttccatctatgttggc
A0A2K6GWM6_BCL2L2-      tgtccattgaagagaaaatggaggctgatgcccgttccatctatgttggc
A0A2K6GWM6_BCL2L2-      tgtccattgaagagaaaatggaggctgatgcccgttccatctatgttggc
A0A8C0Q5E6_BCL2L2-      tgtccattgaagagaagatggaggctgatgcccgttccatttatgttggc
A0A8I3MNK9_BCL2L2-      tgtccattgaagagaagatggaggctgatgcccgttccatttatgttggc
A0A8I3RSU6_BCL2L2-      tgtccattgaagagaagatggaggctgatgcccgttccatttatgttggc
A0A667I624_BCL2L2-      tgtccattgaagagaagatggaggctgatgcccgttccatttatgttggc
G1P3J2_BCL2L2-01        cgcctgcgggaggggaactggg---------------cctcagtgaggac
G3TMU7_BCL2L2-01        cgtctgcgggaggggaactggg---------------catcagtgaggac
A0A2K6TM77_BCL2L2-      cgtctgcgggaggggaactggg---------------catcagtgaggac
A0A2K6TM77_BCL2L2-      cgtctgcgggaggggaactggg---------------catcagtgaggac
A0A2K5CWY6_BCL2L2-      cgtctgcgggaggggaactggg---------------catcagtgaggac
A0A2K5CWY6_BCL2L2-      cgtctgcgggaggggaactggg---------------catcagtgaggac
A0A2K5CWY6_BCL2L2-      tgtccattgaggagaagatggaggctgatgcccgttccatctatgttggc
U3CRF8_BCL2L2-02        tgtccattgaggagaagatggaggctgatgcccgttccatctatgttggc
U3CRF8_BCL2L2-03        tgtccattgaggagaagatggaggctgatgcccgttccatctatgttggc
A0A2I3GEA7_BCL2L2-      tgtccattgaggagaagatggaggctgatgcccgttccatctatgttggc
A0A8I5U2F2_BCL2L2-      tgtccattgaggagaagatggaggctgatgcccgttccatctatgttggc
A0A2I2YPX6_BCL2L2-      tgtccattgaggagaagatggaggctgatgcccgttccatctatgttggc
A0A2I2YPX6_BCL2L2-      tgtccattgaggagaagatggaggctgatgcccgttccatctatgttggc
U3CRF8_BCL2L2-01        tgtccattgaggagaagatggaggctgatgcccgttccatctatgttggc
A0A2K6TM77_BCL2L2-      tgtccattgaggagaagatggaggctgatgcccgttccatctatgttggc
A0A2K6TM77_BCL2L2-      tgtccattgaggagaagatggaggctgatgcccgttccatctatgttggc
A0A2K5V0Q3_BCL2L2-      tgtccattgaggagaagatggaggctgatgcccgttccatctatgttggc
A0A2K6EA59_BCL2L2-      tgtccattgaggagaagatggaggctgatgcccgttccatctatgttggc
A0A2K6EA59_BCL2L2-      tgtccattgaggagaagatggaggctgatgcccgttccatctatgttggc
A0A2K5MZX9_BCL2L2-      tgtccattgaggagaagatggaggctgatgcccgttccatctatgttggc
A0A2K5MZX9_BCL2L2-      tgtccattgaggagaagatggaggctgatgcccgttccatctatgttggc
A0A2K5MZX9_BCL2L2-      tgtccattgaggagaagatggaggctgatgcccgttccatctatgttggc
A0A2K5V0Q3_BCL2L2-      tgtccattgaggagaagatggaggctgatgcccgttccatctatgttggc
F7G4L5_BCL2L2-03        tgtccattgaggagaagatggaggctgatgcccgttccatctatgttggc
A0A2K6EA59_BCL2L2-      tgtccattgaggagaagatggaggctgatgcccgttccatctatgttggc
A0A2K6AI25_BCL2L2-      tgtccattgaggagaagatggaggctgatgcccgttccatctatgttggc
A0A8D2FJU1_BCL2L2-      tgtccattgaggagaagatggaggctgatgcccgttccatctatgttggc
A0A2R9A2Q3_BCL2L2-      tgtccattgaggagaagatggaggctgatgcccgttccatctatgttggc
A0A2R9A2Q3_BCL2L2-      tgtccattgaggagaagatggaggctgatgcccgttccatctatgttggc
A0A2K6RW35_BCL2L2-      tgtccattgaggagaagatggaggctgatgcccgttccatctatgttggc
A0A2K5HEJ9_BCL2L2-      tgtccattgaggagaagatggaggctgatgcccgttccatctatgttggc
A0A2K5HEJ9_BCL2L2-      tgtccattgaggagaagatggaggctgatgcccgttccatctatgttggc
A0A8I5U2F2_BCL2L2-      catctactg-----------------------------------------
A0A2K5CWY6_BCL2L2-      tgtccattgaggagaagatggaggctgatgcccgttccatctatgttggc
A0A8I5U2F2_BCL2L2-      tgtccattgaggagaagatggaggctgatgcccgttccatctatgttggc
A0A2K6RW35_BCL2L2-      cgtctgcgggaggggaactggg---------------catcagtgaggac
A0A2K6RW35_BCL2L2-      cgtctgcgggaggggaactggg---------------catcagtgaggac
A0A2K6ME72_BCL2L2-      cgtctgcgggaggggaactggg---------------catcagtgaggac
A0A2R9A2Q3_BCL2L2-      cgtctgcgggaggggaactggg---------------catcagtgaggac
A0A2K5MZX9_BCL2L2-      cgtctgcgggaggggaactggg---------------catcagtgaggac
A0A2K6EA59_BCL2L2-      cgtctgcgggaggggaactggg---------------catcagtgaggac
A0A2K6RW35_BCL2L2-      tgtccattgaggagaagatggaggctgatgcccgttccatctatgttggc
A0A2K6ME72_BCL2L2-      tgtccattgaggagaagatggaggctgatgcccgttccatctatgttggc
A0A8D2FJU1_BCL2L2-      cgtctgcgggaggggaactggg---------------catcagtgaggac
A0A8D2FJU1_BCL2L2-      tgtccattgaggagaagatggaggctgatgcccgttccatctatgttggc
A0A8C9H679_BCL2L2-      cgtctgcgggaggggaactggg---------------catcagtgaggac
A0A8C9H679_BCL2L2-      --------gtaaggaa----------------------------------
A0A2I3MUE4_BCL2L2-      cgtctgcgggaggggaactggg---------------catcagtgaggac
A0A2I3GEA7_BCL2L2-      cgtctgcgggaggggaactggg---------------catcagtgaggac
A0A2I3GEA7_BCL2L2-      tgtccattgaggagaagatggaggctgatgcccgttccatctatgttggc
A0A2K6AI25_BCL2L2-      tgtccattgaggagaagatggaggctgatgcccgttccatctatgttggc
A0A2K6AI25_BCL2L2-      cgtctgcgggaggggaactggg---------------catcagtgaggac
F7G4L5_BCL2L2-02        tgtccattgaggagaagatggaggctgatgcccgttccatctatgttggc
F7G4L5_BCL2L2-01        cgtctgcgggaggggaactggg---------------catcagtgaggac
A0A2K5V0Q3_BCL2L2-      ---ctgcggtgaggcgatcggaagattg-gtcctttccagtcgcctagct
A0A2K5V0Q3_BCL2L2-      tgtccattgaggagaagatggaggctgatgcccgttccatctatgttggc
A0A2K5V0Q3_BCL2L2-      tgtccattgaggagaagatggaggctgatgcccgttccatctatgttggc
A0A2K5V0Q3_BCL2L2-      tgtccattgaggagaagatggaggctgatgcccgttccatctatgttggc
A0A2K5V0Q3_BCL2L2-      tgtccattgaggagaagatggaggctgatgcccgttccatctatgttggc
A0A2K5V0Q3_BCL2L2-      tgtccattgaggagaagatggaggctgatgcccgttccatctatgttggc
A0A2K5V0Q3_BCL2L2-      cgtctgcgggaggggaactggg---------------catcagtgaggac
G3V4B7_BCL2L2-08        cgtctgcgggaggggaactggg---------------catcagtgaggac
G3V4B7_BCL2L2-07        -------------------------------------catcctt------
G3V4B7_BCL2L2-06        cgtctgcgggaggggaactggg---------------catcagtgaggac
G3V4B7_BCL2L2-05        cgtctgcgggaggggaactggg---------------catcagtgaggac
G3V4B7_BCL2L2-04        --tctaccacaggacaca-------------------tatccctgttagc
G3V4B7_BCL2L2-03        cgtctgcgggaggggaactggg---------------catcagtgaggac
G3V4B7_BCL2L2-02        cgtctgcgggaggggaactggg---------------catcagtgaggac
A0A2I2YPX6_BCL2L2-      cgtctgcgggaggggaactggg---------------catcagtgaggac
A0A2I2YPX6_BCL2L2-      tgtccattgaggagaagatggaggctgatgcccgttccatctatgttggc
A0A2K5HEJ9_BCL2L2-      cgtctgcgggaggggaactggg---------------catcagtgaggac
A0A0D9RU30_BCL2L2-      cgtctgcgggaggggaactggg---------------catcagtgaggac
G3V4B7_BCL2L2-01        --------------------------------------------------
G3V4B7_BCL2L2-09        --------------------------------------------------
                                                                          

H3AAS7_BCL2L2-02        ggttgtgacggggg------------------------------------
H3AAS7_BCL2L2-01        ggttgtgacggggg------------------------------------
Q6GP82_BCL2L2-01        tgtcttaactggag------------------------------------
A0A8C5PJB3_BCL2L2-      tgttctgacaggcg------------------------------------
A0A4X2LP96_BCL2L2-      attgggggctctggtg-------------actgtggg-------------
A0A5F8HG85_BCL2L2-      aatgtggactatggtgcaacagcagaagagctggaggcacacttccatgg
A0A5F8HG85_BCL2L2-      aatgtggactatggtgcaacagcagaagagctggaggcacacttccatgg
A0A5F8HG85_BCL2L2-      aatgtggactatggtgcaacagcagaagagctggaggcacacttccatgg
F7G6M3_BCL2L2-01        cgtgctgacggggg------------------------------------
G1Q051_BCL2L2-01        agtgctgacggggg------------------------------------
G1TV33_BCL2L2-01        agtgctgacggggg------------------------------------
D3Z5F7_BCL2L2-01        aatgtggactatggtgcaacagcagaagagctggaagcccattttcatgg
G3V4B7_BCL2L2-10        agtgctgacggggg------------------------------------
A0A6I9LUT0_BCL2L2-      agtgctgaccgggg------------------------------------
A0A8C3X592_BCL2L2-      agtgctgacggggg------------------------------------
A0A3Q9B4M8_BCL2L2-      agtgctgacggggg------------------------------------
A0A7T8CLX7_BCL2L2-      agtgctgacggggg------------------------------------
A0A8D0TJQ9_BCL2L2-      agtgctgacggggg------------------------------------
A0A4X1SF60_BCL2L2-      tgtgctgacggggg------------------------------------
A0A4X1SF63_BCL2L2-      agtgctgacggggg------------------------------------
A0A8C0Q5E6_BCL2L2-      agtgctgacggggg------------------------------------
A0A8I3MNK9_BCL2L2-      agtgctgacggggg------------------------------------
A0A8I3RSU6_BCL2L2-      agtgctgacggggg------------------------------------
A0A673VAY7_BCL2L2-      agtgctgacagggg------------------------------------
A0A2I2UAE3_BCL2L2-      agtgctgacagggg------------------------------------
A0A8C8XCR9_BCL2L2-      agtgctgacagggg------------------------------------
A0A8C9J3S1_BCL2L2-      agtgctgacagggg------------------------------------
M3Y5X5_BCL2L2-01        agtgctgacagggg------------------------------------
A0A8C7EW82_BCL2L2-      agtgctgacagggg------------------------------------
A0A452SHI1_BCL2L2-      agtgctgacagggg------------------------------------
A0A384DPS8_BCL2L2-      agtgctgacagggg------------------------------------
A0A8C4LWK5_BCL2L2-      agtgctgacagggg------------------------------------
A0A8C6BK57_BCL2L2-      agtgctgacggggg------------------------------------
A0A8C9CXQ5_BCL2L2-      agtgctgacggggg------------------------------------
A0A8B8WSS7_BCL2L2-      agtgctgacggggg------------------------------------
W5QDH4_BCL2L2-02        agtgctgacggggg------------------------------------
A0A8C6CUC2_BCL2L2-      agtgctgacggggg------------------------------------
A0A452ECF0_BCL2L2-      agtgctgacggggg------------------------------------
A0A4W2D6A3_BCL2L2-      agtgctgacggggg------------------------------------
A0A4W2D6A3_BCL2L2-      agtgctgacggggg------------------------------------
A0A4W2GUJ7_BCL2L2-      agtgctgacggggg------------------------------------
A0A4W2GUJ7_BCL2L2-      agtgctgacggggg------------------------------------
A0A8B9WT05_BCL2L2-      agtgctgacggggg------------------------------------
A0A4W2D6A3_BCL2L2-      agtgctgacggggg------------------------------------
A0A4W2D6A3_BCL2L2-      agtgctgacggggg------------------------------------
A0A4W2GUJ7_BCL2L2-      agtgctgacggggg------------------------------------
A0A4W2GUJ7_BCL2L2-      agtgctgacggggg------------------------------------
Q05KI8_BCL2L2-01        agtgctgacggggg------------------------------------
A0A8C2VJ88_BCL2L2-      ------gatggggg------------------------------------
A0A286XQQ9_BCL2L2-      agtgctgacagggg------------------------------------
A0A8C2VJ88_BCL2L2-      agtgctgacggggg------------------------------------
A0A8D2APK0_BCL2L2-      agtgctgacagggg------------------------------------
A0A287D9B3_BCL2L2-      ----------ggag------------------------------------
A0A8D2HGM1_BCL2L2-      agtgctgacggggg------------------------------------
A0A287D9B3_BCL2L2-      agtgctgacggggg------------------------------------
A0A8C9PGU3_BCL2L2-      agtgctgacggggg------------------------------------
W5QDH4_BCL2L2-01        aatgtggactatggtgcaacagcagaagagctagaagcacacttccatgg
A0A4W2GUJ7_BCL2L2-      aatgtggactatggtgcaacagcagaagagctagaagcacactttcatgg
A0A4W2GUJ7_BCL2L2-      aatgtggactatggtgcaacagcagaagagctagaagcacactttcatgg
A0A4W2D6A3_BCL2L2-      aatgtggactatggtgcaacagcagaagagctagaagcacactttcatgg
A0A4W2GUJ7_BCL2L2-      aatgtggactatggtgcaacagcagaagagctagaagcacactttcatgg
A0A4W2D6A3_BCL2L2-      aatgtggactatggtgcaacagcagaagagctagaagcacactttcatgg
A0A4W2GUJ7_BCL2L2-      aatgtggactatggtgcaacagcagaagagctagaagcacactttcatgg
A0A4W2GUJ7_BCL2L2-      aatgtggactatggtgcaacagcagaagagctagaagcacactttcatgg
A0A4W2GUJ7_BCL2L2-      aatgtggactatggtgcaacagcagaagagctagaagcacactttcatgg
A0A5F5PML6_BCL2L2-      aatgtggactatggtgcgacagcagaagagctggaagcacactttcatgg
A0A5F5PML6_BCL2L2-      aatgtggactatggtgcgacagcagaagagctggaagcacactttcatgg
A0A8C5L5C6_BCL2L2-      agtgctgacagggg------------------------------------
A0A8C0Q5E6_BCL2L2-      aatgtggactatggtgcaacagcagaagagttggaagcacactttcatgg
A0A8I3MNK9_BCL2L2-      aatgtggactatggtgcaacagcagaagagttggaagcacactttcatgg
A0A8I3RSU6_BCL2L2-      aatgtggactatggtgcaacagcagaagagttggaagcacactttcatgg
A0A8I3MNK9_BCL2L2-      aatgtggactatggtgcaacagcagaagagttggaagcacactttcatgg
A0A667I624_BCL2L2-      aatgtggactatggtgcaacagcagaagagctggaagcacactttcatgg
G1LKF5_BCL2L2-01        aacgtggactatggtgcaacagcagaagagctggaagcacactttcatgg
G1LKF5_BCL2L2-02        aacgtggactatggtgcaacagcagaagagctggaagcacactttcatgg
A0A384DPS8_BCL2L2-      aacgtggactatggtgcaacagcagaagagctggaagcacactttcatgg
A0A384DPS8_BCL2L2-      aacgtggactatggtgcaacagcagaagagctggaagcacactttcatgg
A0A8C6RJE0_BCL2L2-      aatgtggactatggtgcaacagcagaagagctggaagctcactttcatgg
A0A671DWB3_BCL2L2-      aatgtagactatggtgcaacagcagaagagctggaagcacactttcatgg
A0A250YBR2_BCL2L2-      agtgctgacggggg------------------------------------
A0A250YBR2_BCL2L2-      agtgctgacggggg------------------------------------
O88996_BCL2L2-01        agtgctgacggggg------------------------------------
Q7TS60_BCL2L2-01        agtgctgacggggg------------------------------------
A0A671DWB3_BCL2L2-      aatgtagactatggtgcaacagcagaagagctggaagcacactttcatgg
A0A8C6RJE0_BCL2L2-      agtgctgacggggg------------------------------------
A0A4W2D6A3_BCL2L2-      aatgtggactatggtgcaacagcagaagagctagaagcacactttcatgg
A0A4W2GUJ7_BCL2L2-      aatgtggactatggtgcaacagcagaagagctagaagcacactttcatgg
A0A4W2D6A3_BCL2L2-      aatgtggactatggtgcaacagcagaagagctagaagcacactttcatgg
A0A4W2GUJ7_BCL2L2-      aatgtggactatggtgcaacagcagaagagctagaagcacactttcatgg
A0A8C8YZD8_BCL2L2-      aatgtggactacggtgcaacagcagaagagctggaagctcactttcatgg
A0A8B7FJ73_BCL2L2-      aatgtggactatggtgcaacagcagaagagctggaagctcactttcatgg
A0A2K6GWM6_BCL2L2-      aatgtggactatggtgcaacagcagaagagctggaagctcactttcatgg
A0A8D0TJQ9_BCL2L2-      -----------tagtccaacag----------------------------
A0A482LX62_BCL2L2-      agtgtcaataagga------------------------------------
A0A4X1SF63_BCL2L2-      aatgtggactatggtgcaacagcagaagagctggaagcacactttcatgg
A0A4D6NWN1_BCL2L2-      aatgtggactatggtgcaacagcagaagagctggaagcacactttcatgg
A0A4X1SF60_BCL2L2-      aatgtggactatggtgcaacagcagaagagctggaagcacactttcatgg
A0A4X1SF63_BCL2L2-      aatgtggactatggtgcaacagcagaagagctggaagcacactttcatgg
A0A8D0TJQ9_BCL2L2-      aatgtggactatggtgcaacagcagaagagctggaagcacactttcatgg
A0A4X1SF60_BCL2L2-      aatgtggactatggtgcaacagcagaagagctggaagcacactttcatgg
A0A8D0TJQ9_BCL2L2-      aatgtggactatggtgcaacagcagaagagctggaagcacactttcatgg
H0XR82_BCL2L2-01        agtgctgacagggg------------------------------------
A0A4X1SF63_BCL2L2-      aatgtggactatggtgcaacagcagaagagctggaagcacactttcatgg
A0A4X1SF63_BCL2L2-      aatgtggactatggtgcaacagcagaagagctggaagcacactttcatgg
A0A8D0TJQ9_BCL2L2-      aatgtggactatggtgcaacagcagaagagctggaagcacactttcatgg
A0A8B7FJ73_BCL2L2-      agtgctgacggggg------------------------------------
A0A2K6GWM6_BCL2L2-      agtgctgacagggg------------------------------------
A0A5F5PML6_BCL2L2-      aatgtggactatggtgcgacagcagaagagctggaagcacactttcatgg
A0A8C8YZD8_BCL2L2-      aatgtggactacggtgcaacagcagaagagctggaagctcactttcatgg
A0A8B7FJ73_BCL2L2-      aatgtggactatggtgcaacagcagaagagctggaagctcactttcatgg
A0A8B7FJ73_BCL2L2-      aatgtggactatggtgcaacagcagaagagctggaagctcactttcatgg
A0A2K6GWM6_BCL2L2-      aatgtggactatggtgcaacagcagaagagctggaagctcactttcatgg
A0A2K6GWM6_BCL2L2-      aatgtggactatggtgcaacagcagaagagctggaagctcactttcatgg
A0A8C0Q5E6_BCL2L2-      aatgtggactatggtgcaacagcagaagagttggaagcacactttcatgg
A0A8I3MNK9_BCL2L2-      aatgtggactatggtgcaacagcagaagagttggaagcacactttcatgg
A0A8I3RSU6_BCL2L2-      aatgtggactatggtgcaacagcagaagagttggaagcacactttcatgg
A0A667I624_BCL2L2-      aatgtggactatggtgcaacagcagaagagctggaagcacactttcatgg
G1P3J2_BCL2L2-01        agtgctgacggggg------------------------------------
G3TMU7_BCL2L2-01        agtgctgacggggg------------------------------------
A0A2K6TM77_BCL2L2-      agtgctgacagggg------------------------------------
A0A2K6TM77_BCL2L2-      agtgctgacagggg------------------------------------
A0A2K5CWY6_BCL2L2-      agtgctgacagggg------------------------------------
A0A2K5CWY6_BCL2L2-      agtgctgacagggg------------------------------------
A0A2K5CWY6_BCL2L2-      aatgtggactatggtgcaacagcagaagagctggaagctcactttcatgg
U3CRF8_BCL2L2-02        aatgtggactatggtgcaacagcagaagagctggaagctcactttcatgg
U3CRF8_BCL2L2-03        aatgtggactatggtgcaacagcagaagagctggaagctcactttcatgg
A0A2I3GEA7_BCL2L2-      aatgtggactatggtgcaacagcagaagagctggaagctcactttcatgg
A0A8I5U2F2_BCL2L2-      aatgtggactatggtgcaacagcggaagagctggaagctcactttcatgg
A0A2I2YPX6_BCL2L2-      aatgtggactatggtgcaacagcagaagagctggaagctcactttcatgg
A0A2I2YPX6_BCL2L2-      aatgtggactatggtgcaacagcagaagagctggaagctcactttcatgg
U3CRF8_BCL2L2-01        aatgtggactatggtgcaacagcagaagagctggaagctcactttcatgg
A0A2K6TM77_BCL2L2-      aatgtggactatggtgcaacagcagaagagctggaagctcactttcatgg
A0A2K6TM77_BCL2L2-      aatgtggactatggtgcaacagcagaagagctggaagctcactttcatgg
A0A2K5V0Q3_BCL2L2-      aatgtggactatggtgcaacagcagaagagctggaagctcactttcatgg
A0A2K6EA59_BCL2L2-      aatgtggactatggtgcaacagcagaagagctggaagctcactttcatgg
A0A2K6EA59_BCL2L2-      aatgtggactatggtgcaacagcagaagagctggaagctcactttcatgg
A0A2K5MZX9_BCL2L2-      aatgtggactatggtgcaacagcagaagagctggaagctcactttcatgg
A0A2K5MZX9_BCL2L2-      aatgtggactatggtgcaacagcagaagagctggaagctcactttcatgg
A0A2K5MZX9_BCL2L2-      aatgtggactatggtgcaacagcagaagagctggaagctcactttcatgg
A0A2K5V0Q3_BCL2L2-      aatgtggactatggtgcaacagcagaagagctggaagctcactttcatgg
F7G4L5_BCL2L2-03        aatgtggactatggtgcaacagcagaagagctggaagctcactttcatgg
A0A2K6EA59_BCL2L2-      aatgtggactatggtgcaacagcagaagagctggaagctcactttcatgg
A0A2K6AI25_BCL2L2-      aatgtggactatggtgcaacagcagaagagctggaagctcactttcatgg
A0A8D2FJU1_BCL2L2-      aatgtggactatggtgcaacagcagaagagctggaagctcactttcatgg
A0A2R9A2Q3_BCL2L2-      aatgtggactatggtgcaacagcagaagagctggaagctcactttcatgg
A0A2R9A2Q3_BCL2L2-      aatgtggactatggtgcaacagcagaagagctggaagctcactttcatgg
A0A2K6RW35_BCL2L2-      aatgtggactatggtgcaacagcagaagagctggaagctcactttcatgg
A0A2K5HEJ9_BCL2L2-      aatgtggactatggtgcaacagcagaagagctggaagctcactttcatgg
A0A2K5HEJ9_BCL2L2-      aatgtggactatggtgcaacagcagaagagctggaagctcactttcatgg
A0A8I5U2F2_BCL2L2-      --------------------------------------------------
A0A2K5CWY6_BCL2L2-      aatgtggactatggtgcaacagcagaagagctggaagctcactttcatgg
A0A8I5U2F2_BCL2L2-      aatgtggactatggtgcaacagcggaagagctggaagctcactttcatgg
A0A2K6RW35_BCL2L2-      agtgctgacggggg------------------------------------
A0A2K6RW35_BCL2L2-      agtgctgacggggg------------------------------------
A0A2K6ME72_BCL2L2-      agtgctgacggggg------------------------------------
A0A2R9A2Q3_BCL2L2-      agtgctgacggggg------------------------------------
A0A2K5MZX9_BCL2L2-      agtgctgacggggg------------------------------------
A0A2K6EA59_BCL2L2-      agtgctgacggggg------------------------------------
A0A2K6RW35_BCL2L2-      aatgtggactatggtgcaacagcagaagagctggaagctcactttcatgg
A0A2K6ME72_BCL2L2-      aatgtggactatggtgcaacagcagaagagctggaagctcactttcatgg
A0A8D2FJU1_BCL2L2-      agtgctgacggggg------------------------------------
A0A8D2FJU1_BCL2L2-      aatgtggactatggtgcaacagcagaagagctggaagctcactttcatgg
