Dataset for CDS BCL2L2 of organism all

[Download (right click)] [Edit] [Sequences] [Repertoires]

81 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


Q5XGJ4_BCL2L2-01        --------------------------------------------------
H3AAS7_BCL2L2-02        --------------------------------------------------
H3AAS7_BCL2L2-01        --------------------------------------------------
F7G6M3_BCL2L2-01        atgccaagtgcccggaattctcccctcccccgccagtcggccgcccctca
G3WPT1_BCL2L2-01        --------------------------------------------------
G3WPT1_BCL2L2-02        --------------------------------------------------
G1Q051_BCL2L2-01        --------------------------------------------------
G1TV33_BCL2L2-01        --------------------------------------------------
G1P3J2_BCL2L2-01        --------------------------------------------------
A0A482LX62_BCL2L2-      --------------------------------------------------
A0A1U7RC37_BCL2L2-      --------------------------------------------------
A0A250YBR2_BCL2L2-      --------------------------------------------------
A0A250YBR2_BCL2L2-      --------------------------------------------------
W5QDH4_BCL2L2-01        --------------------------------------------------
A0A287ATE4_BCL2L2-      --------------------------------------------------
A0A3Q9B4M8_BCL2L2-      --------------------------------------------------
A0A1U7RC37_BCL2L2-      --------------------------------------------------
A0A2I2UAE3_BCL2L2-      --------------------------------------------------
M3Y5X5_BCL2L2-01        --------------------------------------------------
G1LMC3_BCL2L2-01        --------------------------------------------------
A0A452SHI1_BCL2L2-      --------------------------------------------------
A0A286XQQ9_BCL2L2-      --------------------------------------------------
L8HP19_BCL2L2-02        --------------------------------------------------
L8HP19_BCL2L2-01        --------------------------------------------------
Q1RMX3_BCL2L2-01        --------------------------------------------------
Q05KI8_BCL2L2-01        --------------------------------------------------
A0A452ECF0_BCL2L2-      --------------------------------------------------
W5QDH4_BCL2L2-02        --------------------------------------------------
H0XR82_BCL2L2-01        --------------------------------------------------
A0A2K6GWM6_BCL2L2-      --------------------------------------------------
A0A287D9B3_BCL2L2-      --------------------------------------------------
A0A1U7UJF2_BCL2L2-      --------------------------------------------------
A0A1S3FYD8_BCL2L2-      --------------------------------------------------
A0A2K6TM77_BCL2L2-      --------------------------------------------------
A0A2K5CWY6_BCL2L2-      --------------------------------------------------
A0A2K5CWY6_BCL2L2-      --------------------------------------------------
A0A2K5RUN8_BCL2L2-      --------------------------------------------------
A0A2R9A2Q3_BCL2L2-      --------------------------------------------------
H2Q805_BCL2L2-01        --------------------------------------------------
A0A2I2YPX6_BCL2L2-      --------------------------------------------------
A0A2I3GEA7_BCL2L2-      --------------------------------------------------
A0A2K5MZX9_BCL2L2-      --------------------------------------------------
A0A2K6EA59_BCL2L2-      --------------------------------------------------
A0A2K5V0Q3_BCL2L2-      --------------------------------------------------
F7G4L5_BCL2L2-01        --------------------------------------------------
A0A2K6AI25_BCL2L2-      --------------------------------------------------
A0A096NX09_BCL2L2-      --------------------------------------------------
A0A2K6RW35_BCL2L2-      --------------------------------------------------
A0A2K6RW35_BCL2L2-      --------------------------------------------------
A0A2K6ME72_BCL2L2-      --------------------------------------------------
A0A0D9RU30_BCL2L2-      --------------------------------------------------
A0A2K5HEJ9_BCL2L2-      --------------------------------------------------
G3TMU7_BCL2L2-01        --------------------------------------------------
O88996_BCL2L2-01        --------------------------------------------------
Q7TS60_BCL2L2-01        --------------------------------------------------
A0A287D9B3_BCL2L2-      --------------------------------------------------
P70345_BCL2L2-02        --------------------------------------------------
P70345_BCL2L2-01        --------------------------------------------------
A0A452UF16_BCL2L2-      --------------------------------------------------
A0A452UF16_BCL2L2-      --------------------------------------------------
A0A4D6NWN1_BCL2L2-      --------------------------------------------------
A0A287ATE4_BCL2L2-      --------------------------------------------------
A0A287ATE4_BCL2L2-      --------------------------------------------------
A0A1U7UJF2_BCL2L2-      --------------------------------------------------
A0A2K6GWM6_BCL2L2-      --------------------------------------------------
A0A2R9A2Q3_BCL2L2-      --------------------------------------------------
H2Q805_BCL2L2-02        --------------------------------------------------
A0A2I2YPX6_BCL2L2-      --------------------------------------------------
A0A2I3GEA7_BCL2L2-      --------------------------------------------------
A0A096NX09_BCL2L2-      --------------------------------------------------
A0A2K5V0Q3_BCL2L2-      --------------------------------------------------
F7G4L5_BCL2L2-02        --------------------------------------------------
A0A2K6AI25_BCL2L2-      --------------------------------------------------
A0A2K5MZX9_BCL2L2-      --------------------------------------------------
A0A2K6EA59_BCL2L2-      --------------------------------------------------
A0A2K5HEJ9_BCL2L2-      --------------------------------------------------
A0A2K6ME72_BCL2L2-      --------------------------------------------------
A0A2K6RW35_BCL2L2-      --------------------------------------------------
A0A2R8M4C0_BCL2L2-      --------------------------------------------------
A0A2K5RUN8_BCL2L2-      --------------------------------------------------
A0A2K6TM77_BCL2L2-      --------------------------------------------------
                                                                          