A0A8C9H679_BCL2L2-      agtgctgacggggg------------------------------------
A0A8C9H679_BCL2L2-      --------------------------------------------------
A0A2I3MUE4_BCL2L2-      agtgctgacggggg------------------------------------
A0A2I3GEA7_BCL2L2-      agtgctgacggggg------------------------------------
A0A2I3GEA7_BCL2L2-      aatgtggactatggtgcaacagcagaagagctggaagctcactttcatgg
A0A2K6AI25_BCL2L2-      aatgtggactatggtgcaacagcagaagagctggaagctcactttcatgg
A0A2K6AI25_BCL2L2-      agtgctgacggggg------------------------------------
F7G4L5_BCL2L2-02        aatgtggactatggtgcaacagcagaagagctggaagctcactttcatgg
F7G4L5_BCL2L2-01        agtgctgacggggg------------------------------------
A0A2K5V0Q3_BCL2L2-      agggccaatcacggagc---------------------------------
A0A2K5V0Q3_BCL2L2-      aatgtggactatggtgcaacagcagaagagctggaagctcactttcatgg
A0A2K5V0Q3_BCL2L2-      aatgtggactatggtgcaacagcagaagagctggaagctcactttcatgg
A0A2K5V0Q3_BCL2L2-      aatgtggactatggtgcaacagcagaagagctggaagctcactttcatgg
A0A2K5V0Q3_BCL2L2-      aatgtggactatggtgcaacagcagaagagctggaagctcactttcatgg
A0A2K5V0Q3_BCL2L2-      aatgtggactatggtgcaacagcagaagagctggaagctcactttcatgg
A0A2K5V0Q3_BCL2L2-      agtgctgacggggg------------------------------------
G3V4B7_BCL2L2-08        agtgctgacggggg------------------------------------
G3V4B7_BCL2L2-07        --------------------------------------------------
G3V4B7_BCL2L2-06        agtgctgacggggg------------------------------------
G3V4B7_BCL2L2-05        agtgctgacggggg------------------------------------
G3V4B7_BCL2L2-04        att-----------------------------------------------
G3V4B7_BCL2L2-03        agtgctgacggggg------------------------------------
G3V4B7_BCL2L2-02        agtgctgacggggg------------------------------------
A0A2I2YPX6_BCL2L2-      agtgctgacggggg------------------------------------
A0A2I2YPX6_BCL2L2-      aatgtggactatggtgcaacagcagaagagctggaagctcactttcatgg
A0A2K5HEJ9_BCL2L2-      agtgctgacggggg------------------------------------
A0A0D9RU30_BCL2L2-      agtgctgacggggg------------------------------------
G3V4B7_BCL2L2-01        --------------------------------------------------
G3V4B7_BCL2L2-09        --------------------------------------------------
                                                                          

H3AAS7_BCL2L2-02        ---------------ctgtggcg----------ctaggggcggtg-atga
H3AAS7_BCL2L2-01        ---------------ctgtggcg----------ctaggggcggtg-atga
Q6GP82_BCL2L2-01        ---------------cggtagct----------ctgggtgctttg-atga
A0A8C5PJB3_BCL2L2-      ---------------cagtcgcc----------ttgggtgctctg-atga
A0A4X2LP96_BCL2L2-      --------------------------------------------------
A0A5F8HG85_BCL2L2-      ttgtggttcagttaatcgagtta----------ccatcctttgtg-acaa
A0A5F8HG85_BCL2L2-      ttgtggttcagttaatcgagtta----------ccatcctttgtg-acaa
A0A5F8HG85_BCL2L2-      ttgtggttcagttaatcgagtta----------ccatcctttgtg-acaa
F7G6M3_BCL2L2-01        ---------------ccgtggcg----------ctgggagccctg-gtga
G1Q051_BCL2L2-01        ---------------ccctggca----------ctaagggccttg-ttaa
G1TV33_BCL2L2-01        ---------------ccgtggca----------ctgggggccctg-gtaa
D3Z5F7_BCL2L2-01        ctgtggttcagtcaaccgtgtta----------ctatactctgtg-acaa
G3V4B7_BCL2L2-10        ---------------ccgtggca----------ctgggggccctg-----
A0A6I9LUT0_BCL2L2-      ---------------ccgtggcc----------ctgggggccctg-gtta
A0A8C3X592_BCL2L2-      ---------------ccgtggca----------ctgggggccctg-gtaa
A0A3Q9B4M8_BCL2L2-      ---------------ccgtggca----------ctgggggccctg-gtaa
A0A7T8CLX7_BCL2L2-      ---------------ccgtggca----------ctgggggccctg-gtaa
A0A8D0TJQ9_BCL2L2-      ---------------ccgtggca----------ctgggggccctg-gtaa
A0A4X1SF60_BCL2L2-      ---------------ccgtggca----------ctgggggccctg-gtaa
A0A4X1SF63_BCL2L2-      ---------------ccgtggca----------ctgggggccctg-gtaa
A0A8C0Q5E6_BCL2L2-      ---------------ccgtggca----------ctgggggccctg-gtca
A0A8I3MNK9_BCL2L2-      ---------------ccgtggca----------ctgggggccctg-gtca
A0A8I3RSU6_BCL2L2-      ---------------ccgtggca----------ctgggggccctg-gtca
A0A673VAY7_BCL2L2-      ---------------ccgtggca----------ctgggggccctg-gtaa
A0A2I2UAE3_BCL2L2-      ---------------ccgtggca----------ctgggggccctg-gtaa
A0A8C8XCR9_BCL2L2-      ---------------ccgtggca----------ctgggggccctg-gtaa
A0A8C9J3S1_BCL2L2-      ---------------ccgtggca----------ctgggggccctg-gtaa
M3Y5X5_BCL2L2-01        ---------------ccgtggca----------ctgggggccctg-gtaa
A0A8C7EW82_BCL2L2-      ---------------ccgtggca----------ctgggggccctg-gtaa
A0A452SHI1_BCL2L2-      ---------------ccgtggca----------ctgggggccctg-gtaa
A0A384DPS8_BCL2L2-      ---------------ccgtggca----------ctgggggccctg-gtaa
A0A8C4LWK5_BCL2L2-      ---------------ccgtggca----------ttgggggccctg-gtaa
A0A8C6BK57_BCL2L2-      ---------------ccgtggca----------ctgggggccctg-gtaa
A0A8C9CXQ5_BCL2L2-      ---------------ccgtggca----------ctgggggccctg-gtaa
A0A8B8WSS7_BCL2L2-      ---------------ccgtggca----------ctgggggccctg-gtaa
W5QDH4_BCL2L2-02        ---------------ccgtggcactttcgctagctgagggctctg-g---
A0A8C6CUC2_BCL2L2-      ---------------ccgtggca----------ctgggggccctg-gtga
A0A452ECF0_BCL2L2-      ---------------ctgtggca----------ctgggggccctg-gtaa
A0A4W2D6A3_BCL2L2-      ---------------ctgtggca----------ctgggggccctg-gtaa
A0A4W2D6A3_BCL2L2-      ---------------ctgtggca----------ctgggggccctg-gtaa
A0A4W2GUJ7_BCL2L2-      ---------------ctgtggca----------ctgggggccctg-gtaa
A0A4W2GUJ7_BCL2L2-      ---------------ctgtggca----------ctgggggccctg-gtaa
A0A8B9WT05_BCL2L2-      ---------------ctgtggca----------ctgggggccctg-gtaa
A0A4W2D6A3_BCL2L2-      ---------------ctgtggca----------ctgggggccctg-gtaa
A0A4W2D6A3_BCL2L2-      ---------------ctgtggca----------ctgggggccctg-gtaa
A0A4W2GUJ7_BCL2L2-      ---------------ctgtggca----------ctgggggccctg-gtaa
A0A4W2GUJ7_BCL2L2-      ---------------ctgtggca----------ctgggggccctg-gtaa
Q05KI8_BCL2L2-01        ---------------ctgtggca----------ctgggggccctg-gtaa
A0A8C2VJ88_BCL2L2-      ---------------ctctg--a----------ttggcagctggg-acag
A0A286XQQ9_BCL2L2-      ---------------ccgtggca----------ctgggggccctg-gtaa
A0A8C2VJ88_BCL2L2-      ---------------ctgtggca----------ctgggggccctg-gtaa
A0A8D2APK0_BCL2L2-      ---------------ccgtggca----------ctgggggccctg-gtaa
A0A287D9B3_BCL2L2-      ---------------gcatgggg----------ctga-------------
A0A8D2HGM1_BCL2L2-      ---------------ccgtggca----------ctgggggccctg-gtaa
A0A287D9B3_BCL2L2-      ---------------ccgtggca----------ctgggggccctg-gtaa
A0A8C9PGU3_BCL2L2-      ---------------ccgtggca----------ctgggggccctg-gtaa
W5QDH4_BCL2L2-01        ctgtggttcagtcaaccgcgtta----------ctatactctgtg-acaa
A0A4W2GUJ7_BCL2L2-      ctgtggttcagtcaaccgcgtaa----------ctatactctgtg-acaa
A0A4W2GUJ7_BCL2L2-      ctgtggttcagtcaaccgcgtaa----------ctatactctgtg-acaa
A0A4W2D6A3_BCL2L2-      ctgtggttcagtcaaccgcgtaa----------ctatactctgtg-acaa
A0A4W2GUJ7_BCL2L2-      ctgtggttcagtcaaccgcgtaa----------ctatactctgtg-acaa
A0A4W2D6A3_BCL2L2-      ctgtggttcagtcaaccgcgtaa----------ctatactctgtg-acaa
A0A4W2GUJ7_BCL2L2-      ctgtggttcagtcaaccgcgtaa----------ctatactctgtg-acaa
A0A4W2GUJ7_BCL2L2-      ctgtggttcagtcaaccgcgtaa----------ctatactctgtg-acaa
A0A4W2GUJ7_BCL2L2-      ctgtggttcagtcaaccgcgtaa----------ctatactctgtg-acaa
A0A5F5PML6_BCL2L2-      ctgtggttcagtcaaccgtgtta----------ccatactctgtg-acaa
A0A5F5PML6_BCL2L2-      ctgtggttcagtcaaccgtgtta----------ccatactctgtg-acaa
A0A8C5L5C6_BCL2L2-      ---------------ccgtggca----------ctgggggccctg-gtaa
A0A8C0Q5E6_BCL2L2-      ctgtggttcagtcaaccgtgtta----------ccatactctgtg-acaa
A0A8I3MNK9_BCL2L2-      ctgtggttcagtcaaccgtgtta----------ccatactctgtg-acaa
A0A8I3RSU6_BCL2L2-      ctgtggttcagtcaaccgtgtta----------ccatactctgtg-acaa
A0A8I3MNK9_BCL2L2-      ctgtggttcagtcaaccgtgtta----------ccatactctgtg-acaa
A0A667I624_BCL2L2-      ctgtggttcagtcaaccgtgtta----------ccatactttgtg-acaa
G1LKF5_BCL2L2-01        ctgtggttcagtcaatcgtgtta----------ccatactctgtg-acaa
G1LKF5_BCL2L2-02        ctgtggttcagtcaatcgtgtta----------ccatactctgtg-acaa
A0A384DPS8_BCL2L2-      ctgtggttcagtcaatcgtgtta----------ccatactctgtg-acaa
A0A384DPS8_BCL2L2-      ctgtggttcagtcaatcgtgtta----------ccatactctgtg-acaa
A0A8C6RJE0_BCL2L2-      ctgtggttcggtcaaccgtgtta----------ctatactctgtg-acaa
A0A671DWB3_BCL2L2-      ctgtggctcagtcaaccgtgtta----------ccatactctgtg-acaa
A0A250YBR2_BCL2L2-      ---------------ctgtggca----------ctgggggccctg-gtaa
A0A250YBR2_BCL2L2-      ---------------ctgtggca----------ctgggggccctg-gtaa
O88996_BCL2L2-01        ---------------ctgtggca----------ctgggggccctg-gtaa
Q7TS60_BCL2L2-01        ---------------ctgtggca----------ctgggggccctg-gtaa
A0A671DWB3_BCL2L2-      ctgtggctcagtcaaccgtgtta----------ccatactctgtg-acaa
A0A8C6RJE0_BCL2L2-      ---------------ctgtggca----------ctgggggccctg-gtaa
A0A4W2D6A3_BCL2L2-      ctgtggttcagtcaaccgcgtaa----------ctatactctgtg-acaa
A0A4W2GUJ7_BCL2L2-      ctgtggttcagtcaaccgcgtaa----------ctatactctgtg-acaa
A0A4W2D6A3_BCL2L2-      ctgtggttcagtcaaccgcgtaa----------ctatactctgtg-acaa
A0A4W2GUJ7_BCL2L2-      ctgtggttcagtcaaccgcgtaa----------ctatactctgtg-acaa
A0A8C8YZD8_BCL2L2-      ttgtggctcagtcaaccgtgtta----------ccatactgtgtg-acaa
A0A8B7FJ73_BCL2L2-      ctgtggttcagtcaaccgtgtta----------ccatactgtgtg-acaa
A0A2K6GWM6_BCL2L2-      ttgtggttcagtcaaccgtgtta----------ccatactgtgtg-acaa
A0A8D0TJQ9_BCL2L2-      -----------------------------------aggctcctt--ctca
A0A482LX62_BCL2L2-      ----gatggagccactcgtgg-----------------------g-acaa
A0A4X1SF63_BCL2L2-      ctgtggttcagtcaaccgcgtta----------ctatactctgtg-acaa
A0A4D6NWN1_BCL2L2-      ctgtggttcagtcaaccgcgtta----------ctatactctgtg-acaa
A0A4X1SF60_BCL2L2-      ctgtggttcagtcaaccgcgtta----------ctatactctgtg-acaa
A0A4X1SF63_BCL2L2-      ctgtggttcagtcaaccgcgtta----------ctatactctgtg-acaa
A0A8D0TJQ9_BCL2L2-      ctgtggttcagtcaaccgcgtta----------ctatactctgtg-acaa
A0A4X1SF60_BCL2L2-      ctgtggttcagtcaaccgcgtta----------ctatactctgtg-acaa
A0A8D0TJQ9_BCL2L2-      ctgtggttcagtcaaccgcgtta----------ctatactctgtg-acaa
H0XR82_BCL2L2-01        ---------------ccgtggca----------ctgggggccctg-gtaa
A0A4X1SF63_BCL2L2-      ctgtggttcagtcaaccgcgtta----------ctatactctgtg-acaa
A0A4X1SF63_BCL2L2-      ctgtggttcagtcaaccgcgtta----------ctatactctgtg-acaa
A0A8D0TJQ9_BCL2L2-      ctgtggttcagtcaaccgcgtta----------ctatactctgtg-acaa
A0A8B7FJ73_BCL2L2-      ---------------ccgtggca----------ctgggggccctg-gtaa
A0A2K6GWM6_BCL2L2-      ---------------ccgtggca----------ctgggggccctg-gtaa
A0A5F5PML6_BCL2L2-      ctgtggttcagtcaaccgtgtta----------ccatactctgtg-acaa
A0A8C8YZD8_BCL2L2-      ttgtggctcagtcaaccgtgtta----------ccatactgtgtg-acaa
A0A8B7FJ73_BCL2L2-      ctgtggttcagtcaaccgtgtta----------ccatactgtgtg-acaa
A0A8B7FJ73_BCL2L2-      ctgtggttcagtcaaccgtgtta----------ccatactgtgtg-acaa
A0A2K6GWM6_BCL2L2-      ttgtggttcagtcaaccgtgtta----------ccatactgtgtg-acaa
A0A2K6GWM6_BCL2L2-      ttgtggttcagtcaaccgtgtta----------ccatactgtgtg-acaa
A0A8C0Q5E6_BCL2L2-      ctgtggttcagtcaaccgtgtta----------ccatactctgtg-acaa
A0A8I3MNK9_BCL2L2-      ctgtggttcagtcaaccgtgtta----------ccatactctgtg-acaa
A0A8I3RSU6_BCL2L2-      ctgtggttcagtcaaccgtgtta----------ccatactctgtg-acaa
A0A667I624_BCL2L2-      ctgtggttcagtcaaccgtgtta----------ccatactttgtg-acaa
G1P3J2_BCL2L2-01        ---------------ccgtggca----------ctaggggccttg-gtaa
G3TMU7_BCL2L2-01        ---------------ctgtggca----------ctgggggccctg-gtaa
A0A2K6TM77_BCL2L2-      ---------------ccgtggca----------ctgggggccctg-gtaa
A0A2K6TM77_BCL2L2-      ---------------ccgtggca----------ctgggggccctg-gtaa
A0A2K5CWY6_BCL2L2-      ---------------ccgtggca----------ctgggggccctg-gtaa
A0A2K5CWY6_BCL2L2-      ---------------ccgtggca----------ctgggggccctg-gtaa
A0A2K5CWY6_BCL2L2-      ctgtggttcagtcaaccgtgtta----------ccatactctgtg-acaa
U3CRF8_BCL2L2-02        ctgtggttcagtcaaccgtgtta----------ccatactctgtg-acaa
U3CRF8_BCL2L2-03        ctgtggttcagtcaaccgtgtta----------ccatactctgtg-acaa
A0A2I3GEA7_BCL2L2-      ctgtggttcagtcaaccgtgtta----------ccatactctgtg-acaa
A0A8I5U2F2_BCL2L2-      ctgtggttcagtcaaccgtgtta----------ccatactctgtg-acaa
A0A2I2YPX6_BCL2L2-      ctgtggttcagtcaaccgtgtta----------ccatactctgtg-acaa
A0A2I2YPX6_BCL2L2-      ctgtggttcagtcaaccgtgtta----------ccatactctgtg-acaa
U3CRF8_BCL2L2-01        ctgtggttcagtcaaccgtgtta----------ccatactctgtg-acaa
A0A2K6TM77_BCL2L2-      ctgtggttcagtcaaccgtgtta----------ccatactctgtg-acaa
A0A2K6TM77_BCL2L2-      ctgtggttcagtcaaccgtgtta----------ccatactctgtg-acaa
A0A2K5V0Q3_BCL2L2-      ctgtggatcagtcaaccgtgtta----------ccatactctgtg-acaa
A0A2K6EA59_BCL2L2-      ctgtggatcagtcaaccgtgtta----------ccatactctgtg-acaa
A0A2K6EA59_BCL2L2-      ctgtggatcagtcaaccgtgtta----------ccatactctgtg-acaa
A0A2K5MZX9_BCL2L2-      ctgtggatcagtcaaccgtgtta----------ccatactctgtg-acaa
A0A2K5MZX9_BCL2L2-      ctgtggatcagtcaaccgtgtta----------ccatactctgtg-acaa
A0A2K5MZX9_BCL2L2-      ctgtggatcagtcaaccgtgtta----------ccatactctgtg-acaa
A0A2K5V0Q3_BCL2L2-      ctgtggatcagtcaaccgtgtta----------ccatactctgtg-acaa
F7G4L5_BCL2L2-03        ctgtggatcagtcaaccgtgtta----------ccatactctgtg-acaa
A0A2K6EA59_BCL2L2-      ctgtggatcagtcaaccgtgtta----------ccatactctgtg-acaa
A0A2K6AI25_BCL2L2-      ctgtggatcagtcaaccgtgtta----------ccatactctgtg-acaa
A0A8D2FJU1_BCL2L2-      ctgtggatcagtcaaccgtgtta----------ccatactctgtg-acaa
A0A2R9A2Q3_BCL2L2-      ctgtggttcagtcaaccgtgtta----------ccatactctgtg-acaa
A0A2R9A2Q3_BCL2L2-      ctgtggttcagtcaaccgtgtta----------ccatactctgtg-acaa
A0A2K6RW35_BCL2L2-      ctgtggatcagtcaaccgtgtta----------ccatactctgtg-acaa
A0A2K5HEJ9_BCL2L2-      ctgtggatcagtcaaccgtgtta----------ccatactctgtg-acaa
A0A2K5HEJ9_BCL2L2-      ctgtggatcagtcaaccgtgtta----------ccatactctgtg-acaa
A0A8I5U2F2_BCL2L2-      -----------------------------------gtgcttcctg-gtca
A0A2K5CWY6_BCL2L2-      ctgtggttcagtcaaccgtgtta----------ccatactctgtg-acaa
A0A8I5U2F2_BCL2L2-      ctgtggttcagtcaaccgtgtta----------ccatactctgtg-acaa
A0A2K6RW35_BCL2L2-      ---------------ccgtggca----------ctgggggccctg-gtaa
A0A2K6RW35_BCL2L2-      ---------------ccgtggca----------ctgggggccctg-gtaa
A0A2K6ME72_BCL2L2-      ---------------ccgtggca----------ctgggggccctg-gtaa
A0A2R9A2Q3_BCL2L2-      ---------------ccgtggca----------ctgggggccctg-gtaa
A0A2K5MZX9_BCL2L2-      ---------------ccgtggca----------ctgggggccctg-gtaa
A0A2K6EA59_BCL2L2-      ---------------ccgtggca----------ctgggggccctg-gtaa
A0A2K6RW35_BCL2L2-      ctgtggatcagtcaaccgtgtta----------ccatactctgtg-acaa
A0A2K6ME72_BCL2L2-      ctgtggatcagtcaaccgtgtta----------ccatactctgtg-acaa
A0A8D2FJU1_BCL2L2-      ---------------ccgtggca----------ctgggggccctg-gtaa
A0A8D2FJU1_BCL2L2-      ctgtggatcagtcaaccgtgtta----------ccatactctgtg-acaa
A0A8C9H679_BCL2L2-      ---------------ccgtggca----------ctgggggccctg-gtaa
A0A8C9H679_BCL2L2-      ----------------------------------------ttgtgagaaa
A0A2I3MUE4_BCL2L2-      ---------------ccgtggca----------ctgggggccctg-gtaa
A0A2I3GEA7_BCL2L2-      ---------------ccgtggca----------ctgggggccctg-gtaa
A0A2I3GEA7_BCL2L2-      ctgtggttcagtcaaccgtgtta----------ccatactctgtg-acaa
A0A2K6AI25_BCL2L2-      ctgtggatcagtcaaccgtgtta----------ccatactctgtg-acaa
A0A2K6AI25_BCL2L2-      ---------------ccgtggca----------ctgggggccctg-gtaa
F7G4L5_BCL2L2-02        ctgtggatcagtcaaccgtgtta----------ccatactctgtg-acaa
F7G4L5_BCL2L2-01        ---------------ccgtggca----------ctgggggccctg-gtaa
A0A2K5V0Q3_BCL2L2-      --------------------gtc----------ctatacttcgcg-----
A0A2K5V0Q3_BCL2L2-      ctgtggatcagtcaaccgtgtta----------ccatactctgtg-acaa
A0A2K5V0Q3_BCL2L2-      ctgtggatcagtcaaccgtgtta----------ccatactctgtg-acaa
A0A2K5V0Q3_BCL2L2-      ctgtggatcagtcaaccgtgtta----------ccatactctgtg-acaa
A0A2K5V0Q3_BCL2L2-      ctgtggatcagtcaaccgtgtta----------ccatactctgtg-acaa
A0A2K5V0Q3_BCL2L2-      ctgtggatcagtcaaccgtgtta----------ccatactctgtg-acaa
A0A2K5V0Q3_BCL2L2-      ---------------ccgtggca----------ctgggggccctg-gtaa
G3V4B7_BCL2L2-08        ---------------ccgtggca----------ctgggggccctg-gtaa
G3V4B7_BCL2L2-07        ---------------ctgcaaag----------ctggtctccagg-ggga
G3V4B7_BCL2L2-06        ---------------ccgtggca----------ctgggggccctg-gtaa
G3V4B7_BCL2L2-05        ---------------ccgtggca----------ctgggggccctg-gtaa
G3V4B7_BCL2L2-04        ---------------ccccggga----------cctttagccaagaggag
G3V4B7_BCL2L2-03        ---------------ccgtggca----------ctgggggccctg-gtaa
G3V4B7_BCL2L2-02        ---------------ccgtggca----------ctgggggccctg-gtaa
A0A2I2YPX6_BCL2L2-      ---------------ccgtggca----------ctgggggccctg-gtaa
A0A2I2YPX6_BCL2L2-      ctgtggttcagtcaaccgtgtta----------ccatactctgtg-acaa
A0A2K5HEJ9_BCL2L2-      ---------------ccgtggca----------ctgggggccctg-gtaa
A0A0D9RU30_BCL2L2-      ---------------ccgtggca----------ctgggggccctg-gtaa
G3V4B7_BCL2L2-01        --------------------------------------------------
G3V4B7_BCL2L2-09        --------------------------------------------------
                                                                          

H3AAS7_BCL2L2-02        cggtcggagcg---------------------------------------
H3AAS7_BCL2L2-01        cggtcggagcg---------------------------------------
Q6GP82_BCL2L2-01        cagtaggagcc---------------------------------------
A0A8C5PJB3_BCL2L2-      cagtgggagct---------------------------------------
A0A4X2LP96_BCL2L2-      --------------------------------------------------
A0A5F8HG85_BCL2L2-      gttcagtggccatcctaaggggtttgcatatatagaattttcagataaag
A0A5F8HG85_BCL2L2-      gttcagtggccatcctaaggggtttgcatatatagaattttcagataaag
A0A5F8HG85_BCL2L2-      gttcagtggccatcctaaggggtttgcatatatagaattttcagataaag
F7G6M3_BCL2L2-01        ccgtcggggcc---------------------------------------
G1Q051_BCL2L2-01        ctgtaggagca---------------------------------------
G1TV33_BCL2L2-01        ctgtaggggcc---------------------------------------
D3Z5F7_BCL2L2-01        atttagtggccatcccaaagggtttgcatatatagagttctcggacaaag
G3V4B7_BCL2L2-10        --gtatggagc---------------------------------------
A0A6I9LUT0_BCL2L2-      ctgtcggggcc---------------------------------------
A0A8C3X592_BCL2L2-      ctgtaggggcc---------------------------------------
A0A3Q9B4M8_BCL2L2-      ctgtaggggcc---------------------------------------
A0A7T8CLX7_BCL2L2-      ctgtaggggcc---------------------------------------
A0A8D0TJQ9_BCL2L2-      ctgtaggggcc---------------------------------------
A0A4X1SF60_BCL2L2-      ctgtaggggcc---------------------------------------
A0A4X1SF63_BCL2L2-      ctgtaggggcc---------------------------------------
A0A8C0Q5E6_BCL2L2-      ccgtaggggcc---------------------------------------
A0A8I3MNK9_BCL2L2-      ccgtaggggcc---------------------------------------
A0A8I3RSU6_BCL2L2-      ccgtaggggcc---------------------------------------
A0A673VAY7_BCL2L2-      ctgtaggagcc---------------------------------------
A0A2I2UAE3_BCL2L2-      ctgtaggggcc---------------------------------------
A0A8C8XCR9_BCL2L2-      ctgtaggggcc---------------------------------------
A0A8C9J3S1_BCL2L2-      ctgtaggggcc---------------------------------------
M3Y5X5_BCL2L2-01        ctgtaggggcc---------------------------------------
A0A8C7EW82_BCL2L2-      ctgtaggggcc---------------------------------------
A0A452SHI1_BCL2L2-      ctgtaggggcc---------------------------------------
A0A384DPS8_BCL2L2-      ctgtaggggcc---------------------------------------
A0A8C4LWK5_BCL2L2-      ctgtaggggcc---------------------------------------
A0A8C6BK57_BCL2L2-      ctgtaggggcc---------------------------------------
A0A8C9CXQ5_BCL2L2-      ctgtaggggcc---------------------------------------
A0A8B8WSS7_BCL2L2-      ctgtaggggcc---------------------------------------
W5QDH4_BCL2L2-02        ccg-------c---------------------------------------
A0A8C6CUC2_BCL2L2-      ccgtaggggcc---------------------------------------
A0A452ECF0_BCL2L2-      ccgtaggggcc---------------------------------------
A0A4W2D6A3_BCL2L2-      ctgtaggggcc---------------------------------------
A0A4W2D6A3_BCL2L2-      ctgtaggggcc---------------------------------------
A0A4W2GUJ7_BCL2L2-      ctgtaggggcc---------------------------------------
A0A4W2GUJ7_BCL2L2-      ctgtaggggcc---------------------------------------
A0A8B9WT05_BCL2L2-      ctgtaggggcc---------------------------------------
A0A4W2D6A3_BCL2L2-      ctgtaggggcc---------------------------------------
A0A4W2D6A3_BCL2L2-      ctgtaggggcc---------------------------------------
A0A4W2GUJ7_BCL2L2-      ctgtaggggcc---------------------------------------
A0A4W2GUJ7_BCL2L2-      ctgtaggggcc---------------------------------------
Q05KI8_BCL2L2-01        ctgtaggggcc---------------------------------------
A0A8C2VJ88_BCL2L2-      ctg-----------------------------------------------
A0A286XQQ9_BCL2L2-      ctgtaggggcc---------------------------------------
A0A8C2VJ88_BCL2L2-      ctgtaggggcc---------------------------------------
A0A8D2APK0_BCL2L2-      ctgtaggggcc---------------------------------------
A0A287D9B3_BCL2L2-      --------------------------------------------------
A0A8D2HGM1_BCL2L2-      ctgtaggggcc---------------------------------------
A0A287D9B3_BCL2L2-      ctgtaggggcc---------------------------------------
A0A8C9PGU3_BCL2L2-      ctgtaggggcc---------------------------------------
W5QDH4_BCL2L2-01        atttagtggccatcccaaagggtttgcgtatatagagttctcagacaaag
A0A4W2GUJ7_BCL2L2-      atttagtggccatccgaaagggtttgcgtatatagagttctcagacaaag
A0A4W2GUJ7_BCL2L2-      atttagtggccatccgaaagggtttgcgtatatagagttctcagacaaag
A0A4W2D6A3_BCL2L2-      atttagtggccatccgaaagggtttgcgtatatagagttctcagacaaag
A0A4W2GUJ7_BCL2L2-      atttagtggccatccgaaagggtttgcgtatatagagttctcagacaaag
A0A4W2D6A3_BCL2L2-      atttagtggccatccgaaagggtttgcgtatatagagttctcagacaaag
A0A4W2GUJ7_BCL2L2-      atttagtggccatccgaaagggtttgcgtatatagagttctcagacaaag
A0A4W2GUJ7_BCL2L2-      atttagtggccatccgaaagggtttgcgtatatagagttctcagacaaag
A0A4W2GUJ7_BCL2L2-      atttagtggccatccgaaagggtttgcgtatatagagttctcagacaaag
A0A5F5PML6_BCL2L2-      atttagtggccatcccaaagggtttgcatatatagagttctcagacaaag
A0A5F5PML6_BCL2L2-      atttagtggccatcccaaagggtttgcatatatagagttctcagacaaag
A0A8C5L5C6_BCL2L2-      ctgtaggggcc---------------------------------------
A0A8C0Q5E6_BCL2L2-      atttagtggccatcctaaaggttttgcgtatatagagttctcagacaaag
A0A8I3MNK9_BCL2L2-      atttagtggccatcctaaaggttttgcgtatatagagttctcagacaaag
A0A8I3RSU6_BCL2L2-      atttagtggccatcctaaaggttttgcgtatatagagttctcagacaaag
A0A8I3MNK9_BCL2L2-      atttagtggccatcctaaaggttttgcgtatatagagttctcagacaaag
A0A667I624_BCL2L2-      atttagtggccatcctaaagggtttgcatatatagagttctcagacaaag
G1LKF5_BCL2L2-01        atttagtggccatcctaaagggtttgcatatatagagttctcagataaag
G1LKF5_BCL2L2-02        atttagtggccatcctaaagggtttgcatatatagagttctcagataaag
A0A384DPS8_BCL2L2-      atttagtggccatcctaaagggtttgcatatatagagttctcagataaag
A0A384DPS8_BCL2L2-      atttagtggccatcctaaagggtttgcatatatagagttctcagataaag
A0A8C6RJE0_BCL2L2-      atttagtggccatcccaaagggtttgcatatatagagttctcagacaaag
A0A671DWB3_BCL2L2-      atttagtggccaccccaaagggtttgcatatatagagttctcagacaaag
A0A250YBR2_BCL2L2-      ctgtaggggcc---------------------------------------
A0A250YBR2_BCL2L2-      ctgtaggggcc---------------------------------------
O88996_BCL2L2-01        ctgtaggggcc---------------------------------------
Q7TS60_BCL2L2-01        ctgtaggggcc---------------------------------------
A0A671DWB3_BCL2L2-      atttagtggccaccccaaagggtttgcatatatagagttctcagacaaag
A0A8C6RJE0_BCL2L2-      ctgtaggggcc---------------------------------------
A0A4W2D6A3_BCL2L2-      atttagtggccatccgaaagggtttgcgtatatagagttctcagacaaag
A0A4W2GUJ7_BCL2L2-      atttagtggccatccgaaagggtttgcgtatatagagttctcagacaaag
A0A4W2D6A3_BCL2L2-      atttagtggccatccgaaagggtttgcgtatatagagttctcagacaaag
A0A4W2GUJ7_BCL2L2-      atttagtggccatccgaaagggtttgcgtatatagagttctcagacaaag
A0A8C8YZD8_BCL2L2-      atttagtggccatcccaaagggtttgcatatatagagttctcagacaaag
A0A8B7FJ73_BCL2L2-      atttagtggccatcccaaagggtttgcatatatagagttctcagacaaag
A0A2K6GWM6_BCL2L2-      atttagtggccatcccaaagggtttgcatatatagagttctcagacaaag
A0A8D0TJQ9_BCL2L2-      tttaaatggccacctcac--------------------------------
A0A482LX62_BCL2L2-      gtgcaggagt----------------------------------------
A0A4X1SF63_BCL2L2-      atttagtggccatcccaaagggtttgcatatatagagttctcagacaaag
A0A4D6NWN1_BCL2L2-      atttagtggccatcccaaagggtttgcatatatagagttctcagacaaag
A0A4X1SF60_BCL2L2-      atttagtggccatcccaaagggtttgcatatatagagttctcagacaaag
A0A4X1SF63_BCL2L2-      atttagtggccatcccaaagggtttgcatatatagagttctcagacaaag
A0A8D0TJQ9_BCL2L2-      atttagtggccatcccaaagggtttgcatatatagagttctcagacaaag
A0A4X1SF60_BCL2L2-      atttagtggccatcccaaagggtttgcatatatagagttctcagacaaag
A0A8D0TJQ9_BCL2L2-      atttagtggccatcccaaagggtttgcatatatagagttctcagacaaag
H0XR82_BCL2L2-01        ctgtaggggcc---------------------------------------
A0A4X1SF63_BCL2L2-      atttagtggccatcccaaagggtttgcatatatagagttctcagacaaag
A0A4X1SF63_BCL2L2-      atttagtggccatcccaaagggtttgcatatatagagttctcagacaaag
A0A8D0TJQ9_BCL2L2-      atttagtggccatcccaaagggtttgcatatatagagttctcagacaaag
A0A8B7FJ73_BCL2L2-      ctgtaggggcc---------------------------------------
A0A2K6GWM6_BCL2L2-      ctgtaggggcc---------------------------------------
A0A5F5PML6_BCL2L2-      atttagtggccatcccaaagggtttgcatatatagagttctcagacaaag
A0A8C8YZD8_BCL2L2-      atttagtggccatcccaaagggtttgcatatatagagttctcagacaaag
A0A8B7FJ73_BCL2L2-      atttagtggccatcccaaagggtttgcatatatagagttctcagacaaag
A0A8B7FJ73_BCL2L2-      atttagtggccatcccaaagggtttgcatatatagagttctcagacaaag
A0A2K6GWM6_BCL2L2-      atttagtggccatcccaaagggtttgcatatatagagttctcagacaaag
A0A2K6GWM6_BCL2L2-      atttagtggccatcccaaagggtttgcatatatagagttctcagacaaag
A0A8C0Q5E6_BCL2L2-      atttagtggccatcctaaaggttttgcgtatatagagttctcagacaaag
A0A8I3MNK9_BCL2L2-      atttagtggccatcctaaaggttttgcgtatatagagttctcagacaaag
A0A8I3RSU6_BCL2L2-      atttagtggccatcctaaaggttttgcgtatatagagttctcagacaaag
A0A667I624_BCL2L2-      atttagtggccatcctaaagggtttgcatatatagagttctcagacaaag
G1P3J2_BCL2L2-01        ctgtaggagca---------------------------------------
G3TMU7_BCL2L2-01        ctgtaggggcc---------------------------------------
A0A2K6TM77_BCL2L2-      ctgtaggggcc---------------------------------------
A0A2K6TM77_BCL2L2-      ctgtaggggcc---------------------------------------
A0A2K5CWY6_BCL2L2-      ctgtaggggcc---------------------------------------
A0A2K5CWY6_BCL2L2-      ctgtaggggcc---------------------------------------
A0A2K5CWY6_BCL2L2-      atttagtggccatcccaaagggtttgcatatatagagttctcagacaaag
U3CRF8_BCL2L2-02        atttagtggccatcccaaagggtttgcatatatagagttctcagacaaag
U3CRF8_BCL2L2-03        atttagtggccatcccaaagggtttgcatatatagagttctcagacaaag
A0A2I3GEA7_BCL2L2-      atttagtggccatcccaaagggtttgcatatatagagttctcagacaaag
A0A8I5U2F2_BCL2L2-      atttagtggccatcccaaagggtttgcatatatagagttctcagacaaag
A0A2I2YPX6_BCL2L2-      atttagtggccatcccaaagggtttgcatatatagagttctcagacaaag
A0A2I2YPX6_BCL2L2-      atttagtggccatcccaaagggtttgcatatatagagttctcagacaaag
U3CRF8_BCL2L2-01        atttagtggccatcccaaagggtttgcatatatagagttctcagacaaag
A0A2K6TM77_BCL2L2-      atttagtggccatcccaaagggtttgcatatatagagttctcagacaaag
A0A2K6TM77_BCL2L2-      atttagtggccatcccaaagggtttgcatatatagagttctcagacaaag
A0A2K5V0Q3_BCL2L2-      atttagtggccatcccaaaggatttgcgtatatagagttctcagacaaag
A0A2K6EA59_BCL2L2-      atttagtggccatcccaaaggatttgcgtatatagagttctcagacaaag
A0A2K6EA59_BCL2L2-      atttagtggccatcccaaaggatttgcgtatatagagttctcagacaaag
A0A2K5MZX9_BCL2L2-      atttagtggccatcccaaaggatttgcgtatatagagttctcagacaaag
A0A2K5MZX9_BCL2L2-      atttagtggccatcccaaaggatttgcgtatatagagttctcagacaaag
A0A2K5MZX9_BCL2L2-      atttagtggccatcccaaaggatttgcgtatatagagttctcagacaaag
A0A2K5V0Q3_BCL2L2-      atttagtggccatcccaaaggatttgcgtatatagagttctcagacaaag
F7G4L5_BCL2L2-03        atttagtggccatcccaaaggatttgcgtatatagagttctcagacaaag
A0A2K6EA59_BCL2L2-      atttagtggccatcccaaaggatttgcgtatatagagttctcagacaaag
A0A2K6AI25_BCL2L2-      atttagtggccatcccaaaggatttgcgtatatagagttctcagacaaag
A0A8D2FJU1_BCL2L2-      atttagtggccatcccaaaggatttgcgtatatagagttctcagacaaag
A0A2R9A2Q3_BCL2L2-      atttagtggccatcccaaagggtttgcgtatatagagttctcagacaaag
A0A2R9A2Q3_BCL2L2-      atttagtggccatcccaaagggtttgcgtatatagagttctcagacaaag
A0A2K6RW35_BCL2L2-      atttagtggccatcccaaagggtttgcgtatatagagttctcagacaaag
A0A2K5HEJ9_BCL2L2-      atttagtggccatcccaaagggtttgcgtatatagagttctcagacaaag
A0A2K5HEJ9_BCL2L2-      atttagtggccatcccaaagggtttgcgtatatagagttctcagacaaag
A0A8I5U2F2_BCL2L2-      agatacaag-----------------------------------------
A0A2K5CWY6_BCL2L2-      atttagtggccatcccaaagggtttgcatatatagagttctcagacaaag
A0A8I5U2F2_BCL2L2-      atttagtggccatcccaaagggtttgcatatatagagttctcagacaaag
A0A2K6RW35_BCL2L2-      ctgtaggggcc---------------------------------------
A0A2K6RW35_BCL2L2-      ctgtaggggcc---------------------------------------
A0A2K6ME72_BCL2L2-      ctgtaggggcc---------------------------------------
A0A2R9A2Q3_BCL2L2-      ctgtaggggcc---------------------------------------
A0A2K5MZX9_BCL2L2-      ctgtaggggcc---------------------------------------
A0A2K6EA59_BCL2L2-      ctgtaggggcc---------------------------------------
A0A2K6RW35_BCL2L2-      atttagtggccatcccaaagggtttgcgtatatagagttctcagacaaag
A0A2K6ME72_BCL2L2-      atttagtggccatcccaaagggtttgcgtatatagagttctcagacaaag
A0A8D2FJU1_BCL2L2-      ctgtaggggcc---------------------------------------
A0A8D2FJU1_BCL2L2-      atttagtggccatcccaaaggatttgcgtatatagagttctcagacaaag
A0A8C9H679_BCL2L2-      ctgtaggggcc---------------------------------------
A0A8C9H679_BCL2L2-      aagtgggggtga--------------------------------------
A0A2I3MUE4_BCL2L2-      ctgtaggggcc---------------------------------------
A0A2I3GEA7_BCL2L2-      ctgtaggggcc---------------------------------------
A0A2I3GEA7_BCL2L2-      atttagtggccatcccaaagggtttgcatatatagagttctcagacaaag
A0A2K6AI25_BCL2L2-      atttagtggccatcccaaaggatttgcgtatatagagttctcagacaaag
A0A2K6AI25_BCL2L2-      ctgtaggggcc---------------------------------------
F7G4L5_BCL2L2-02        atttagtggccatcccaaaggatttgcgtatatagagttctcagacaaag
F7G4L5_BCL2L2-01        ctgtaggggcc---------------------------------------
A0A2K5V0Q3_BCL2L2-      -------ggcc---------------------------------------
A0A2K5V0Q3_BCL2L2-      atttagtggccatcccaaaggatttgcgtatatagagttctcagacaaag
A0A2K5V0Q3_BCL2L2-      atttagtggccatcccaaaggatttgcgtatatagagttctcagacaaag
A0A2K5V0Q3_BCL2L2-      atttagtggccatcccaaaggatttgcgtatatagagttctcagacaaag
A0A2K5V0Q3_BCL2L2-      atttagtggccatcccaaaggatttgcgtatatagagttctcagacaaag
A0A2K5V0Q3_BCL2L2-      atttagtggccatcccaaaggatttgcgtatatagagttctcagacaaag
A0A2K5V0Q3_BCL2L2-      ctgtaggggcc---------------------------------------
G3V4B7_BCL2L2-08        ctgtaggggcc---------------------------------------
G3V4B7_BCL2L2-07        agatgggggct---------------------------------------
G3V4B7_BCL2L2-06        ctgtaggggcc---------------------------------------
G3V4B7_BCL2L2-05        ctgtaggggcc---------------------------------------
G3V4B7_BCL2L2-04        ctgcagggacc---------------------------------------
G3V4B7_BCL2L2-03        ctgtaggggcc---------------------------------------
G3V4B7_BCL2L2-02        ctgtaggggcc---------------------------------------
A0A2I2YPX6_BCL2L2-      ctgtaggggcc---------------------------------------
A0A2I2YPX6_BCL2L2-      atttagtggccatcccaaagggtttgcatatatagagttctcagacaaag
A0A2K5HEJ9_BCL2L2-      ctgtaggggcc---------------------------------------
A0A0D9RU30_BCL2L2-      ctgtaggggcc---------------------------------------
G3V4B7_BCL2L2-01        --------------------------------------------------
G3V4B7_BCL2L2-09        --------------------------------------------------
                                                                          

H3AAS7_BCL2L2-02        --------------------------------------------------
H3AAS7_BCL2L2-01        --------------------------------------------------
Q6GP82_BCL2L2-01        --------------------------------------------------
A0A8C5PJB3_BCL2L2-      --------------------------------------------------
A0A4X2LP96_BCL2L2-      -------------------ggcctt-------------------------
A0A5F8HG85_BCL2L2-      attcagtcaggacgtcgatggccttggatgattctcttttcagaggaaga
A0A5F8HG85_BCL2L2-      attcagtcaggacgtcgatggccttggatgattctcttttcagaggaaga
A0A5F8HG85_BCL2L2-      attcagtcaggacgtcgatggccttggatgattctcttttcagaggaaga
F7G6M3_BCL2L2-01        --------------------------------------------------
G1Q051_BCL2L2-01        --------------------------------------------------
G1TV33_BCL2L2-01        --------------------------------------------------
D3Z5F7_BCL2L2-01        agtcagtgaggacgtccctggccttagatgagtccctgttcagaggaaga
G3V4B7_BCL2L2-10        -----------acactcttcacccta------------------------
A0A6I9LUT0_BCL2L2-      --------------------------------------------------
A0A8C3X592_BCL2L2-      --------------------------------------------------
A0A3Q9B4M8_BCL2L2-      --------------------------------------------------
A0A7T8CLX7_BCL2L2-      --------------------------------------------------
A0A8D0TJQ9_BCL2L2-      --------------------------------------------------
A0A4X1SF60_BCL2L2-      --------------------------------------------------
A0A4X1SF63_BCL2L2-      --------------------------------------------------
A0A8C0Q5E6_BCL2L2-      --------------------------------------------------
A0A8I3MNK9_BCL2L2-      --------------------------------------------------
A0A8I3RSU6_BCL2L2-      --------------------------------------------------
A0A673VAY7_BCL2L2-      --------------------------------------------------
A0A2I2UAE3_BCL2L2-      --------------------------------------------------
A0A8C8XCR9_BCL2L2-      --------------------------------------------------
A0A8C9J3S1_BCL2L2-      --------------------------------------------------
M3Y5X5_BCL2L2-01        --------------------------------------------------
A0A8C7EW82_BCL2L2-      --------------------------------------------------
A0A452SHI1_BCL2L2-      --------------------------------------------------
A0A384DPS8_BCL2L2-      --------------------------------------------------
A0A8C4LWK5_BCL2L2-      --------------------------------------------------
A0A8C6BK57_BCL2L2-      --------------------------------------------------
A0A8C9CXQ5_BCL2L2-      --------------------------------------------------
A0A8B8WSS7_BCL2L2-      --------------------------------------------------
W5QDH4_BCL2L2-02        --------------------------------------------------
A0A8C6CUC2_BCL2L2-      --------------------------------------------------
A0A452ECF0_BCL2L2-      --------------------------------------------------
A0A4W2D6A3_BCL2L2-      --------------------------------------------------
A0A4W2D6A3_BCL2L2-      --------------------------------------------------
A0A4W2GUJ7_BCL2L2-      --------------------------------------------------
A0A4W2GUJ7_BCL2L2-      --------------------------------------------------
A0A8B9WT05_BCL2L2-      --------------------------------------------------
A0A4W2D6A3_BCL2L2-      --------------------------------------------------
A0A4W2D6A3_BCL2L2-      --------------------------------------------------
A0A4W2GUJ7_BCL2L2-      --------------------------------------------------
A0A4W2GUJ7_BCL2L2-      --------------------------------------------------
Q05KI8_BCL2L2-01        --------------------------------------------------
A0A8C2VJ88_BCL2L2-      --------------------------------------------------
A0A286XQQ9_BCL2L2-      --------------------------------------------------
A0A8C2VJ88_BCL2L2-      --------------------------------------------------
A0A8D2APK0_BCL2L2-      --------------------------------------------------
A0A287D9B3_BCL2L2-      --------------------------------------------------
A0A8D2HGM1_BCL2L2-      --------------------------------------------------
A0A287D9B3_BCL2L2-      --------------------------------------------------
A0A8C9PGU3_BCL2L2-      --------------------------------------------------
W5QDH4_BCL2L2-01        agtcagtgaggacttccctggccttagatgaatccttatttagaggaaga
A0A4W2GUJ7_BCL2L2-      agtcagtgaggacttccctggccttagatgaatccttatttagaggaaga
A0A4W2GUJ7_BCL2L2-      agtcagtgaggacttccctggccttagatgaatccttatttagaggaaga
A0A4W2D6A3_BCL2L2-      agtcagtgaggacttccctggccttagatgaatccttatttagaggaaga
A0A4W2GUJ7_BCL2L2-      agtcagtgaggacttccctggccttagatgaatccttatttagaggaaga
A0A4W2D6A3_BCL2L2-      agtcagtgaggacttccctggccttagatgaatccttatttagaggaaga
A0A4W2GUJ7_BCL2L2-      agtcagtgaggacttccctggccttagatgaatccttatttagaggaaga
A0A4W2GUJ7_BCL2L2-      agtcagtgaggacttccctggccttagatgaatccttatttagaggaaga
A0A4W2GUJ7_BCL2L2-      agtcagtgaggacttccctggccttagatgaatccttatttagaggaaga
A0A5F5PML6_BCL2L2-      aatcagtgaggacttccctggccttagatgagtccctatttagaggaagg
A0A5F5PML6_BCL2L2-      aatcagtgaggacttccctggccttagatgagtccctatttagaggaagg
A0A8C5L5C6_BCL2L2-      --------------------------------------------------
A0A8C0Q5E6_BCL2L2-      agtcagtgaggacttccttggccttagatgagtcactatttagaggaaga
A0A8I3MNK9_BCL2L2-      agtcagtgaggacttccttggccttagatgagtcactatttagaggaaga
A0A8I3RSU6_BCL2L2-      agtcagtgaggacttccttggccttagatgagtcactatttagaggaaga
A0A8I3MNK9_BCL2L2-      agtcagtgaggacttccttggccttagatgagtcactatttagaggaaga
A0A667I624_BCL2L2-      agtcagtgaggacttccttggccttagatgagtccctatttagaggaaga
G1LKF5_BCL2L2-01        agtcagtgaggacttccttggccttagatgagtccctatttagaggaaga
G1LKF5_BCL2L2-02        agtcagtgaggacttccttggccttagatgagtccctatttagaggaaga
A0A384DPS8_BCL2L2-      agtcagtgaggacttccttggccttagatgagtccctgtttagaggaaga
A0A384DPS8_BCL2L2-      agtcagtgaggacttccttggccttagatgagtccctgtttagaggaaga
A0A8C6RJE0_BCL2L2-      agtcagtgaggacttccctggccttagatgagtctctgtttagaggaaga
A0A671DWB3_BCL2L2-      agtcagtgaggacttccctggccttagatgagtccctgtttagaggaaga
A0A250YBR2_BCL2L2-      --------------------------------------------------
A0A250YBR2_BCL2L2-      --------------------------------------------------
O88996_BCL2L2-01        --------------------------------------------------
Q7TS60_BCL2L2-01        --------------------------------------------------
A0A671DWB3_BCL2L2-      agtcagtgaggacttccctggccttagatgagtccctgtttagaggaaga
A0A8C6RJE0_BCL2L2-      --------------------------------------------------
A0A4W2D6A3_BCL2L2-      agtcagtgaggacttccctggccttagatgaatccttatttagaggaaga
A0A4W2GUJ7_BCL2L2-      agtcagtgaggacttccctggccttagatgaatccttatttagaggaaga
A0A4W2D6A3_BCL2L2-      agtcagtgaggacttccctggccttagatgaatccttatttagaggaaga
A0A4W2GUJ7_BCL2L2-      agtcagtgaggacttccctggccttagatgaatccttatttagaggaaga
A0A8C8YZD8_BCL2L2-      agtcagtgaggacttccctggccttagatgagtccctatttagaggaaga
A0A8B7FJ73_BCL2L2-      agtcagtgaggacttccctggccttagatgagtccctatttagaggaaga
A0A2K6GWM6_BCL2L2-      agtcagtgaggacttccctggccttagatgagtccctgtttagaggaaga
A0A8D0TJQ9_BCL2L2-      --------------------------------------------------
A0A482LX62_BCL2L2-      --------------------------------------------------
A0A4X1SF63_BCL2L2-      agtcagtgaggacttccttggccttagatgagtccctatttagaggaaga
A0A4D6NWN1_BCL2L2-      agtcagtgaggacttccttggccttagatgagtccctatttagaggaaga
A0A4X1SF60_BCL2L2-      agtcagtgaggacttccttggccttagatgagtccctatttagaggaaga
A0A4X1SF63_BCL2L2-      agtcagtgaggacttccttggccttagatgagtccctatttagaggaaga
A0A8D0TJQ9_BCL2L2-      agtcagtgaggacttccttggccttagatgagtccctatttagaggaaga
A0A4X1SF60_BCL2L2-      agtcagtgaggacttccttggccttagatgagtccctatttagaggaaga
A0A8D0TJQ9_BCL2L2-      agtcagtgaggacttccttggccttagatgagtccctatttagaggaaga
H0XR82_BCL2L2-01        --------------------------------------------------
A0A4X1SF63_BCL2L2-      agtcagtgaggacttccttggccttagatgagtccctatttagaggaaga
A0A4X1SF63_BCL2L2-      agtcagtgaggacttccttggccttagatgagtccctatttagaggaaga
A0A8D0TJQ9_BCL2L2-      agtcagtgaggacttccttggccttagatgagtccctatttagaggaaga
A0A8B7FJ73_BCL2L2-      --------------------------------------------------
A0A2K6GWM6_BCL2L2-      --------------------------------------------------
A0A5F5PML6_BCL2L2-      aatcagtgaggacttccctggccttagatgagtccctatttagaggaagg
A0A8C8YZD8_BCL2L2-      agtcagtgaggacttccctggccttagatgagtccctatttagaggaaga
A0A8B7FJ73_BCL2L2-      agtcagtgaggacttccctggccttagatgagtccctatttagaggaaga
A0A8B7FJ73_BCL2L2-      agtcagtgaggacttccctggccttagatgagtccctatttagaggaaga
A0A2K6GWM6_BCL2L2-      agtcagtgaggacttccctggccttagatgagtccctgtttagaggaaga
A0A2K6GWM6_BCL2L2-      agtcagtgaggacttccctggccttagatgagtccctgtttagaggaaga
A0A8C0Q5E6_BCL2L2-      agtcagtgaggacttccttggccttagatgagtcactatttagaggaaga
A0A8I3MNK9_BCL2L2-      agtcagtgaggacttccttggccttagatgagtcactatttagaggaaga
A0A8I3RSU6_BCL2L2-      agtcagtgaggacttccttggccttagatgagtcactatttagaggaaga
A0A667I624_BCL2L2-      agtcagtgaggacttccttggccttagatgagtccctatttagaggaaga
G1P3J2_BCL2L2-01        --------------------------------------------------
G3TMU7_BCL2L2-01        --------------------------------------------------
A0A2K6TM77_BCL2L2-      --------------------------------------------------
A0A2K6TM77_BCL2L2-      --------------------------------------------------
A0A2K5CWY6_BCL2L2-      --------------------------------------------------
A0A2K5CWY6_BCL2L2-      --------------------------------------------------
A0A2K5CWY6_BCL2L2-      agtcagtgaggacttccttggccttagatgagtccctatttagaggaagg
U3CRF8_BCL2L2-02        agtcagtgaggacttccttggccttagatgagtccctatttagaggaagg
U3CRF8_BCL2L2-03        agtcagtgaggacttccttggccttagatgagtccctatttagaggaagg
A0A2I3GEA7_BCL2L2-      agtcagtgaggacttccttggccttagatgagtccctgtttagaggaagg
A0A8I5U2F2_BCL2L2-      agtcagtgaggacttccttggccttagatgagtccctatttagaggaagg
A0A2I2YPX6_BCL2L2-      agtcagtgaggacttccttggccttagatgagtccctatttagaggaagg
A0A2I2YPX6_BCL2L2-      agtcagtgaggacttccttggccttagatgagtccctatttagaggaagg
U3CRF8_BCL2L2-01        agtcagtgaggacttccttggccttagatgagtccctatttagaggaagg
A0A2K6TM77_BCL2L2-      agtcagtgaggacttccttggccttagacgagtccctatttagaggacgg
A0A2K6TM77_BCL2L2-      agtcagtgaggacttccttggccttagacgagtccctatttagaggacgg
A0A2K5V0Q3_BCL2L2-      agtcagtgaggacttccttggccttagatgagtccctatttagaggaagg
A0A2K6EA59_BCL2L2-      agtcagtgaggacttccttggccttagatgagtccctatttagaggaagg
A0A2K6EA59_BCL2L2-      agtcagtgaggacttccttggccttagatgagtccctatttagaggaagg
A0A2K5MZX9_BCL2L2-      agtcagtgaggacttccttggccttagatgagtccctatttagaggaagg
A0A2K5MZX9_BCL2L2-      agtcagtgaggacttccttggccttagatgagtccctatttagaggaagg
A0A2K5MZX9_BCL2L2-      agtcagtgaggacttccttggccttagatgagtccctatttagaggaagg
A0A2K5V0Q3_BCL2L2-      agtcagtgaggacttccttggccttagatgagtccctatttagaggaagg
F7G4L5_BCL2L2-03        agtcagtgaggacttccttggccttagatgagtccctatttagaggaagg
A0A2K6EA59_BCL2L2-      agtcagtgaggacttccttggccttagatgagtccctatttagaggaagg
A0A2K6AI25_BCL2L2-      agtcagtgaggacttccttggccttagatgagtccctatttagaggaagg
A0A8D2FJU1_BCL2L2-      agtcagtgaggacttccttggccttagatgagtccctatttagaggaagg
A0A2R9A2Q3_BCL2L2-      agtcagtgaggacttccttggccttagatgagtccctatttagaggaagg
A0A2R9A2Q3_BCL2L2-      agtcagtgaggacttccttggccttagatgagtccctatttagaggaagg
A0A2K6RW35_BCL2L2-      agtcagtgaggacttccttggccttagatgagtccctatttagaggaagg
A0A2K5HEJ9_BCL2L2-      agtcagtgaggacgtccttggccttagatgagtccctatttagaggaagg
A0A2K5HEJ9_BCL2L2-      agtcagtgaggacgtccttggccttagatgagtccctatttagaggaagg
A0A8I5U2F2_BCL2L2-      --------------------------------------------------
A0A2K5CWY6_BCL2L2-      agtcagtgaggacttccttggccttagatgagtccctatttagaggaagg
A0A8I5U2F2_BCL2L2-      agtcagtgaggacttccttggccttagatgagtccctatttagaggaagg
A0A2K6RW35_BCL2L2-      --------------------------------------------------
A0A2K6RW35_BCL2L2-      --------------------------------------------------
A0A2K6ME72_BCL2L2-      --------------------------------------------------
A0A2R9A2Q3_BCL2L2-      --------------------------------------------------
A0A2K5MZX9_BCL2L2-      --------------------------------------------------
A0A2K6EA59_BCL2L2-      --------------------------------------------------
A0A2K6RW35_BCL2L2-      agtcagtgaggacttccttggccttagatgagtccctatttagaggaagg
A0A2K6ME72_BCL2L2-      agtcagtgaggacttccttggccttagatgagtccctatttagaggaagg
A0A8D2FJU1_BCL2L2-      --------------------------------------------------
A0A8D2FJU1_BCL2L2-      agtcagtgaggacttccttggccttagatgagtccctatttagaggaagg
A0A8C9H679_BCL2L2-      --------------------------------------------------
A0A8C9H679_BCL2L2-      --------------------------------------------------
A0A2I3MUE4_BCL2L2-      --------------------------------------------------
A0A2I3GEA7_BCL2L2-      --------------------------------------------------
A0A2I3GEA7_BCL2L2-      agtcagtgaggacttccttggccttagatgagtccctgtttagaggaagg
A0A2K6AI25_BCL2L2-      agtcagtgaggacttccttggccttagatgagtccctatttagaggaagg
A0A2K6AI25_BCL2L2-      --------------------------------------------------
F7G4L5_BCL2L2-02        agtcagtgaggacttccttggccttagatgagtccctatttagaggaagg
F7G4L5_BCL2L2-01        --------------------------------------------------
A0A2K5V0Q3_BCL2L2-      --------------------------------------------------
A0A2K5V0Q3_BCL2L2-      agtcagtgaggacttccttggccttagatgagtccctatttagaggaagg
A0A2K5V0Q3_BCL2L2-      agtcagtgaggacttccttggccttagatgagtccctatttagaggaagg
A0A2K5V0Q3_BCL2L2-      agtcagtgaggacttccttggccttagatgagtccctatttagaggaagg
A0A2K5V0Q3_BCL2L2-      agtcagtgaggacttccttggccttagatgagtccctatttagaggaagg
A0A2K5V0Q3_BCL2L2-      agtcagtgaggacttccttggccttagatgagtccctatttagaggaagg
A0A2K5V0Q3_BCL2L2-      --------------------------------------------------
G3V4B7_BCL2L2-08        --------------------------------------------------
G3V4B7_BCL2L2-07        --------------------------------------------------
G3V4B7_BCL2L2-06        --------------------------------------------------
G3V4B7_BCL2L2-05        --------------------------------------------------
G3V4B7_BCL2L2-04        --------------------------------------------------
G3V4B7_BCL2L2-03        --------------------------------------------------
G3V4B7_BCL2L2-02        --------------------------------------------------
A0A2I2YPX6_BCL2L2-      --------------------------------------------------
A0A2I2YPX6_BCL2L2-      agtcagtgaggacttccttggccttagatgagtccctatttagaggaagg
A0A2K5HEJ9_BCL2L2-      --------------------------------------------------
A0A0D9RU30_BCL2L2-      --------------------------------------------------
G3V4B7_BCL2L2-01        --------------------------------------------------
G3V4B7_BCL2L2-09        --------------------------------------------------
                                                                          

H3AAS7_BCL2L2-02        --------------------------------------------------
H3AAS7_BCL2L2-01        --------------------------------------------------
Q6GP82_BCL2L2-01        --------------------------------------------------
A0A8C5PJB3_BCL2L2-      --------------------------------------------------
A0A4X2LP96_BCL2L2-      --------------------------------------------------
A0A5F8HG85_BCL2L2-      cagatca---------------------------------------aagt
A0A5F8HG85_BCL2L2-      cagatca---------------------------------------aagt
A0A5F8HG85_BCL2L2-      cagatca---------------------------------------aagt
F7G6M3_BCL2L2-01        --------------------------------------------------
G1Q051_BCL2L2-01        --------------------------------------------------
G1TV33_BCL2L2-01        --------------------------------------------------
D3Z5F7_BCL2L2-01        caaatca---------------------------------------aggt
G3V4B7_BCL2L2-10        --------------------------------------------------
A0A6I9LUT0_BCL2L2-      --------------------------------------------------
A0A8C3X592_BCL2L2-      --------------------------------------------------
A0A3Q9B4M8_BCL2L2-      --------------------------------------------------
A0A7T8CLX7_BCL2L2-      --------------------------------------------------
A0A8D0TJQ9_BCL2L2-      --------------------------------------------------
A0A4X1SF60_BCL2L2-      --------------------------------------------------
A0A4X1SF63_BCL2L2-      --------------------------------------------------
A0A8C0Q5E6_BCL2L2-      --------------------------------------------------
A0A8I3MNK9_BCL2L2-      --------------------------------------------------
A0A8I3RSU6_BCL2L2-      --------------------------------------------------
A0A673VAY7_BCL2L2-      --------------------------------------------------
A0A2I2UAE3_BCL2L2-      --------------------------------------------------
A0A8C8XCR9_BCL2L2-      --------------------------------------------------
A0A8C9J3S1_BCL2L2-      --------------------------------------------------
M3Y5X5_BCL2L2-01        --------------------------------------------------
A0A8C7EW82_BCL2L2-      --------------------------------------------------
A0A452SHI1_BCL2L2-      --------------------------------------------------
A0A384DPS8_BCL2L2-      --------------------------------------------------
A0A8C4LWK5_BCL2L2-      --------------------------------------------------
A0A8C6BK57_BCL2L2-      --------------------------------------------------
A0A8C9CXQ5_BCL2L2-      --------------------------------------------------
A0A8B8WSS7_BCL2L2-      --------------------------------------------------
W5QDH4_BCL2L2-02        --------------------------------------------------
A0A8C6CUC2_BCL2L2-      --------------------------------------------------
A0A452ECF0_BCL2L2-      --------------------------------------------------
A0A4W2D6A3_BCL2L2-      --------------------------------------------------
A0A4W2D6A3_BCL2L2-      --------------------------------------------------
A0A4W2GUJ7_BCL2L2-      --------------------------------------------------
A0A4W2GUJ7_BCL2L2-      --------------------------------------------------
A0A8B9WT05_BCL2L2-      --------------------------------------------------
A0A4W2D6A3_BCL2L2-      --------------------------------------------------
A0A4W2D6A3_BCL2L2-      --------------------------------------------------
A0A4W2GUJ7_BCL2L2-      --------------------------------------------------
A0A4W2GUJ7_BCL2L2-      --------------------------------------------------
Q05KI8_BCL2L2-01        --------------------------------------------------
A0A8C2VJ88_BCL2L2-      --------------------------------------------------
A0A286XQQ9_BCL2L2-      --------------------------------------------------
A0A8C2VJ88_BCL2L2-      --------------------------------------------------
A0A8D2APK0_BCL2L2-      --------------------------------------------------
A0A287D9B3_BCL2L2-      --------------------------------------------------
A0A8D2HGM1_BCL2L2-      --------------------------------------------------
A0A287D9B3_BCL2L2-      --------------------------------------------------
A0A8C9PGU3_BCL2L2-      --------------------------------------------------
W5QDH4_BCL2L2-01        cagatca---------------------------------------aggt
A0A4W2GUJ7_BCL2L2-      cagatca---------------------------------------aggt
A0A4W2GUJ7_BCL2L2-      cagatca---------------------------------------aggt
A0A4W2D6A3_BCL2L2-      cagatca---------------------------------------aggt
A0A4W2GUJ7_BCL2L2-      cagatca---------------------------------------aggt
A0A4W2D6A3_BCL2L2-      cagatca---------------------------------------aggt
A0A4W2GUJ7_BCL2L2-      cagatca---------------------------------------aggt
A0A4W2GUJ7_BCL2L2-      cagatca---------------------------------------aggt
A0A4W2GUJ7_BCL2L2-      cagatca---------------------------------------aggt
A0A5F5PML6_BCL2L2-      caaatca---------------------------------------aggt
A0A5F5PML6_BCL2L2-      caaatca---------------------------------------aggt
A0A8C5L5C6_BCL2L2-      --------------------------------------------------
A0A8C0Q5E6_BCL2L2-      caaatca---------------------------------------aggt
A0A8I3MNK9_BCL2L2-      caaatca---------------------------------------aggt
A0A8I3RSU6_BCL2L2-      caaatca---------------------------------------aggt
A0A8I3MNK9_BCL2L2-      caaatca---------------------------------------aggt
A0A667I624_BCL2L2-      caaatca---------------------------------------aggt
G1LKF5_BCL2L2-01        caaatca---------------------------------------aggt
G1LKF5_BCL2L2-02        caaatca---------------------------------------aggt
A0A384DPS8_BCL2L2-      caaatca---------------------------------------aggt
A0A384DPS8_BCL2L2-      caaatca---------------------------------------aggt
A0A8C6RJE0_BCL2L2-      caaatca---------------------------------------aggt
A0A671DWB3_BCL2L2-      caaatca---------------------------------------aggt
A0A250YBR2_BCL2L2-      --------------------------------------------------
A0A250YBR2_BCL2L2-      --------------------------------------------------
O88996_BCL2L2-01        --------------------------------------------------
Q7TS60_BCL2L2-01        --------------------------------------------------
A0A671DWB3_BCL2L2-      caaatca---------------------------------------aggt
A0A8C6RJE0_BCL2L2-      --------------------------------------------------
A0A4W2D6A3_BCL2L2-      cagatca---------------------------------------aggt
A0A4W2GUJ7_BCL2L2-      cagatca---------------------------------------aggt
A0A4W2D6A3_BCL2L2-      cagatca---------------------------------------aggt
A0A4W2GUJ7_BCL2L2-      cagatca---------------------------------------aggt
A0A8C8YZD8_BCL2L2-      caaatca---------------------------------------aggt
A0A8B7FJ73_BCL2L2-      caaatca---------------------------------------aggt
A0A2K6GWM6_BCL2L2-      caaatcaaggtaagcctgtgctttccattgtacatcctttactctcaggt
A0A8D0TJQ9_BCL2L2-      --------------------------------------------------
A0A482LX62_BCL2L2-      --------------------------------------------------
A0A4X1SF63_BCL2L2-      caaatca---------------------------------------aggt
A0A4D6NWN1_BCL2L2-      caaatca---------------------------------------aggt
A0A4X1SF60_BCL2L2-      caaatca---------------------------------------aggt
A0A4X1SF63_BCL2L2-      caaatca---------------------------------------aggt
A0A8D0TJQ9_BCL2L2-      caaatca---------------------------------------aggt
A0A4X1SF60_BCL2L2-      caaatca---------------------------------------aggt
A0A8D0TJQ9_BCL2L2-      caaatca---------------------------------------aggt
H0XR82_BCL2L2-01        --------------------------------------------------
A0A4X1SF63_BCL2L2-      caaatca---------------------------------------aggt
A0A4X1SF63_BCL2L2-      caaatca---------------------------------------aggt
A0A8D0TJQ9_BCL2L2-      caaatca---------------------------------------aggt
A0A8B7FJ73_BCL2L2-      --------------------------------------------------
A0A2K6GWM6_BCL2L2-      --------------------------------------------------
A0A5F5PML6_BCL2L2-      caaatca---------------------------------------aggt
A0A8C8YZD8_BCL2L2-      caaatca---------------------------------------aggt
A0A8B7FJ73_BCL2L2-      caaatca---------------------------------------aggt
A0A8B7FJ73_BCL2L2-      caaatca---------------------------------------aggt
A0A2K6GWM6_BCL2L2-      caaatca---------------------------------------aggt
A0A2K6GWM6_BCL2L2-      caaatca---------------------------------------aggt
A0A8C0Q5E6_BCL2L2-      caaatca---------------------------------------aggt
A0A8I3MNK9_BCL2L2-      caaatca---------------------------------------aggt
A0A8I3RSU6_BCL2L2-      caaatca---------------------------------------aggt
A0A667I624_BCL2L2-      caaatca---------------------------------------aggt
G1P3J2_BCL2L2-01        --------------------------------------------------
G3TMU7_BCL2L2-01        --------------------------------------------------
A0A2K6TM77_BCL2L2-      --------------------------------------------------
A0A2K6TM77_BCL2L2-      --------------------------------------------------
A0A2K5CWY6_BCL2L2-      --------------------------------------------------
A0A2K5CWY6_BCL2L2-      --------------------------------------------------
A0A2K5CWY6_BCL2L2-      caaatca---------------------------------------aggt
U3CRF8_BCL2L2-02        cagatca---------------------------------------aggt
U3CRF8_BCL2L2-03        cagatca---------------------------------------aggt
A0A2I3GEA7_BCL2L2-      caaatca---------------------------------------aggt
A0A8I5U2F2_BCL2L2-      caaatca---------------------------------------aggt
A0A2I2YPX6_BCL2L2-      caaatca---------------------------------------aggt
A0A2I2YPX6_BCL2L2-      caaatca---------------------------------------aggt
U3CRF8_BCL2L2-01        cagatca---------------------------------------aggt
A0A2K6TM77_BCL2L2-      caaatca---------------------------------------aggt
A0A2K6TM77_BCL2L2-      caaatcaaggttgactttaaggctttcatttattcatctctgactcaggt
A0A2K5V0Q3_BCL2L2-      caaatca---------------------------------------aggt
A0A2K6EA59_BCL2L2-      caaatca---------------------------------------aggt
A0A2K6EA59_BCL2L2-      caaatca---------------------------------------aggt
A0A2K5MZX9_BCL2L2-      caaatca---------------------------------------aggt
A0A2K5MZX9_BCL2L2-      caaatca---------------------------------------aggt
A0A2K5MZX9_BCL2L2-      caaatca---------------------------------------aggt
A0A2K5V0Q3_BCL2L2-      caaatca---------------------------------------aggt
F7G4L5_BCL2L2-03        caaatca---------------------------------------aggt
A0A2K6EA59_BCL2L2-      caaatca---------------------------------------aggt
A0A2K6AI25_BCL2L2-      caaatca---------------------------------------aggt
A0A8D2FJU1_BCL2L2-      caaatca---------------------------------------aggt
A0A2R9A2Q3_BCL2L2-      caaatca---------------------------------------aggt
A0A2R9A2Q3_BCL2L2-      caaatca---------------------------------------aggt
A0A2K6RW35_BCL2L2-      caaatca---------------------------------------aggt
A0A2K5HEJ9_BCL2L2-      caaatca---------------------------------------aggt
A0A2K5HEJ9_BCL2L2-      caaatca---------------------------------------aggt
A0A8I5U2F2_BCL2L2-      --------------------------------------------------
A0A2K5CWY6_BCL2L2-      caaatcaaggttgactttaaggctttcatttattcatctctgactcaggt
A0A8I5U2F2_BCL2L2-      caaatca---------------------------------------aggt
A0A2K6RW35_BCL2L2-      --------------------------------------------------
A0A2K6RW35_BCL2L2-      --------------------------------------------------
A0A2K6ME72_BCL2L2-      --------------------------------------------------
A0A2R9A2Q3_BCL2L2-      --------------------------------------------------
A0A2K5MZX9_BCL2L2-      --------------------------------------------------
A0A2K6EA59_BCL2L2-      --------------------------------------------------
A0A2K6RW35_BCL2L2-      caaatca---------------------------------------aggt
A0A2K6ME72_BCL2L2-      caaatca---------------------------------------aggt
A0A8D2FJU1_BCL2L2-      --------------------------------------------------
A0A8D2FJU1_BCL2L2-      caaatca---------------------------------------aggt
A0A8C9H679_BCL2L2-      --------------------------------------------------
A0A8C9H679_BCL2L2-      --------------------------------------------------
A0A2I3MUE4_BCL2L2-      --------------------------------------------------
A0A2I3GEA7_BCL2L2-      --------------------------------------------------
A0A2I3GEA7_BCL2L2-      caaatca---------------------------------------aggt
A0A2K6AI25_BCL2L2-      caaatca---------------------------------------aggt
A0A2K6AI25_BCL2L2-      --------------------------------------------------
F7G4L5_BCL2L2-02        caaatca---------------------------------------aggt
F7G4L5_BCL2L2-01        --------------------------------------------------
A0A2K5V0Q3_BCL2L2-      --------------------------------------------------
A0A2K5V0Q3_BCL2L2-      caaatca---------------------------------------aggt
A0A2K5V0Q3_BCL2L2-      caaatca---------------------------------------aggt
A0A2K5V0Q3_BCL2L2-      caaatca---------------------------------------aggt
A0A2K5V0Q3_BCL2L2-      caaatca---------------------------------------aggt
A0A2K5V0Q3_BCL2L2-      caaatca---------------------------------------aggt
A0A2K5V0Q3_BCL2L2-      --------------------------------------------------
G3V4B7_BCL2L2-08        --------------------------------------------------
G3V4B7_BCL2L2-07        --------------------------------------------------
G3V4B7_BCL2L2-06        --------------------------------------------------
G3V4B7_BCL2L2-05        --------------------------------------------------
G3V4B7_BCL2L2-04        --------------------------------------------------
G3V4B7_BCL2L2-03        --------------------------------------------------
G3V4B7_BCL2L2-02        --------------------------------------------------
A0A2I2YPX6_BCL2L2-      --------------------------------------------------
A0A2I2YPX6_BCL2L2-      caaatcaaggttgactttaaggctatcatttgttcatctctgactcaggt
A0A2K5HEJ9_BCL2L2-      --------------------------------------------------
A0A0D9RU30_BCL2L2-      --------------------------------------------------
G3V4B7_BCL2L2-01        --------------------------------------------------
G3V4B7_BCL2L2-09        --------------------------------------------------
                                                                          

H3AAS7_BCL2L2-02        ------------------------------------------------ct
H3AAS7_BCL2L2-01        ------------------------------------------------ct
Q6GP82_BCL2L2-01        ------------------------------------------------tt
A0A8C5PJB3_BCL2L2-      ------------------------------------------------ct
A0A4X2LP96_BCL2L2-      --------------------------------------------------
A0A5F8HG85_BCL2L2-      gataccaaaacggaccaataggccggggatcagcaccacagatcggggtt
A0A5F8HG85_BCL2L2-      gataccaaaacggaccaataggccggggatcagcaccacagatcggggtt
A0A5F8HG85_BCL2L2-      gataccaaaacggaccaataggccggggatcagcaccacagatcggggtt
F7G6M3_BCL2L2-01        ------------------------------------------------tt
G1Q051_BCL2L2-01        ------------------------------------------------tt
G1TV33_BCL2L2-01        ------------------------------------------------tt
D3Z5F7_BCL2L2-01        gattcccaaacgaaccaacagaccaggcatcagcacaacagaccggggtt
G3V4B7_BCL2L2-10        ----------------------------ccctctaccacaggacacatat
A0A6I9LUT0_BCL2L2-      ------------------------------------------------tt
A0A8C3X592_BCL2L2-      ------------------------------------------------tt
A0A3Q9B4M8_BCL2L2-      ------------------------------------------------tt
A0A7T8CLX7_BCL2L2-      ------------------------------------------------tt
A0A8D0TJQ9_BCL2L2-      ------------------------------------------------tt
A0A4X1SF60_BCL2L2-      ------------------------------------------------tt
A0A4X1SF63_BCL2L2-      ------------------------------------------------tt
A0A8C0Q5E6_BCL2L2-      ------------------------------------------------tt
A0A8I3MNK9_BCL2L2-      ------------------------------------------------tt
A0A8I3RSU6_BCL2L2-      ------------------------------------------------tt
A0A673VAY7_BCL2L2-      ------------------------------------------------tt
A0A2I2UAE3_BCL2L2-      ------------------------------------------------tt
A0A8C8XCR9_BCL2L2-      ------------------------------------------------tt
A0A8C9J3S1_BCL2L2-      ------------------------------------------------tt
M3Y5X5_BCL2L2-01        ------------------------------------------------tt
A0A8C7EW82_BCL2L2-      ------------------------------------------------tt
A0A452SHI1_BCL2L2-      ------------------------------------------------tt
A0A384DPS8_BCL2L2-      ------------------------------------------------tt
A0A8C4LWK5_BCL2L2-      ------------------------------------------------tt
A0A8C6BK57_BCL2L2-      ------------------------------------------------tt
A0A8C9CXQ5_BCL2L2-      ------------------------------------------------tt
A0A8B8WSS7_BCL2L2-      ------------------------------------------------tt
W5QDH4_BCL2L2-02        ------------------------------------------------tt
A0A8C6CUC2_BCL2L2-      ------------------------------------------------tt
A0A452ECF0_BCL2L2-      ------------------------------------------------tt
A0A4W2D6A3_BCL2L2-      ------------------------------------------------tt
A0A4W2D6A3_BCL2L2-      ------------------------------------------------tt
A0A4W2GUJ7_BCL2L2-      ------------------------------------------------tt
A0A4W2GUJ7_BCL2L2-      ------------------------------------------------tt
A0A8B9WT05_BCL2L2-      ------------------------------------------------tt
A0A4W2D6A3_BCL2L2-      ------------------------------------------------tt
A0A4W2D6A3_BCL2L2-      ------------------------------------------------tt
A0A4W2GUJ7_BCL2L2-      ------------------------------------------------tt
A0A4W2GUJ7_BCL2L2-      ------------------------------------------------tt
Q05KI8_BCL2L2-01        ------------------------------------------------tt
A0A8C2VJ88_BCL2L2-      --------------------------------------------------
A0A286XQQ9_BCL2L2-      ------------------------------------------------tt
A0A8C2VJ88_BCL2L2-      ------------------------------------------------tt
A0A8D2APK0_BCL2L2-      ------------------------------------------------tt
A0A287D9B3_BCL2L2-      --------------------------------------------------
A0A8D2HGM1_BCL2L2-      ------------------------------------------------tt
A0A287D9B3_BCL2L2-      ------------------------------------------------tt
A0A8C9PGU3_BCL2L2-      ------------------------------------------------tt
W5QDH4_BCL2L2-01        gatccctaaacgaaccaacagaccaggcatcagcacaacagaccgaggtt
A0A4W2GUJ7_BCL2L2-      gatccctaaacgaaccaacagaccaggcatcagcacaacagaccgaggct
A0A4W2GUJ7_BCL2L2-      gatccctaaacgaaccaacagaccaggcatcagcacaacagaccgaggct
A0A4W2D6A3_BCL2L2-      gatccctaaacgaaccaacagaccaggcatcagcacaacagaccgaggct
A0A4W2GUJ7_BCL2L2-      gatccctaaacgaaccaacagaccaggcatcagcacaacagaccgaggct
A0A4W2D6A3_BCL2L2-      gatccctaaacgaaccaacagaccaggcatcagcacaacagaccgaggct
A0A4W2GUJ7_BCL2L2-      gatccctaaacgaaccaacagaccaggcatcagcacaacagaccgaggct
A0A4W2GUJ7_BCL2L2-      gatccctaaacgaaccaacagaccaggcatcagcacaacagaccgaggct
A0A4W2GUJ7_BCL2L2-      gatccctaaacgaaccaacagaccaggcatcagcacaacagaccgaggct
A0A5F5PML6_BCL2L2-      gatccctaaacgaaccaacagaccaggcatcagtacaacagaccggggtt
A0A5F5PML6_BCL2L2-      gatccctaaacgaaccaacagaccaggcatcagtacaacagaccggggtt
A0A8C5L5C6_BCL2L2-      ------------------------------------------------tt
A0A8C0Q5E6_BCL2L2-      gatcccaaaacgaaccaacagaccaggcatcagcacaacagaccggggtt
A0A8I3MNK9_BCL2L2-      gatcccaaaacgaaccaacagaccaggcatcagcacaacagaccggggtt
A0A8I3RSU6_BCL2L2-      gatcccaaaacgaaccaacagaccaggcatcagcacaacagaccggggtt
A0A8I3MNK9_BCL2L2-      gatcccaaaacgaaccaacagaccaggcatcagcacaacagaccggggtt
A0A667I624_BCL2L2-      gatcccaaaacgaaccaacagaccaggcatcagcacaacagaccggggtt
G1LKF5_BCL2L2-01        gatcccaaaacgaaccaacagaccaggcatcagcaccacagaccggggtt
G1LKF5_BCL2L2-02        gatcccaaaacgaaccaacagaccaggcatcagcaccacagaccggggtt
A0A384DPS8_BCL2L2-      gatcccaaaacgaaccaacagaccaggcatcagcacaacagaccggggtt
A0A384DPS8_BCL2L2-      gatcccaaaacgaaccaacagaccaggcatcagcacaacagaccggggtt
A0A8C6RJE0_BCL2L2-      gatccccaaacgaaccaacagaccaggtatcagcacaacagaccggggct
A0A671DWB3_BCL2L2-      gatcccaaaacgaaccaacagaccaggcatcagcacaacagaccggggtt
A0A250YBR2_BCL2L2-      ------------------------------------------------tt
A0A250YBR2_BCL2L2-      ------------------------------------------------tt
O88996_BCL2L2-01        ------------------------------------------------tt
Q7TS60_BCL2L2-01        ------------------------------------------------tt
A0A671DWB3_BCL2L2-      gatcccaaaacgaaccaacagaccaggcatcagcacaacagaccggggtt
A0A8C6RJE0_BCL2L2-      ------------------------------------------------tt
A0A4W2D6A3_BCL2L2-      gatccctaaacgaaccaacagaccaggcatcagcacaacagaccgaggct
A0A4W2GUJ7_BCL2L2-      gatccctaaacgaaccaacagaccaggcatcagcacaacagaccgaggct
A0A4W2D6A3_BCL2L2-      gatccctaaacgaaccaacagaccaggcatcagcacaacagaccgaggct
A0A4W2GUJ7_BCL2L2-      gatccctaaacgaaccaacagaccaggcatcagcacaacagaccgaggct
A0A8C8YZD8_BCL2L2-      gatcccaaaacgaaccaacagaccaggcatcagcacaacagaccggggtt
A0A8B7FJ73_BCL2L2-      gatcccaaaacgaaccaacagaccaggcatcagcacaacagaccggggtt
A0A2K6GWM6_BCL2L2-      gatcccaaaacgaaccaacagaccaggcatcagcacaacagaccggggtt
A0A8D0TJQ9_BCL2L2-      ------------------------------------------------tt
A0A482LX62_BCL2L2-      --------------------------------------------------
A0A4X1SF63_BCL2L2-      gatcccaaaacgaaccaacagaccaggcatcagcacaacagaccggggtt
A0A4D6NWN1_BCL2L2-      gatcccaaaacgaaccaacagaccaggcatcagcacaacagaccggggtt
A0A4X1SF60_BCL2L2-      gatcccaaaacgaaccaacagaccaggcatcagcacaacagaccggggtt
A0A4X1SF63_BCL2L2-      gatcccaaaacgaaccaacagaccaggcatcagcacaacagaccggggtt
A0A8D0TJQ9_BCL2L2-      gatcccaaaacgaaccaacagaccaggcatcagcacaacagaccggggtt
A0A4X1SF60_BCL2L2-      gatcccaaaacgaaccaacagaccaggcatcagcacaacagaccggggtt
A0A8D0TJQ9_BCL2L2-      gatcccaaaacgaaccaacagaccaggcatcagcacaacagaccggggtt
H0XR82_BCL2L2-01        ------------------------------------------------tt
A0A4X1SF63_BCL2L2-      gatcccaaaacgaaccaacagaccaggcatcagcacaacagaccggggtt
A0A4X1SF63_BCL2L2-      gatcccaaaacgaaccaacagaccaggcatcagcacaacagaccggggtt
A0A8D0TJQ9_BCL2L2-      gatcccaaaacgaaccaacagaccaggcatcagcacaacagaccggggtt
A0A8B7FJ73_BCL2L2-      ------------------------------------------------tt
A0A2K6GWM6_BCL2L2-      ------------------------------------------------tt
A0A5F5PML6_BCL2L2-      gatccctaaacgaaccaacagaccaggcatcagtacaacagaccggggtt
A0A8C8YZD8_BCL2L2-      gatcccaaaacgaaccaacagaccaggcatcagcacaacagaccggggtt
A0A8B7FJ73_BCL2L2-      gatcccaaaacgaaccaacagaccaggcatcagcacaacagaccggggtt
A0A8B7FJ73_BCL2L2-      gatcccaaaacgaaccaacagaccaggcatcagcacaacagaccggggtt
A0A2K6GWM6_BCL2L2-      gatcccaaaacgaaccaacagaccaggcatcagcacaacagaccggggtt
A0A2K6GWM6_BCL2L2-      gatcccaaaacgaaccaacagaccaggcatcagcacaacagaccggggtt
A0A8C0Q5E6_BCL2L2-      gatcccaaaacgaaccaacagaccaggcatcagcacaacagaccggggtt
A0A8I3MNK9_BCL2L2-      gatcccaaaacgaaccaacagaccaggcatcagcacaacagaccggggtt
A0A8I3RSU6_BCL2L2-      gatcccaaaacgaaccaacagaccaggcatcagcacaacagaccggggtt
A0A667I624_BCL2L2-      gatcccaaaacgaaccaacagaccaggcatcagcacaacagaccggggtt
G1P3J2_BCL2L2-01        ------------------------------------------------tt
G3TMU7_BCL2L2-01        ------------------------------------------------tt
A0A2K6TM77_BCL2L2-      ------------------------------------------------tt
A0A2K6TM77_BCL2L2-      ------------------------------------------------tt
A0A2K5CWY6_BCL2L2-      ------------------------------------------------tt
A0A2K5CWY6_BCL2L2-      ------------------------------------------------tt
A0A2K5CWY6_BCL2L2-      gatcccgaaacgaaccaacagaccaggcatcagcacaacagaccggggtt
U3CRF8_BCL2L2-02        gatcccaaaacgaaccaacagaccaggcatcagcacaacagaccggggtt
U3CRF8_BCL2L2-03        gatcccaaaacgaaccaacagaccaggcatcagcacaacagaccggggtt
A0A2I3GEA7_BCL2L2-      gatcccaaaacgaaccaacagaccaggcatcagcacaacagaccggggtt
A0A8I5U2F2_BCL2L2-      gatcccaaaacgaaccaacagaccaggcatcagcacaacagaccggggtt
A0A2I2YPX6_BCL2L2-      gatcccaaaacgaaccaacagaccaggcatcagcacaacagaccggggtt
A0A2I2YPX6_BCL2L2-      gatcccaaaacgaaccaacagaccaggcatcagcacaacagaccggggtt
U3CRF8_BCL2L2-01        gatcccaaaacgaaccaacagaccaggcatcagcacaacagaccggggtt
A0A2K6TM77_BCL2L2-      gatcccaaaacgaaccaacagaccaggcatcagcacaacagaccggggtt
A0A2K6TM77_BCL2L2-      gatcccaaaacgaaccaacagaccaggcatcagcacaacagaccggggtt
A0A2K5V0Q3_BCL2L2-      gatcccaaaacgaaccaacagaccaggcatcagcacaacagaccggggtt
A0A2K6EA59_BCL2L2-      gatcccaaaacgaaccaacagaccaggcatcagcacaacagaccggggtt
A0A2K6EA59_BCL2L2-      gatcccaaaacgaaccaacagaccaggcatcagcacaacagaccggggtt
A0A2K5MZX9_BCL2L2-      gatcccaaaacgaaccaacagaccaggcatcagcacaacagaccggggtt
A0A2K5MZX9_BCL2L2-      gatcccaaaacgaaccaacagaccaggcatcagcacaacagaccggggtt
A0A2K5MZX9_BCL2L2-      gatcccaaaacgaaccaacagaccaggcatcagcacaacagaccggggtt
A0A2K5V0Q3_BCL2L2-      gatcccaaaacgaaccaacagaccaggcatcagcacaacagaccggggtt
F7G4L5_BCL2L2-03        gatcccaaaacgaaccaacagaccaggcatcagcacaacagaccggggtt
A0A2K6EA59_BCL2L2-      gatcccaaaacgaaccaacagaccaggcatcagcacaacagaccggggtt
A0A2K6AI25_BCL2L2-      gatcccaaaacgaaccaacagaccaggcatcagcacaacagaccggggtt
A0A8D2FJU1_BCL2L2-      gatcccaaaacgaaccaacagaccaggcatcagcacaacagaccggggtt
A0A2R9A2Q3_BCL2L2-      gatcccaaaacgaaccaacagaccaggcatcagcacaacagaccggggtt
A0A2R9A2Q3_BCL2L2-      gatcccaaaacgaaccaacagaccaggcatcagcacaacagaccggggtt
A0A2K6RW35_BCL2L2-      gatcccaaaacgaaccaacagaccaggcatcagcacaacagaccggggtt
A0A2K5HEJ9_BCL2L2-      gatcccaaaacgaaccaacagaccaggcatcagcacaacagaccggggtt
A0A2K5HEJ9_BCL2L2-      gatcccaaaacgaaccaacagaccaggcatcagcacaacagaccggggtt
A0A8I5U2F2_BCL2L2-      ------------------------------------------------tt
A0A2K5CWY6_BCL2L2-      gatcccgaaacgaaccaacagaccaggcatcagcacaacagaccggggtt
A0A8I5U2F2_BCL2L2-      gatcccaaaacgaaccaacagaccaggcatcagcacaacagaccggggtt
A0A2K6RW35_BCL2L2-      ------------------------------------------------tt
A0A2K6RW35_BCL2L2-      ------------------------------------------------tt
A0A2K6ME72_BCL2L2-      ------------------------------------------------tt
A0A2R9A2Q3_BCL2L2-      ------------------------------------------------tt
A0A2K5MZX9_BCL2L2-      ------------------------------------------------tt
A0A2K6EA59_BCL2L2-      ------------------------------------------------tt
A0A2K6RW35_BCL2L2-      gatcccaaaacgaaccaacagaccaggcatcagcacaacagaccggggtt
A0A2K6ME72_BCL2L2-      gatcccaaaacgaaccaacagaccaggcatcagcacaacagaccggggtt
A0A8D2FJU1_BCL2L2-      ------------------------------------------------tt
A0A8D2FJU1_BCL2L2-      gatcccaaaacgaaccaacagaccaggcatcagcacaacagaccggggtt
A0A8C9H679_BCL2L2-      ------------------------------------------------tt
A0A8C9H679_BCL2L2-      --------------------------------------------------
A0A2I3MUE4_BCL2L2-      ------------------------------------------------tt
A0A2I3GEA7_BCL2L2-      ------------------------------------------------tt
A0A2I3GEA7_BCL2L2-      gatcccaaaacgaaccaacagaccaggcatcagcacaacagaccggggtt
A0A2K6AI25_BCL2L2-      gatcccaaaacgaaccaacagaccaggcatcagcacaacagaccggggtt
A0A2K6AI25_BCL2L2-      ------------------------------------------------tt
F7G4L5_BCL2L2-02        gatcccaaaacgaaccaacagaccaggcatcagcacaacagaccggggtt
F7G4L5_BCL2L2-01        ------------------------------------------------tt
A0A2K5V0Q3_BCL2L2-      --------------------------------------------------
A0A2K5V0Q3_BCL2L2-      gatcccaaaacgaaccaacagaccaggcatcagcacaacagaccggggtt
A0A2K5V0Q3_BCL2L2-      gatcccaaaacgaaccaacagaccaggcatcagcacaacagaccggggtt
A0A2K5V0Q3_BCL2L2-      gatcccaaaacgaaccaacagaccaggcatcagcacaacagaccggggtt
A0A2K5V0Q3_BCL2L2-      gatcccaaaacgaaccaacagaccaggcatcagcacaacagaccggggtt
A0A2K5V0Q3_BCL2L2-      gatcccaaaacgaaccaacagaccaggcatcagcacaacagaccggggtt
A0A2K5V0Q3_BCL2L2-      ------------------------------------------------tt
G3V4B7_BCL2L2-08        ------------------------------------------------tt
G3V4B7_BCL2L2-07        --------------------------------------------------
G3V4B7_BCL2L2-06        ------------------------------------------------tt
G3V4B7_BCL2L2-05        ------------------------------------------------tt
G3V4B7_BCL2L2-04        --------------------------------------------------
G3V4B7_BCL2L2-03        ------------------------------------------------tt
G3V4B7_BCL2L2-02        ------------------------------------------------tt
A0A2I2YPX6_BCL2L2-      ------------------------------------------------tt
A0A2I2YPX6_BCL2L2-      gatcccaaaacgaaccaacagaccaggcatcagcacaacagaccggggtt
A0A2K5HEJ9_BCL2L2-      ------------------------------------------------tt
A0A0D9RU30_BCL2L2-      ------------------------------------------------tt
G3V4B7_BCL2L2-01        --------------------------------------------------
G3V4B7_BCL2L2-09        --------------------------------------------------
                                                                          

H3AAS7_BCL2L2-02        ttttgccagcagataa----------------------------------
H3AAS7_BCL2L2-01        ttttgccagcagataa----------------------------------
Q6GP82_BCL2L2-01        gtttgccagcaagtga----------------------------------
A0A8C5PJB3_BCL2L2-      gtttgccagcaagtga----------------------------------
A0A4X2LP96_BCL2L2-      --------------------------------------------------
A0A5F8HG85_BCL2L2-      ttccacgtgcccgatatcgtgccagggctactaactacagtagttcacgc
A0A5F8HG85_BCL2L2-      ttccacgtgcccgatatcgtgccagggctactaactacagtagttcacgc
A0A5F8HG85_BCL2L2-      ttccacgtgcccgatatcgtgccagggctactaactacagtagttcacgc
F7G6M3_BCL2L2-01        cttcgcgagcaagtga----------------------------------
G1Q051_BCL2L2-01        ttttgctagcatgtga----------------------------------
G1TV33_BCL2L2-01        ttttgctagcaaatga----------------------------------
D3Z5F7_BCL2L2-01        tcccgcgctcccgataccgtgcccggactaccaactacaacagctcccga
G3V4B7_BCL2L2-10        ccctgttagca------ttccccgggacctttagccaaga----------
A0A6I9LUT0_BCL2L2-      ttttgctagcaagtga----------------------------------
A0A8C3X592_BCL2L2-      ttttgctagcaagtga----------------------------------
A0A3Q9B4M8_BCL2L2-      ttttgctagcaagtga----------------------------------
A0A7T8CLX7_BCL2L2-      ttttgctagcaagtga----------------------------------
A0A8D0TJQ9_BCL2L2-      ttttgctagcaagtga----------------------------------
A0A4X1SF60_BCL2L2-      ttttgctagcaagtga----------------------------------
A0A4X1SF63_BCL2L2-      ttttgctagcaagtga----------------------------------
A0A8C0Q5E6_BCL2L2-      ttttgcgagcaagtga----------------------------------
A0A8I3MNK9_BCL2L2-      ttttgcgagcaagtga----------------------------------
A0A8I3RSU6_BCL2L2-      ttttgcgagcaagtga----------------------------------
A0A673VAY7_BCL2L2-      ttttgctagcaagtga----------------------------------
A0A2I2UAE3_BCL2L2-      ttttgctagcaagtga----------------------------------
A0A8C8XCR9_BCL2L2-      ttttgctagcaagtga----------------------------------
A0A8C9J3S1_BCL2L2-      ttttgctagcaagtga----------------------------------
M3Y5X5_BCL2L2-01        ttttgctagcaagtga----------------------------------
A0A8C7EW82_BCL2L2-      ttttgctagcaagtga----------------------------------
A0A452SHI1_BCL2L2-      ttttgctagcaagtga----------------------------------
A0A384DPS8_BCL2L2-      ttttgctagcaagtga----------------------------------
A0A8C4LWK5_BCL2L2-      ttttgctagcaagtga----------------------------------
A0A8C6BK57_BCL2L2-      ttttgctagcaagtga----------------------------------
A0A8C9CXQ5_BCL2L2-      ttttgctagcaagtga----------------------------------
A0A8B8WSS7_BCL2L2-      ttttgctagcaagtga----------------------------------
W5QDH4_BCL2L2-02        ttttgc-agaaagt------------------------------------
A0A8C6CUC2_BCL2L2-      tttcgctagcaagtga----------------------------------
A0A452ECF0_BCL2L2-      tttcgctagcaagtga----------------------------------
A0A4W2D6A3_BCL2L2-      ttttgctagcaagtga----------------------------------
A0A4W2D6A3_BCL2L2-      ttttgctagcaagtga----------------------------------
A0A4W2GUJ7_BCL2L2-      ttttgctagcaagtga----------------------------------
A0A4W2GUJ7_BCL2L2-      ttttgctagcaagtga----------------------------------
A0A8B9WT05_BCL2L2-      ttttgctagcaagtga----------------------------------
A0A4W2D6A3_BCL2L2-      ttttgctagcaagtga----------------------------------
A0A4W2D6A3_BCL2L2-      ttttgctagcaagtga----------------------------------
A0A4W2GUJ7_BCL2L2-      ttttgctagcaagtga----------------------------------
A0A4W2GUJ7_BCL2L2-      ttttgctagcaagtga----------------------------------
Q05KI8_BCL2L2-01        ttttgctagcaagtga----------------------------------
A0A8C2VJ88_BCL2L2-      ---tgctaggaaggag----------------------------------
A0A286XQQ9_BCL2L2-      ttttgctagcaagtga----------------------------------
A0A8C2VJ88_BCL2L2-      ttttgctagcaagtga----------------------------------
A0A8D2APK0_BCL2L2-      ttttgccagcaagtga----------------------------------
A0A287D9B3_BCL2L2-      --------------------------------------------------
A0A8D2HGM1_BCL2L2-      ttttgctagcaagtga----------------------------------
A0A287D9B3_BCL2L2-      ttttgctagcaagtga----------------------------------
A0A8C9PGU3_BCL2L2-      ttttgctagcaagtga----------------------------------
W5QDH4_BCL2L2-01        tcccacgagcccgataccgtgcccgaaccaccaactacaacagttcccgc
A0A4W2GUJ7_BCL2L2-      tcccacgagcccgataccgtgcccgaaccaccaactacaacagttcccgc
A0A4W2GUJ7_BCL2L2-      tcccacgagcccgataccgtgcccgaaccaccaactacaacagttcccgc
A0A4W2D6A3_BCL2L2-      tcccacgagcccgataccgtgcccgaaccaccaactacaacagttcccgc
A0A4W2GUJ7_BCL2L2-      tcccacgagcccgataccgtgcccgaaccaccaactacaacagttcccgc
A0A4W2D6A3_BCL2L2-      tcccacgagcccgataccgtgcccgaaccaccaactacaacagttcccgc
A0A4W2GUJ7_BCL2L2-      tcccacgagcccgataccgtgcccgaaccaccaactacaacagttcccgc
A0A4W2GUJ7_BCL2L2-      tcccacgagcccgataccgtgcccgaaccaccaactacaacagttcccgc
A0A4W2GUJ7_BCL2L2-      tcccacgagcccgataccgtgcccgaaccaccaactacaacagttcccgc
A0A5F5PML6_BCL2L2-      tcccacgagcccgataccgtgccaggaccactaactacaacagttcccgc
A0A5F5PML6_BCL2L2-      tcccacgagcccgataccgtgccaggaccactaactacaacagttcccgc
A0A8C5L5C6_BCL2L2-      ttttgctagcaagtga----------------------------------
A0A8C0Q5E6_BCL2L2-      tcccacgagcccgataccgtgcccggactaccaactacaacagctcccgc
A0A8I3MNK9_BCL2L2-      tcccacgagcccgataccgtgcccggactaccaactacaacagctcccgc
A0A8I3RSU6_BCL2L2-      tcccacgagcccgataccgtgcccggactaccaactacaacagctcccgc
A0A8I3MNK9_BCL2L2-      tcccacgagcccgataccgtgcccggactaccaactacaacagctcccgc
A0A667I624_BCL2L2-      tcccacgagcccgataccgtgcccggaccaccaactacaacagttcccgc
G1LKF5_BCL2L2-01        tcccacgagcccgataccgtgcccggaccaccaactacaacagttcccgc
G1LKF5_BCL2L2-02        tcccacgagcccgataccgtgcccggaccaccaactacaacagttcccgc
A0A384DPS8_BCL2L2-      tcccacgagcccgataccgtgcccggaccaccaactacaacagttcccgc
A0A384DPS8_BCL2L2-      tcccacgagcccgataccgtgcccggaccaccaactacaacagttcccgc
A0A8C6RJE0_BCL2L2-      tcccacgtgctcgttaccgtgccaggactaccaactacaacagttcccgt
A0A671DWB3_BCL2L2-      tcccaagagcccgataccgtgcccggaccaccaactacaacagttcccgc
A0A250YBR2_BCL2L2-      ttttgctagcaagtga----------------------------------
A0A250YBR2_BCL2L2-      ttttgctagcaagtga----------------------------------
O88996_BCL2L2-01        ttttgctagcaagtga----------------------------------
Q7TS60_BCL2L2-01        ttttgctagcaagtga----------------------------------
A0A671DWB3_BCL2L2-      tcccaagagcccgataccgtgcccggaccaccaactacaacagttcccgc
A0A8C6RJE0_BCL2L2-      ttttgccagcaagtga----------------------------------
A0A4W2D6A3_BCL2L2-      tcccacgagcccgataccgtgcccgaaccaccaactacaacagttcccgc
A0A4W2GUJ7_BCL2L2-      tcccacgagcccgataccgtgcccgaaccaccaactacaacagttcccgc
A0A4W2D6A3_BCL2L2-      tcccacgagcccgataccgtgcccgaaccaccaactacaacagttcccgc
A0A4W2GUJ7_BCL2L2-      tcccacgagcccgataccgtgcccgaaccaccaactacaacagttcccgc
A0A8C8YZD8_BCL2L2-      tcccacgagcccgctaccgtgcccggactaccaactacaacagttcccgc
A0A8B7FJ73_BCL2L2-      tcccacgagcccgctaccgtgcccggactaccaactacaacagttcccgc
A0A2K6GWM6_BCL2L2-      tcccacgagcccgctaccgtgcccggactaccaactacaacagttcccgc
A0A8D0TJQ9_BCL2L2-      ctgtgcaa------------------------------------------
A0A482LX62_BCL2L2-      -------ggatggtga----------------------------------
A0A4X1SF63_BCL2L2-      ttccacgagctcgataccgtgcccggaccaccaactacaacagttcccgc
A0A4D6NWN1_BCL2L2-      ttccacgagctcgataccgtgcccggaccaccaactacaacagttcccgc
A0A4X1SF60_BCL2L2-      ttccacgagctcgataccgtgcccggaccaccaactacaacagttcccgc
A0A4X1SF63_BCL2L2-      ttccacgagctcgataccgtgcccggaccaccaactacaacagttcccgc
A0A8D0TJQ9_BCL2L2-      ttccacgagctcgataccgtgcccggaccaccaactacaacagttcccgc
A0A4X1SF60_BCL2L2-      ttccacgagctcgataccgtgcccggaccaccaactacaacagttcccgc
A0A8D0TJQ9_BCL2L2-      ttccacgagctcgataccgtgcccggaccaccaactacaacagttcccgc
H0XR82_BCL2L2-01        ttttgctagcaagtga----------------------------------
A0A4X1SF63_BCL2L2-      ttccacgagctcgataccgtgcccggaccaccaactacaacagttcccgc
A0A4X1SF63_BCL2L2-      ttccacgagctcgataccgtgcccggaccaccaactacaacagttcccgc
A0A8D0TJQ9_BCL2L2-      ttccacgagctcgataccgtgcccggaccaccaactacaacagttcccgc
A0A8B7FJ73_BCL2L2-      tttcgctagcaagtga----------------------------------
A0A2K6GWM6_BCL2L2-      tttcgctagcaagtga----------------------------------
A0A5F5PML6_BCL2L2-      tcccacgagcccgataccgtgccaggaccactaactacaacagttcccgc
A0A8C8YZD8_BCL2L2-      tcccacgagcccgctaccgtgcccggactaccaactacaacagttcccgc
A0A8B7FJ73_BCL2L2-      tcccacgagcccgctaccgtgcccggactaccaactacaacagttcccgc
A0A8B7FJ73_BCL2L2-      tcccacgagcccgctaccgtgcccggactaccaactacaacagttcccgc
A0A2K6GWM6_BCL2L2-      tcccacgagcccgctaccgtgcccggactaccaactacaacagttcccgc
A0A2K6GWM6_BCL2L2-      tcccacgagcccgctaccgtgcccggactaccaactacaacagttcccgc
A0A8C0Q5E6_BCL2L2-      tcccacgagcccgataccgtgcccggactaccaactacaacagctcccgc
A0A8I3MNK9_BCL2L2-      tcccacgagcccgataccgtgcccggactaccaactacaacagctcccgc
A0A8I3RSU6_BCL2L2-      tcccacgagcccgataccgtgcccggactaccaactacaacagctcccgc
A0A667I624_BCL2L2-      tcccacgagcccgataccgtgcccggaccaccaactacaacagttcccgc
G1P3J2_BCL2L2-01        ttttgctagcaagtga----------------------------------
G3TMU7_BCL2L2-01        ttttgctagcaagtga----------------------------------
A0A2K6TM77_BCL2L2-      ttttgctagcaagtga----------------------------------
A0A2K6TM77_BCL2L2-      ttttgctagcaagtga----------------------------------
A0A2K5CWY6_BCL2L2-      ttttgctagcaagtga----------------------------------
A0A2K5CWY6_BCL2L2-      ttttgctagcaagtga----------------------------------
A0A2K5CWY6_BCL2L2-      ttccacgagcccgctaccgcgcacggaccaccaactacaacagttcccgc
U3CRF8_BCL2L2-02        ttccacgagcccgctaccgcgcacggaccaccaactacaacagttcccgc
U3CRF8_BCL2L2-03        ttccacgagcccgctaccgcgcacggaccaccaactacaacagttcccgc
A0A2I3GEA7_BCL2L2-      ttccacgagcccgctaccgcgcccggaccaccaactacaacagttcccgc
A0A8I5U2F2_BCL2L2-      ttccacgagcccgctaccgcgcccggaccaccaactacaacagttcccgc
A0A2I2YPX6_BCL2L2-      ttccacgagcccgctaccgcgcccggaccaccaactacaacagttcccgc
A0A2I2YPX6_BCL2L2-      ttccacgagcccgctaccgcgcccggaccaccaactacaacagttcccgc
U3CRF8_BCL2L2-01        ttccacgagcccgctaccgcgcacggaccaccaactacaacagttcccgc
A0A2K6TM77_BCL2L2-      ttccacgagcccgctaccgcgcacggaccaccaactacaacagttcccgc
A0A2K6TM77_BCL2L2-      ttccacgagcccgctaccgcgcacggaccaccaactacaacagttcccgc
A0A2K5V0Q3_BCL2L2-      ttccacgagcccgctaccgcgcccggaccaccaactacaacagttcccgc
A0A2K6EA59_BCL2L2-      ttccacgagcccgctaccgcgcccggaccaccaactacaacagttcccgc
A0A2K6EA59_BCL2L2-      ttccacgagcccgctaccgcgcccggaccaccaactacaacagttcccgc
A0A2K5MZX9_BCL2L2-      ttccacgagcccgctaccgcgcccggaccaccaactacaacagttcccgc
A0A2K5MZX9_BCL2L2-      ttccacgagcccgctaccgcgcccggaccaccaactacaacagttcccgc
A0A2K5MZX9_BCL2L2-      ttccacgagcccgctaccgcgcccggaccaccaactacaacagttcccgc
A0A2K5V0Q3_BCL2L2-      ttccacgagcccgctaccgcgcccggaccaccaactacaacagttcccgc
F7G4L5_BCL2L2-03        ttccacgagcccgctaccgcgcccggaccaccaactacaacagttcccgc
A0A2K6EA59_BCL2L2-      ttccacgagcccgctaccgcgcccggaccaccaactacaacagttcccgc
A0A2K6AI25_BCL2L2-      ttccacgagcccgctaccgcgcccggaccaccaactacaacagttcccgc
A0A8D2FJU1_BCL2L2-      ttccacgagcccgctaccgcgcccggaccaccaactacaacagttcccgc
A0A2R9A2Q3_BCL2L2-      ttccacgagcccgctaccgcgcccggaccaccaactacaacagttcccgc
A0A2R9A2Q3_BCL2L2-      ttccacgagcccgctaccgcgcccggaccaccaactacaacagttcccgc
A0A2K6RW35_BCL2L2-      ttccacgagcccgctaccgcgcccggaccaccaactacaacagttcccgc
A0A2K5HEJ9_BCL2L2-      ttccacgagcccgctaccgcgcccggaccaccaactacaacagttcccgc
A0A2K5HEJ9_BCL2L2-      ttccacgagcccgctaccgcgcccggaccaccaactacaacagttcccgc
A0A8I5U2F2_BCL2L2-      tcctga--------------------------------------------
A0A2K5CWY6_BCL2L2-      ttccacgagcccgctaccgcgcacggaccaccaactacaacagttcccgc
A0A8I5U2F2_BCL2L2-      ttccacgagcccgctaccgcgcccggaccaccaactacaacagttcccgc
A0A2K6RW35_BCL2L2-      ttttgctagcaagtga----------------------------------
A0A2K6RW35_BCL2L2-      ttttgctagcaagtga----------------------------------
A0A2K6ME72_BCL2L2-      ttttgctagcaagtga----------------------------------
A0A2R9A2Q3_BCL2L2-      ttttgctagcaagtga----------------------------------
A0A2K5MZX9_BCL2L2-      ttttgctagcaagtga----------------------------------
A0A2K6EA59_BCL2L2-      ttttgctagcaagtga----------------------------------
A0A2K6RW35_BCL2L2-      ttccacgagcccgctaccgcgcccggaccaccaactacaacagttcccgc
A0A2K6ME72_BCL2L2-      ttccacgagcccgctaccgcgcccggaccaccaactacaacagttcccgc
A0A8D2FJU1_BCL2L2-      ttttgctagcaagtga----------------------------------
A0A8D2FJU1_BCL2L2-      ttccacgagcccgctaccgcgcccggaccaccaactacaacagttcccgc
A0A8C9H679_BCL2L2-      ttttgctagcaagtga----------------------------------
A0A8C9H679_BCL2L2-      --------------------------------------------------
A0A2I3MUE4_BCL2L2-      ttttgctagcaagtga----------------------------------
A0A2I3GEA7_BCL2L2-      ttttgctagcaagtga----------------------------------
A0A2I3GEA7_BCL2L2-      ttccacgagcccgctaccgcgcccggaccaccaactacaacagttcccgc
A0A2K6AI25_BCL2L2-      ttccacgagcccgctaccgcgcccggaccaccaactacaacagttcccgc
A0A2K6AI25_BCL2L2-      ttttgctagcaagtga----------------------------------
F7G4L5_BCL2L2-02        ttccacgagcccgctaccgcgcccggaccaccaactacaacagttcccgc
F7G4L5_BCL2L2-01        ttttgctagcaagtga----------------------------------
A0A2K5V0Q3_BCL2L2-      -------cgcccgtag----------------------------------
A0A2K5V0Q3_BCL2L2-      ttccacgagcccgctaccgcgcccggaccaccaactacaacagttcccgc
A0A2K5V0Q3_BCL2L2-      ttccacgagcccgctaccgcgcccggaccaccaactacaacagttcccgc
A0A2K5V0Q3_BCL2L2-      ttccacgagcccgctaccgcgcccggaccaccaactacaacagttcccgc
A0A2K5V0Q3_BCL2L2-      ttccacgagcccgctaccgcgcccggaccaccaactacaacagttcccgc
A0A2K5V0Q3_BCL2L2-      ttccacgagcccgctaccgcgcccggaccaccaactacaacagttcccgc
A0A2K5V0Q3_BCL2L2-      ttttgctagcaagtga----------------------------------
G3V4B7_BCL2L2-08        ttttgctagcaagtga----------------------------------
G3V4B7_BCL2L2-07        --------------------------------------------------
G3V4B7_BCL2L2-06        ttttgctagcaagtga----------------------------------
G3V4B7_BCL2L2-05        ttttgctagcaagtga----------------------------------
G3V4B7_BCL2L2-04        ----atggccaggtta----------------------------------
G3V4B7_BCL2L2-03        ttttgctagcaagtga----------------------------------
G3V4B7_BCL2L2-02        ttttgctagcaagtga----------------------------------
A0A2I2YPX6_BCL2L2-      ttttgctagcaagtga----------------------------------
A0A2I2YPX6_BCL2L2-      ttccacgagcccgctaccgcgcccggaccaccaactacaacagttcccgc
A0A2K5HEJ9_BCL2L2-      ttttgctagcaagtga----------------------------------
A0A0D9RU30_BCL2L2-      ttttgctagcaagtga----------------------------------
G3V4B7_BCL2L2-01        --------------------------------------------------
G3V4B7_BCL2L2-09        --------------------------------------------------
                                                                          

H3AAS7_BCL2L2-02        --------------------------------------------------
H3AAS7_BCL2L2-01        --------------------------------------------------
Q6GP82_BCL2L2-01        --------------------------------------------------
A0A8C5PJB3_BCL2L2-      --------------------------------------------------
A0A4X2LP96_BCL2L2-      -----------------ctttgccagca----------------------
A0A5F8HG85_BCL2L2-      tctcgattctatagcggcttcaacagcagaccccggggccgagtctacag
A0A5F8HG85_BCL2L2-      tctcgattctatagcggcttcaacagcagaccccggggccgagtctacag
A0A5F8HG85_BCL2L2-      tctcgattctatagcggcttcaacagcagaccccggggccgagtctacag
F7G6M3_BCL2L2-01        --------------------------------------------------
G1Q051_BCL2L2-01        --------------------------------------------------
G1TV33_BCL2L2-01        --------------------------------------------------
D3Z5F7_BCL2L2-01        tctcgattctacagtggttttaacagcaggccccggggtcgaatctacag
G3V4B7_BCL2L2-10        ----------------------------------ggagctgcagggacca
A0A6I9LUT0_BCL2L2-      --------------------------------------------------
A0A8C3X592_BCL2L2-      --------------------------------------------------
A0A3Q9B4M8_BCL2L2-      --------------------------------------------------
A0A7T8CLX7_BCL2L2-      --------------------------------------------------
A0A8D0TJQ9_BCL2L2-      --------------------------------------------------
A0A4X1SF60_BCL2L2-      --------------------------------------------------
A0A4X1SF63_BCL2L2-      --------------------------------------------------
A0A8C0Q5E6_BCL2L2-      --------------------------------------------------
A0A8I3MNK9_BCL2L2-      --------------------------------------------------
A0A8I3RSU6_BCL2L2-      --------------------------------------------------
A0A673VAY7_BCL2L2-      --------------------------------------------------
A0A2I2UAE3_BCL2L2-      --------------------------------------------------
A0A8C8XCR9_BCL2L2-      --------------------------------------------------
A0A8C9J3S1_BCL2L2-      --------------------------------------------------
M3Y5X5_BCL2L2-01        --------------------------------------------------
A0A8C7EW82_BCL2L2-      --------------------------------------------------
A0A452SHI1_BCL2L2-      --------------------------------------------------
A0A384DPS8_BCL2L2-      --------------------------------------------------
A0A8C4LWK5_BCL2L2-      --------------------------------------------------
A0A8C6BK57_BCL2L2-      --------------------------------------------------
A0A8C9CXQ5_BCL2L2-      --------------------------------------------------
A0A8B8WSS7_BCL2L2-      --------------------------------------------------
W5QDH4_BCL2L2-02        --------------------------------------------------
A0A8C6CUC2_BCL2L2-      --------------------------------------------------
A0A452ECF0_BCL2L2-      --------------------------------------------------
A0A4W2D6A3_BCL2L2-      --------------------------------------------------
A0A4W2D6A3_BCL2L2-      --------------------------------------------------
A0A4W2GUJ7_BCL2L2-      --------------------------------------------------
A0A4W2GUJ7_BCL2L2-      --------------------------------------------------
A0A8B9WT05_BCL2L2-      --------------------------------------------------
A0A4W2D6A3_BCL2L2-      --------------------------------------------------
A0A4W2D6A3_BCL2L2-      --------------------------------------------------
A0A4W2GUJ7_BCL2L2-      --------------------------------------------------
A0A4W2GUJ7_BCL2L2-      --------------------------------------------------
Q05KI8_BCL2L2-01        --------------------------------------------------
A0A8C2VJ88_BCL2L2-      --------------------------------------------------
A0A286XQQ9_BCL2L2-      --------------------------------------------------
A0A8C2VJ88_BCL2L2-      --------------------------------------------------
A0A8D2APK0_BCL2L2-      --------------------------------------------------
A0A287D9B3_BCL2L2-      --------------------------------------------------
A0A8D2HGM1_BCL2L2-      --------------------------------------------------
A0A287D9B3_BCL2L2-      --------------------------------------------------
A0A8C9PGU3_BCL2L2-      --------------------------------------------------
W5QDH4_BCL2L2-01        tctcgattctacagtggttttaacagcaggccccggggtcgcgtctacag
A0A4W2GUJ7_BCL2L2-      tctcgattctacagtggttttaacagcaggccccggggtcgcgtctaca-
A0A4W2GUJ7_BCL2L2-      tctcgattctacagtggttttaacagcaggccccggggtcgcgtctaca-
A0A4W2D6A3_BCL2L2-      tctcgattctacagtggttttaacagcaggccccggggtcgcgtctacag
A0A4W2GUJ7_BCL2L2-      tctcgattctacagtggttttaacagcaggccccggggtcgcgtctacag
A0A4W2D6A3_BCL2L2-      tctcgattctacagtggttttaacagcaggccccggggtcgcgtctacag
A0A4W2GUJ7_BCL2L2-      tctcgattctacagtggttttaacagcaggccccggggtcgcgtctacag
A0A4W2GUJ7_BCL2L2-      tctcgattctacagtggttttaacagcaggccccggggtcgcgtctacag
A0A4W2GUJ7_BCL2L2-      tctcgattctacagtggttttaacagcaggccccggggtcgcgtctacag
A0A5F5PML6_BCL2L2-      tctcgattctacagtggttttaacagcaggccccggggtcgcgtctacag
A0A5F5PML6_BCL2L2-      tctcgattctacagtggttttaacagcaggccccggggtcgcgtctacag
A0A8C5L5C6_BCL2L2-      --------------------------------------------------
A0A8C0Q5E6_BCL2L2-      tctcgattctacagtggttttaacagcaggccccggggtcgcgtctacag
A0A8I3MNK9_BCL2L2-      tctcgattctacagtggttttaacagcaggccccggggtcgcgtctacag
A0A8I3RSU6_BCL2L2-      tctcgattctacagtggttttaacagcaggccccggggtcgcgtctacag
A0A8I3MNK9_BCL2L2-      tctcgattctacagtggttttaacagcaggccccggggtcgcgtctacag
A0A667I624_BCL2L2-      tctcgattctacagtggttttaacagcaggccccggggtcgcgtctacag
G1LKF5_BCL2L2-01        tctcgattctacagtggttttaacagcaggccccggggtcgcgtctacag
G1LKF5_BCL2L2-02        tctcgattctacagtggttttaacagcaggccccggggtcgcgtctacag
A0A384DPS8_BCL2L2-      tctcgattctacagtggttttaacagcaggccccggggtcgcgtctacag
A0A384DPS8_BCL2L2-      tctcgattctacagtggttttaacagcaggccccggggtcgcgtctacag
A0A8C6RJE0_BCL2L2-      tctcgattctacagtggttttaacagcaggccccggggtcgagtctacag
A0A671DWB3_BCL2L2-      tctcgattctacagtggtttcaacagcaggccccggggtcgcgtctacag
A0A250YBR2_BCL2L2-      --------------------------------------------------
A0A250YBR2_BCL2L2-      --------------------------------------------------
O88996_BCL2L2-01        --------------------------------------------------
Q7TS60_BCL2L2-01        --------------------------------------------------
A0A671DWB3_BCL2L2-      tctcgattctacagtggtttcaacagcaggccccggggtcgcgtctacag
A0A8C6RJE0_BCL2L2-      --------------------------------------------------
A0A4W2D6A3_BCL2L2-      tctcgattctacagtggttttaacagcaggccccggggtcgcgtctaca-
A0A4W2GUJ7_BCL2L2-      tctcgattctacagtggttttaacagcaggccccggggtcgcgtctaca-
A0A4W2D6A3_BCL2L2-      tctcgattctacagtggttttaacagcaggccccggggtcgcgtctaca-
A0A4W2GUJ7_BCL2L2-      tctcgattctacagtggttttaacagcaggccccggggtcgcgtctaca-
A0A8C8YZD8_BCL2L2-      tctcgattctacagtggttttaacagcaggccccggggtcgcgtctacag
A0A8B7FJ73_BCL2L2-      tctcgattctacagtggttttaacagcaggccccggggtcgagtctacag
A0A2K6GWM6_BCL2L2-      tctcgattctacagtggttttaacagcaggccccggggtcgcgtctacag
A0A8D0TJQ9_BCL2L2-      ------------------------agttggacctag--------------
A0A482LX62_BCL2L2-      --------------------------------------------------
A0A4X1SF63_BCL2L2-      tctcgattctacagtggttttaacagcaggccccggggtcgtgtctacag
A0A4D6NWN1_BCL2L2-      tctcgattctacagtggttttaacagcaggccccggggtcgtgtctacag
A0A4X1SF60_BCL2L2-      tctcgattctacagtggttttaacagcaggccccggggtcgtgtctacag
A0A4X1SF63_BCL2L2-      tctcgattctacagtggttttaacagcaggccccggggtcgtgtctacag
A0A8D0TJQ9_BCL2L2-      tctcgattctacagtggttttaacagcaggccccggggtcgtgtctacag
A0A4X1SF60_BCL2L2-      tctcgattctacagtggttttaacagcaggccccggggtcgtgtctaca-
A0A8D0TJQ9_BCL2L2-      tctcgattctacagtggttttaacagcaggccccggggtcgtgtctaca-
H0XR82_BCL2L2-01        --------------------------------------------------
A0A4X1SF63_BCL2L2-      tctcgattctacagtggttttaacagcaggccccggggtcgtgtctacag
A0A4X1SF63_BCL2L2-      tctcgattctacagtggttttaacagcaggccccggggtcgtgtctaca-
A0A8D0TJQ9_BCL2L2-      tctcgattctacagtggttttaacagcaggccccggggtcgtgtctaca-
A0A8B7FJ73_BCL2L2-      --------------------------------------------------
A0A2K6GWM6_BCL2L2-      --------------------------------------------------
A0A5F5PML6_BCL2L2-      tctcgattctacagtggttttaacagcaggccccggggtcgcgtctacag
A0A8C8YZD8_BCL2L2-      tctcgattctacagtggttttaacagcaggccccggggtcgcgtctacag
A0A8B7FJ73_BCL2L2-      tctcgattctacagtggttttaacagcaggccccggggtcgagtctacag
A0A8B7FJ73_BCL2L2-      tctcgattctacagtggttttaacagcaggccccggggtcgagtctacag
A0A2K6GWM6_BCL2L2-      tctcgattctacagtggttttaacagcaggccccggggtcgcgtctacag
A0A2K6GWM6_BCL2L2-      tctcgattctacagtggttttaacagcaggccccggggtcgcgtctacag
A0A8C0Q5E6_BCL2L2-      tctcgattctacagtggttttaacagcaggccccggggtcgcgtctacag
A0A8I3MNK9_BCL2L2-      tctcgattctacagtggttttaacagcaggccccggggtcgcgtctacag
A0A8I3RSU6_BCL2L2-      tctcgattctacagtggttttaacagcaggccccggggtcgcgtctacag
A0A667I624_BCL2L2-      tctcgattctacagtggttttaacagcaggccccggggtcgcgtctacag
G1P3J2_BCL2L2-01        --------------------------------------------------
G3TMU7_BCL2L2-01        --------------------------------------------------
A0A2K6TM77_BCL2L2-      --------------------------------------------------
A0A2K6TM77_BCL2L2-      --------------------------------------------------
A0A2K5CWY6_BCL2L2-      --------------------------------------------------
A0A2K5CWY6_BCL2L2-      --------------------------------------------------
A0A2K5CWY6_BCL2L2-      tctcgattctacagtggttttaacagcaggccccggggtcgcgtctacag
U3CRF8_BCL2L2-02        tctcgattctacagtggttttaacagcaggccccggggtcgcgtctacag
U3CRF8_BCL2L2-03        tctcgattctacagtggttttaacagcaggccccggggtcgcgtctaca-
A0A2I3GEA7_BCL2L2-      tctcgattctacagtggttttaacagcaggccccggggtcgcgtctacag
A0A8I5U2F2_BCL2L2-      tctcgattctacagtggttttaacagcaggccccggggtcgcgtctacag
A0A2I2YPX6_BCL2L2-      tctcgattctacagtggttttaacagcaggccccggggtcgcgtctacag
A0A2I2YPX6_BCL2L2-      tctcgattctacagtggttttaacagcaggccccggggtcgcgtctacag
U3CRF8_BCL2L2-01        tctcgattctacagtggttttaacagcaggccccggggtcgcgtctacag
A0A2K6TM77_BCL2L2-      tctcgattctacagtggttttaacagcaggccccggggtcgcgtctaca-
A0A2K6TM77_BCL2L2-      tctcgattctacagtggttttaacagcaggccccggggtcgcgtctacag
A0A2K5V0Q3_BCL2L2-      tctcgattctacagtggttttaacagcaggccccggggtcgtgtctaca-
A0A2K6EA59_BCL2L2-      tctcgattctacagtggttttaacagcaggccccggggtcgtgtctacag
A0A2K6EA59_BCL2L2-      tctcgattctacagtggttttaacagcaggccccggggtcgtgtctacag
A0A2K5MZX9_BCL2L2-      tctcgattctacagtggttttaacagcaggccccggggtcgtgtctacag
A0A2K5MZX9_BCL2L2-      tctcgattctacagtggttttaacagcaggccccggggtcgtgtctacag
A0A2K5MZX9_BCL2L2-      tctcgattctacagtggttttaacagcaggccccggggtcgtgtctacag
A0A2K5V0Q3_BCL2L2-      tctcgattctacagtggttttaacagcaggccccggggtcgtgtctacag
F7G4L5_BCL2L2-03        tctcgattctacagtggttttaacagcaggccccggggtcgtgtctacag
A0A2K6EA59_BCL2L2-      tctcgattctacagtggttttaacagcaggccccggggtcgtgtctacag
A0A2K6AI25_BCL2L2-      tctcgattctacagtggttttaacagcaggccccggggtcgtgtctacag
A0A8D2FJU1_BCL2L2-      tctcgattctacagtggttttaacagcaggccccggggtcgtgtctacag
A0A2R9A2Q3_BCL2L2-      tctcgattctacagtggttttaacagcaggccccggggtcgcgtctacag
A0A2R9A2Q3_BCL2L2-      tctcgattctacagtggttttaacagcaggccccggggtcgcgtctaca-
A0A2K6RW35_BCL2L2-      tctcgcttctacagtggttttaacagcaggccccggggtcgcgtctacag
A0A2K5HEJ9_BCL2L2-      tctcgattctacagtggttttaacagcaggccccggggtcgcgtctacag
A0A2K5HEJ9_BCL2L2-      tctcgattctacagtggttttaacagcaggccccggggtcgcgtctacag
A0A8I5U2F2_BCL2L2-      --------------------------------------------------
A0A2K5CWY6_BCL2L2-      tctcgattctacagtggttttaacagcaggccccggggtcgcgtctacag
A0A8I5U2F2_BCL2L2-      tctcgattctacagtggttttaacagcaggccccggggtcgcgtctacag
A0A2K6RW35_BCL2L2-      --------------------------------------------------
A0A2K6RW35_BCL2L2-      --------------------------------------------------
A0A2K6ME72_BCL2L2-      --------------------------------------------------
A0A2R9A2Q3_BCL2L2-      --------------------------------------------------
A0A2K5MZX9_BCL2L2-      --------------------------------------------------
A0A2K6EA59_BCL2L2-      --------------------------------------------------
A0A2K6RW35_BCL2L2-      tctcgcttctacagtggttttaacagcaggccccggggtcgcgtctacag
A0A2K6ME72_BCL2L2-      tctcgcttctacagtggttttaacagcaggccccggggtcgcgtctacag
A0A8D2FJU1_BCL2L2-      --------------------------------------------------
A0A8D2FJU1_BCL2L2-      tctcgattctacagtggttttaacagcaggccccggggtcgtgtctacag
A0A8C9H679_BCL2L2-      --------------------------------------------------
A0A8C9H679_BCL2L2-      --------------------------------------------------
A0A2I3MUE4_BCL2L2-      --------------------------------------------------
A0A2I3GEA7_BCL2L2-      --------------------------------------------------
A0A2I3GEA7_BCL2L2-      tctcgattctacagtggttttaacagcaggccccggggtcgcgtctacag
A0A2K6AI25_BCL2L2-      tctcgattctacagtggttttaacagcaggccccggggtcgtgtctacag
A0A2K6AI25_BCL2L2-      --------------------------------------------------
F7G4L5_BCL2L2-02        tctcgattctacagtggttttaacagcaggccccggggtcgtgtctacag
F7G4L5_BCL2L2-01        --------------------------------------------------
A0A2K5V0Q3_BCL2L2-      --------------------------------------------------
A0A2K5V0Q3_BCL2L2-      tctcgattctacagtggttttaacagcaggccccggggtcgtgtctacag
A0A2K5V0Q3_BCL2L2-      tctcgattctacagtggttttaacagcaggccccggggtcgtgtctacag
A0A2K5V0Q3_BCL2L2-      tctcgattctacagtggttttaacagcaggccccggggtcgtgtctacag
A0A2K5V0Q3_BCL2L2-      tctcgattctacagtggttttaacagcaggccccggggtcgtgtctacag
A0A2K5V0Q3_BCL2L2-      tctcgattctacagtggttttaacagcaggccccggggtcgtgtctacag
A0A2K5V0Q3_BCL2L2-      --------------------------------------------------
G3V4B7_BCL2L2-08        --------------------------------------------------
G3V4B7_BCL2L2-07        --------------------------------------------------
G3V4B7_BCL2L2-06        --------------------------------------------------
G3V4B7_BCL2L2-05        --------------------------------------------------
G3V4B7_BCL2L2-04        --------------------------------------------------
G3V4B7_BCL2L2-03        --------------------------------------------------
G3V4B7_BCL2L2-02        --------------------------------------------------
A0A2I2YPX6_BCL2L2-      --------------------------------------------------
A0A2I2YPX6_BCL2L2-      tctcgattctacagtggttttaacagcaggccccggggtcgcgtctacag
A0A2K5HEJ9_BCL2L2-      --------------------------------------------------
A0A0D9RU30_BCL2L2-      --------------------------------------------------
G3V4B7_BCL2L2-01        --------------------------------------------------
G3V4B7_BCL2L2-09        --------------------------------------------------
                                                                          

H3AAS7_BCL2L2-02        --------------------------------------------------
H3AAS7_BCL2L2-01        --------------------------------------------------
Q6GP82_BCL2L2-01        --------------------------------------------------
A0A8C5PJB3_BCL2L2-      --------------------------------------------------
A0A4X2LP96_BCL2L2-      ------------agtga---------------------------------
A0A5F8HG85_BCL2L2-      gggccgggctagagcgacgtcatggtatt---------------------
A0A5F8HG85_BCL2L2-      gggccgggctagagcgacgtcatggt------------------------
A0A5F8HG85_BCL2L2-      gggccgggctagagcgacgtcatggtatt---------------------
F7G6M3_BCL2L2-01        --------------------------------------------------
G1Q051_BCL2L2-01        --------------------------------------------------
G1TV33_BCL2L2-01        --------------------------------------------------
D3Z5F7_BCL2L2-01        gggccgggctagagcgacatcatggtatt---------------------
G3V4B7_BCL2L2-10        tggccaggttaccaaaatgccctgctctga--------------------
A0A6I9LUT0_BCL2L2-      --------------------------------------------------
A0A8C3X592_BCL2L2-      --------------------------------------------------
A0A3Q9B4M8_BCL2L2-      --------------------------------------------------
A0A7T8CLX7_BCL2L2-      --------------------------------------------------
A0A8D0TJQ9_BCL2L2-      --------------------------------------------------
A0A4X1SF60_BCL2L2-      --------------------------------------------------
A0A4X1SF63_BCL2L2-      --------------------------------------------------
A0A8C0Q5E6_BCL2L2-      --------------------------------------------------
A0A8I3MNK9_BCL2L2-      --------------------------------------------------
A0A8I3RSU6_BCL2L2-      --------------------------------------------------
A0A673VAY7_BCL2L2-      --------------------------------------------------
A0A2I2UAE3_BCL2L2-      --------------------------------------------------
A0A8C8XCR9_BCL2L2-      --------------------------------------------------
A0A8C9J3S1_BCL2L2-      --------------------------------------------------
M3Y5X5_BCL2L2-01        --------------------------------------------------
A0A8C7EW82_BCL2L2-      --------------------------------------------------
A0A452SHI1_BCL2L2-      --------------------------------------------------
A0A384DPS8_BCL2L2-      --------------------------------------------------
A0A8C4LWK5_BCL2L2-      --------------------------------------------------
A0A8C6BK57_BCL2L2-      --------------------------------------------------
A0A8C9CXQ5_BCL2L2-      --------------------------------------------------
A0A8B8WSS7_BCL2L2-      --------------------------------------------------
W5QDH4_BCL2L2-02        --------------------------------------------------
A0A8C6CUC2_BCL2L2-      --------------------------------------------------
A0A452ECF0_BCL2L2-      --------------------------------------------------
A0A4W2D6A3_BCL2L2-      --------------------------------------------------
A0A4W2D6A3_BCL2L2-      --------------------------------------------------
A0A4W2GUJ7_BCL2L2-      --------------------------------------------------
A0A4W2GUJ7_BCL2L2-      --------------------------------------------------
A0A8B9WT05_BCL2L2-      --------------------------------------------------
A0A4W2D6A3_BCL2L2-      --------------------------------------------------
A0A4W2D6A3_BCL2L2-      --------------------------------------------------
A0A4W2GUJ7_BCL2L2-      --------------------------------------------------
A0A4W2GUJ7_BCL2L2-      --------------------------------------------------
Q05KI8_BCL2L2-01        --------------------------------------------------
A0A8C2VJ88_BCL2L2-      --------------------------------------------------
A0A286XQQ9_BCL2L2-      --------------------------------------------------
A0A8C2VJ88_BCL2L2-      --------------------------------------------------
A0A8D2APK0_BCL2L2-      --------------------------------------------------
A0A287D9B3_BCL2L2-      --------------------------------------------------
A0A8D2HGM1_BCL2L2-      --------------------------------------------------
A0A287D9B3_BCL2L2-      --------------------------------------------------
A0A8C9PGU3_BCL2L2-      --------------------------------------------------
W5QDH4_BCL2L2-01        gggccgggctagagcgacatcatggtatt---------------------
A0A4W2GUJ7_BCL2L2-      -ggtcaggatag--------------------------------------
A0A4W2GUJ7_BCL2L2-      -ggtcaggatag--------------------------------------
A0A4W2D6A3_BCL2L2-      gggccgggctagagcgacatcatggtatt---------------------
A0A4W2GUJ7_BCL2L2-      gggccgggctagagcgacatcatggtatt---------------------
A0A4W2D6A3_BCL2L2-      gggccgggctagagcgacatcatggtatt---------------------
A0A4W2GUJ7_BCL2L2-      gggccgggctagagcgacatcatggtatt---------------------
A0A4W2GUJ7_BCL2L2-      gggccgggctagagcgacatcatggtatt---------------------
A0A4W2GUJ7_BCL2L2-      gggccgggctagagcgacatcatggtatt---------------------
A0A5F5PML6_BCL2L2-      gggccgggctagagcgacatcatggagatcgtgcttgattctggtcaata
A0A5F5PML6_BCL2L2-      gggccgggctagagcgacatcatg------------gtttctg-------
A0A8C5L5C6_BCL2L2-      --------------------------------------------------
A0A8C0Q5E6_BCL2L2-      gggccgggctagagcgacatcatggtatt---------------------
A0A8I3MNK9_BCL2L2-      gggccgggctagagcgacatcatggtatt---------------------
A0A8I3RSU6_BCL2L2-      gggccgggctagagcgacatcatggtatt---------------------
A0A8I3MNK9_BCL2L2-      gggccgggctagagcgacatcatggt------------------------
A0A667I624_BCL2L2-      gggccgggctagagcgacatcatggtatt---------------------
G1LKF5_BCL2L2-01        gggccgggctagagcgacatcatggt------------------------
G1LKF5_BCL2L2-02        gggccgggctagagcgacatcatggtatt---------------------
A0A384DPS8_BCL2L2-      gggccgggctagagcgacatcatggt------------------------
A0A384DPS8_BCL2L2-      gggccgggctagagcgacatcatggtatt---------------------
A0A8C6RJE0_BCL2L2-      gggccgggctagagcgacatcatggtatt---------------------
A0A671DWB3_BCL2L2-      gggccgggctagagcgacttcatggtatt---------------------
A0A250YBR2_BCL2L2-      --------------------------------------------------
A0A250YBR2_BCL2L2-      --------------------------------------------------
O88996_BCL2L2-01        --------------------------------------------------
Q7TS60_BCL2L2-01        --------------------------------------------------
A0A671DWB3_BCL2L2-      gggccgggctagagcgacttcatggtatt---------------------
A0A8C6RJE0_BCL2L2-      --------------------------------------------------
A0A4W2D6A3_BCL2L2-      -ggtcaggatag--------------------------------------
A0A4W2GUJ7_BCL2L2-      -ggtcaggatag--------------------------------------
A0A4W2D6A3_BCL2L2-      -ggtcaggatag--------------------------------------
A0A4W2GUJ7_BCL2L2-      -ggtcaggatag--------------------------------------
A0A8C8YZD8_BCL2L2-      gggccgggctagagcgacatcatggtatt---------------------
A0A8B7FJ73_BCL2L2-      gggccgggctagagcgacatcatggtatt---------------------
A0A2K6GWM6_BCL2L2-      gggccgggctagagcgacatcatggtatt---------------------
A0A8D0TJQ9_BCL2L2-      --------------------------------------------------
A0A482LX62_BCL2L2-      --------------------------------------------------
A0A4X1SF63_BCL2L2-      atgc------------acttctttatttg---------------------
A0A4D6NWN1_BCL2L2-      gggccgggctagagcgacatcatggtatt---------------------
A0A4X1SF60_BCL2L2-      gggccgggctagagcgacatcatggtatt---------------------
A0A4X1SF63_BCL2L2-      gggccgggctagagcgacatcatggtatt---------------------
A0A8D0TJQ9_BCL2L2-      gggccgggctagagcgacatcatggtatt---------------------
A0A4X1SF60_BCL2L2-      -ggtcaggatag--------------------------------------
A0A8D0TJQ9_BCL2L2-      -ggtcaggatag--------------------------------------
H0XR82_BCL2L2-01        --------------------------------------------------
A0A4X1SF63_BCL2L2-      gggccgggctagagcgacatcatggtttctgtag----------------
A0A4X1SF63_BCL2L2-      -ggtcaggatag--------------------------------------
A0A8D0TJQ9_BCL2L2-      -ggtcaggatag--------------------------------------
A0A8B7FJ73_BCL2L2-      --------------------------------------------------
A0A2K6GWM6_BCL2L2-      --------------------------------------------------
A0A5F5PML6_BCL2L2-      gggccgggctagagcgacatcatggagatcgtgcttgattctggtcaata
A0A8C8YZD8_BCL2L2-      gggccgggctagagcgacatcatggtatt---------------------
A0A8B7FJ73_BCL2L2-      gggccgggctagagcgacatcatggtatt---------------------
A0A8B7FJ73_BCL2L2-      gggccgggctagagcgacatcatggtatt---------------------
A0A2K6GWM6_BCL2L2-      gggccgggctagagcgacatcatggtatt---------------------
A0A2K6GWM6_BCL2L2-      gggccgggctagagcgacatcatggtatt---------------------
A0A8C0Q5E6_BCL2L2-      gggccgggctagagcgacatcatggtatt---------------------
A0A8I3MNK9_BCL2L2-      gggccgggctagagcgacatcatggtatt---------------------
A0A8I3RSU6_BCL2L2-      gggccgggctagagcgacatcatggtatt---------------------
A0A667I624_BCL2L2-      gggccgggctagagcgacatcatggtatt---------------------
G1P3J2_BCL2L2-01        --------------------------------------------------
G3TMU7_BCL2L2-01        --------------------------------------------------
A0A2K6TM77_BCL2L2-      --------------------------------------------------
A0A2K6TM77_BCL2L2-      --------------------------------------------------
A0A2K5CWY6_BCL2L2-      --------------------------------------------------
A0A2K5CWY6_BCL2L2-      --------------------------------------------------
A0A2K5CWY6_BCL2L2-      gggccgggctagagcgacatcatggtatt---------------------
U3CRF8_BCL2L2-02        gggccgggctagagcgacatcatggtatt---------------------
U3CRF8_BCL2L2-03        -ggtcaggatag--------------------------------------
A0A2I3GEA7_BCL2L2-      gggccgggctagagcgacatcatggtatt---------------------
A0A8I5U2F2_BCL2L2-      gggccgggctagagcgacatcatggtatt---------------------
A0A2I2YPX6_BCL2L2-      gggccgggctagagcgacatcatggtatt---------------------
A0A2I2YPX6_BCL2L2-      gggccgggctagagcgacatcatggtatt---------------------
U3CRF8_BCL2L2-01        gggccgggctagagcgacatcatggtatt---------------------
A0A2K6TM77_BCL2L2-      -ggtcaggatag--------------------------------------
A0A2K6TM77_BCL2L2-      gggccgggctagagcgacatcatggtatt---------------------
A0A2K5V0Q3_BCL2L2-      gggccgggctagagcgacatcatggtatt---------------------
A0A2K6EA59_BCL2L2-      gggccgggctagagcgacatcatggtatt---------------------
A0A2K6EA59_BCL2L2-      gggccgggctagagcgacatcatggtatt---------------------
A0A2K5MZX9_BCL2L2-      gggccgggctagagcgacatcatggtatt---------------------
A0A2K5MZX9_BCL2L2-      gggccgggctagagcgacatcatggtatt---------------------
A0A2K5MZX9_BCL2L2-      gggccgggctagagcgacatcatggtatt---------------------
A0A2K5V0Q3_BCL2L2-      gggccgggctagagcgacatcatggtatt---------------------
F7G4L5_BCL2L2-03        gggccgggctagagcgacatcatggtatt---------------------
A0A2K6EA59_BCL2L2-      gggccgggctagagcgacatcatggtatt---------------------
A0A2K6AI25_BCL2L2-      gggccgggctagagcgacatcatggtatt---------------------
A0A8D2FJU1_BCL2L2-      gggccgggctagagcgacatcatggtatt---------------------
A0A2R9A2Q3_BCL2L2-      gggccgggctagagcgacatcatggtatt---------------------
A0A2R9A2Q3_BCL2L2-      -ggtcaggatag--------------------------------------
A0A2K6RW35_BCL2L2-      gggccgggctagagcgacatcatggtatt---------------------
A0A2K5HEJ9_BCL2L2-      gggccgggctagagcgacatcatggtatt---------------------
A0A2K5HEJ9_BCL2L2-      gggccgggctagagcgacatcatggtatt---------------------
A0A8I5U2F2_BCL2L2-      --------------------------------------------------
A0A2K5CWY6_BCL2L2-      gggccgggctagagcgacatcatggtatt---------------------
A0A8I5U2F2_BCL2L2-      gggccgggctagagcgacatcatggtatt---------------------
A0A2K6RW35_BCL2L2-      --------------------------------------------------
A0A2K6RW35_BCL2L2-      --------------------------------------------------
A0A2K6ME72_BCL2L2-      --------------------------------------------------
A0A2R9A2Q3_BCL2L2-      --------------------------------------------------
A0A2K5MZX9_BCL2L2-      --------------------------------------------------
A0A2K6EA59_BCL2L2-      --------------------------------------------------
A0A2K6RW35_BCL2L2-      gtcaggatag----------------------------------------
A0A2K6ME72_BCL2L2-      gtcaggatag----------------------------------------
A0A8D2FJU1_BCL2L2-      --------------------------------------------------
A0A8D2FJU1_BCL2L2-      gggccgggctagagcgacatcatggtatt---------------------
A0A8C9H679_BCL2L2-      --------------------------------------------------
A0A8C9H679_BCL2L2-      --------------------------------------------------
A0A2I3MUE4_BCL2L2-      --------------------------------------------------
A0A2I3GEA7_BCL2L2-      --------------------------------------------------
A0A2I3GEA7_BCL2L2-      gggccgggctagagcgacatcatggtatt---------------------
A0A2K6AI25_BCL2L2-      gggccgggctagagcgacatcatggtatt---------------------
A0A2K6AI25_BCL2L2-      --------------------------------------------------
F7G4L5_BCL2L2-02        gggccgggctagagcgacatcatggtatt---------------------
F7G4L5_BCL2L2-01        --------------------------------------------------
A0A2K5V0Q3_BCL2L2-      --------------------------------------------------
A0A2K5V0Q3_BCL2L2-      gtcaggatag----------------------------------------
A0A2K5V0Q3_BCL2L2-      gtcaggatag----------------------------------------
A0A2K5V0Q3_BCL2L2-      gggccgggctagagcgacatcatggtatt---------------------
A0A2K5V0Q3_BCL2L2-      gggccgggctagagcgacatcatggtttc---------------------
A0A2K5V0Q3_BCL2L2-      gtcaggatag----------------------------------------
A0A2K5V0Q3_BCL2L2-      --------------------------------------------------
G3V4B7_BCL2L2-08        --------------------------------------------------
G3V4B7_BCL2L2-07        --------------------------------------------------
G3V4B7_BCL2L2-06        --------------------------------------------------
G3V4B7_BCL2L2-05        --------------------------------------------------
G3V4B7_BCL2L2-04        ---------------------ccaaaatg---------------------
G3V4B7_BCL2L2-03        --------------------------------------------------
G3V4B7_BCL2L2-02        --------------------------------------------------
A0A2I2YPX6_BCL2L2-      --------------------------------------------------
A0A2I2YPX6_BCL2L2-      gggccgggctagagcgacatcatggtatt---------------------
A0A2K5HEJ9_BCL2L2-      --------------------------------------------------
A0A0D9RU30_BCL2L2-      --------------------------------------------------
G3V4B7_BCL2L2-01        --------------------------------------------------
G3V4B7_BCL2L2-09        --------------------------------------------------
                                                                          

H3AAS7_BCL2L2-02        ----------------------------
H3AAS7_BCL2L2-01        ----------------------------
Q6GP82_BCL2L2-01        ----------------------------
A0A8C5PJB3_BCL2L2-      ----------------------------
A0A4X2LP96_BCL2L2-      ----------------------------
A0A5F8HG85_BCL2L2-      -ccccttactaa----------------
A0A5F8HG85_BCL2L2-      ----ttctgtag----------------
A0A5F8HG85_BCL2L2-      -ccccttactaa----------------
F7G6M3_BCL2L2-01        ----------------------------
G1Q051_BCL2L2-01        ----------------------------
G1TV33_BCL2L2-01        ----------------------------
D3Z5F7_BCL2L2-01        -ccccttactaa----------------
G3V4B7_BCL2L2-10        ----------------------------
A0A6I9LUT0_BCL2L2-      ----------------------------
A0A8C3X592_BCL2L2-      ----------------------------
A0A3Q9B4M8_BCL2L2-      ----------------------------
A0A7T8CLX7_BCL2L2-      ----------------------------
A0A8D0TJQ9_BCL2L2-      ----------------------------
A0A4X1SF60_BCL2L2-      ----------------------------
A0A4X1SF63_BCL2L2-      ----------------------------
A0A8C0Q5E6_BCL2L2-      ----------------------------
A0A8I3MNK9_BCL2L2-      ----------------------------
A0A8I3RSU6_BCL2L2-      ----------------------------
A0A673VAY7_BCL2L2-      ----------------------------
A0A2I2UAE3_BCL2L2-      ----------------------------
A0A8C8XCR9_BCL2L2-      ----------------------------
A0A8C9J3S1_BCL2L2-      ----------------------------
M3Y5X5_BCL2L2-01        ----------------------------
A0A8C7EW82_BCL2L2-      ----------------------------
A0A452SHI1_BCL2L2-      ----------------------------
A0A384DPS8_BCL2L2-      ----------------------------
A0A8C4LWK5_BCL2L2-      ----------------------------
A0A8C6BK57_BCL2L2-      ----------------------------
A0A8C9CXQ5_BCL2L2-      ----------------------------
A0A8B8WSS7_BCL2L2-      ----------------------------
W5QDH4_BCL2L2-02        ----------------------------
A0A8C6CUC2_BCL2L2-      ----------------------------
A0A452ECF0_BCL2L2-      ----------------------------
A0A4W2D6A3_BCL2L2-      ----------------------------
A0A4W2D6A3_BCL2L2-      ----------------------------
A0A4W2GUJ7_BCL2L2-      ----------------------------
A0A4W2GUJ7_BCL2L2-      ----------------------------
A0A8B9WT05_BCL2L2-      ----------------------------
A0A4W2D6A3_BCL2L2-      ----------------------------
A0A4W2D6A3_BCL2L2-      ----------------------------
A0A4W2GUJ7_BCL2L2-      ----------------------------
A0A4W2GUJ7_BCL2L2-      ----------------------------
Q05KI8_BCL2L2-01        ----------------------------
A0A8C2VJ88_BCL2L2-      ----------------------------
A0A286XQQ9_BCL2L2-      ----------------------------
A0A8C2VJ88_BCL2L2-      ----------------------------
A0A8D2APK0_BCL2L2-      ----------------------------
A0A287D9B3_BCL2L2-      ----------------------------
A0A8D2HGM1_BCL2L2-      ----------------------------
A0A287D9B3_BCL2L2-      ----------------------------
A0A8C9PGU3_BCL2L2-      ----------------------------
W5QDH4_BCL2L2-01        -ccccttactaa----------------
A0A4W2GUJ7_BCL2L2-      ----------------------------
A0A4W2GUJ7_BCL2L2-      ----------------------------
A0A4W2D6A3_BCL2L2-      -ccccttactaa----------------
A0A4W2GUJ7_BCL2L2-      -ccccttactaa----------------
A0A4W2D6A3_BCL2L2-      -ccccttactaa----------------
A0A4W2GUJ7_BCL2L2-      -ccccttactaa----------------
A0A4W2GUJ7_BCL2L2-      -ccccttactaa----------------
A0A4W2GUJ7_BCL2L2-      -ccccttactaa----------------
A0A5F5PML6_BCL2L2-      ccttcccactgactttggaataa-----
A0A5F5PML6_BCL2L2-      --------------------tag-----
A0A8C5L5C6_BCL2L2-      ----------------------------
A0A8C0Q5E6_BCL2L2-      -ccccttactaa----------------
A0A8I3MNK9_BCL2L2-      -ccccttactaa----------------
A0A8I3RSU6_BCL2L2-      -ccccttactaa----------------
A0A8I3MNK9_BCL2L2-      ----ttctgtag----------------
A0A667I624_BCL2L2-      -ccccttactaa----------------
G1LKF5_BCL2L2-01        ----ttctgtag----------------
G1LKF5_BCL2L2-02        -ccccttactaa----------------
A0A384DPS8_BCL2L2-      ----ttctgtag----------------
A0A384DPS8_BCL2L2-      -ccccttactaa----------------
A0A8C6RJE0_BCL2L2-      -ccccttactaa----------------
A0A671DWB3_BCL2L2-      -ccccttactaa----------------
A0A250YBR2_BCL2L2-      ----------------------------
A0A250YBR2_BCL2L2-      ----------------------------
O88996_BCL2L2-01        ----------------------------
Q7TS60_BCL2L2-01        ----------------------------
A0A671DWB3_BCL2L2-      -ccccttactaa----------------
A0A8C6RJE0_BCL2L2-      ----------------------------
A0A4W2D6A3_BCL2L2-      ----------------------------
A0A4W2GUJ7_BCL2L2-      ----------------------------
A0A4W2D6A3_BCL2L2-      ----------------------------
A0A4W2GUJ7_BCL2L2-      ----------------------------
A0A8C8YZD8_BCL2L2-      -ccccttactaa----------------
A0A8B7FJ73_BCL2L2-      -ccccttactaa----------------
A0A2K6GWM6_BCL2L2-      -ccccttactaa----------------
A0A8D0TJQ9_BCL2L2-      ----------------------------
A0A482LX62_BCL2L2-      ----------------------------
A0A4X1SF63_BCL2L2-      -ccactgtttggcggaagtag-------
A0A4D6NWN1_BCL2L2-      -ccccttactaa----------------
A0A4X1SF60_BCL2L2-      -ccccttactaa----------------
A0A4X1SF63_BCL2L2-      -ccccttactaa----------------
A0A8D0TJQ9_BCL2L2-      -ccccttactaa----------------
A0A4X1SF60_BCL2L2-      ----------------------------
A0A8D0TJQ9_BCL2L2-      ----------------------------
H0XR82_BCL2L2-01        ----------------------------
A0A4X1SF63_BCL2L2-      ----------------------------
A0A4X1SF63_BCL2L2-      ----------------------------
A0A8D0TJQ9_BCL2L2-      ----------------------------
A0A8B7FJ73_BCL2L2-      ----------------------------
A0A2K6GWM6_BCL2L2-      ----------------------------
A0A5F5PML6_BCL2L2-      ccttcccactgactttggaataa-----
A0A8C8YZD8_BCL2L2-      -ccccttactaa----------------
A0A8B7FJ73_BCL2L2-      -ccccttactaa----------------
A0A8B7FJ73_BCL2L2-      -ccccttactaa----------------
A0A2K6GWM6_BCL2L2-      -ccccttactaa----------------
A0A2K6GWM6_BCL2L2-      -ccccttactaa----------------
A0A8C0Q5E6_BCL2L2-      -ccccttactaa----------------
A0A8I3MNK9_BCL2L2-      -ccccttactaa----------------
A0A8I3RSU6_BCL2L2-      -ccccttactaa----------------
A0A667I624_BCL2L2-      -ccccttactaa----------------
G1P3J2_BCL2L2-01        ----------------------------
G3TMU7_BCL2L2-01        ----------------------------
A0A2K6TM77_BCL2L2-      ----------------------------
A0A2K6TM77_BCL2L2-      ----------------------------
A0A2K5CWY6_BCL2L2-      ----------------------------
A0A2K5CWY6_BCL2L2-      ----------------------------
A0A2K5CWY6_BCL2L2-      -ccccttactaa----------------
U3CRF8_BCL2L2-02        -ccccttactaa----------------
U3CRF8_BCL2L2-03        ----------------------------
A0A2I3GEA7_BCL2L2-      -ccccttactaa----------------
A0A8I5U2F2_BCL2L2-      -ccccttactaa----------------
A0A2I2YPX6_BCL2L2-      -ccccttactaa----------------
A0A2I2YPX6_BCL2L2-      -ccccttactaa----------------
U3CRF8_BCL2L2-01        -ccccttactaa----------------
A0A2K6TM77_BCL2L2-      ----------------------------
A0A2K6TM77_BCL2L2-      -ccccttactaa----------------
A0A2K5V0Q3_BCL2L2-      -ccccttactaaaaaaagtgtgtattag
A0A2K6EA59_BCL2L2-      -ccccttactaa----------------
A0A2K6EA59_BCL2L2-      -ccccttactaa----------------
A0A2K5MZX9_BCL2L2-      -ccccttactaa----------------
A0A2K5MZX9_BCL2L2-      -ccccttactaa----------------
A0A2K5MZX9_BCL2L2-      -ccccttactaa----------------
A0A2K5V0Q3_BCL2L2-      -ccccttactaa----------------
F7G4L5_BCL2L2-03        -ccccttactaa----------------
A0A2K6EA59_BCL2L2-      -ccccttactaa----------------
A0A2K6AI25_BCL2L2-      -ccccttactaa----------------
A0A8D2FJU1_BCL2L2-      -ccccttactaa----------------
A0A2R9A2Q3_BCL2L2-      -ccccttactaa----------------
A0A2R9A2Q3_BCL2L2-      ----------------------------
A0A2K6RW35_BCL2L2-      -ccccttactaa----------------
A0A2K5HEJ9_BCL2L2-      -ccccttactaa----------------
A0A2K5HEJ9_BCL2L2-      -ccccttactaa----------------
A0A8I5U2F2_BCL2L2-      ----------------------------
A0A2K5CWY6_BCL2L2-      -ccccttactaa----------------
A0A8I5U2F2_BCL2L2-      -ccccttactaa----------------
A0A2K6RW35_BCL2L2-      ----------------------------
A0A2K6RW35_BCL2L2-      ----------------------------
A0A2K6ME72_BCL2L2-      ----------------------------
A0A2R9A2Q3_BCL2L2-      ----------------------------
A0A2K5MZX9_BCL2L2-      ----------------------------
A0A2K6EA59_BCL2L2-      ----------------------------
A0A2K6RW35_BCL2L2-      ----------------------------
A0A2K6ME72_BCL2L2-      ----------------------------
A0A8D2FJU1_BCL2L2-      ----------------------------
A0A8D2FJU1_BCL2L2-      -ccccttactaa----------------
A0A8C9H679_BCL2L2-      ----------------------------
A0A8C9H679_BCL2L2-      ----------------------------
A0A2I3MUE4_BCL2L2-      ----------------------------
A0A2I3GEA7_BCL2L2-      ----------------------------
A0A2I3GEA7_BCL2L2-      -ccccttactaa----------------
A0A2K6AI25_BCL2L2-      -ccccttactaa----------------
A0A2K6AI25_BCL2L2-      ----------------------------
F7G4L5_BCL2L2-02        -ccccttactaa----------------
F7G4L5_BCL2L2-01        ----------------------------
A0A2K5V0Q3_BCL2L2-      ----------------------------
A0A2K5V0Q3_BCL2L2-      ----------------------------
A0A2K5V0Q3_BCL2L2-      ----------------------------
A0A2K5V0Q3_BCL2L2-      -ccccttactaa----------------
A0A2K5V0Q3_BCL2L2-      -tgtag----------------------
A0A2K5V0Q3_BCL2L2-      ----------------------------
A0A2K5V0Q3_BCL2L2-      ----------------------------
G3V4B7_BCL2L2-08        ----------------------------
G3V4B7_BCL2L2-07        --------ctga----------------
G3V4B7_BCL2L2-06        ----------------------------
G3V4B7_BCL2L2-05        ----------------------------
G3V4B7_BCL2L2-04        -ccctgctctga----------------
G3V4B7_BCL2L2-03        ----------------------------
G3V4B7_BCL2L2-02        ----------------------------
A0A2I2YPX6_BCL2L2-      ----------------------------
A0A2I2YPX6_BCL2L2-      -ccccttactaa----------------
A0A2K5HEJ9_BCL2L2-      ----------------------------
A0A0D9RU30_BCL2L2-      ----------------------------
G3V4B7_BCL2L2-01        ----------------------------
G3V4B7_BCL2L2-09        ----------------------------
                                                    

© 1998-2023Legal notice