Q5XGJ4_BCL2L2-01        --------------------------------------------------
H3AAS7_BCL2L2-02        --------------------------------------------------
H3AAS7_BCL2L2-01        --------------------------------------------------
F7G6M3_BCL2L2-01        gccctgctgtcttgccccctgcccctccaggccccccggcagccctcctg
G3WPT1_BCL2L2-01        -------------------------------------------------c
G3WPT1_BCL2L2-02        --------------------------------------------------
G1Q051_BCL2L2-01        -------------------------------------------atgaatg
G1TV33_BCL2L2-01        --------------------------------------------------
G1P3J2_BCL2L2-01        -------------------cctgaaatgctccattctgtgtctctgacta
A0A482LX62_BCL2L2-      --------------------------------------------------
A0A1U7RC37_BCL2L2-      --------------------------------------------------
A0A250YBR2_BCL2L2-      --------------------------------------------------
A0A250YBR2_BCL2L2-      --------------------------------------------------
W5QDH4_BCL2L2-01        -------atgggctggccaaacctgaaatacctccttctgggcctctcac
A0A287ATE4_BCL2L2-      --------------------------------------------------
A0A3Q9B4M8_BCL2L2-      --------------------------------------------------
A0A1U7RC37_BCL2L2-      --------------------------------------------------
A0A2I2UAE3_BCL2L2-      --------------------------------------------------
M3Y5X5_BCL2L2-01        -------------------aagcctgaagcaccccttctggctttccaac
G1LMC3_BCL2L2-01        -------------------------------------------------c
A0A452SHI1_BCL2L2-      --------------------------------------------------
A0A286XQQ9_BCL2L2-      --------------------------------------------------
L8HP19_BCL2L2-02        --------------------------------------------------
L8HP19_BCL2L2-01        --------------------------------------------------
Q1RMX3_BCL2L2-01        --------------------------------------------------
Q05KI8_BCL2L2-01        --------------------------------------------------
A0A452ECF0_BCL2L2-      --------------------------------------------------
W5QDH4_BCL2L2-02        -------atgggctggccaaacctgaaatacctccttctgggcctctcac
H0XR82_BCL2L2-01        --------------------------------------------------
A0A2K6GWM6_BCL2L2-      --------------------------------------------------
A0A287D9B3_BCL2L2-      --------------------------------------------------
A0A1U7UJF2_BCL2L2-      --------------------------------------------------
A0A1S3FYD8_BCL2L2-      --------------------------------------------------
A0A2K6TM77_BCL2L2-      --------------------------------------------------
A0A2K5CWY6_BCL2L2-      --------------------------------------------------
A0A2K5CWY6_BCL2L2-      ----------------------------atgccccttctggttctctgtc
A0A2K5RUN8_BCL2L2-      --------------------------------------------------
A0A2R9A2Q3_BCL2L2-      --------------------------------------------------
H2Q805_BCL2L2-01        --------------------------------------------------
A0A2I2YPX6_BCL2L2-      --------------------------------------------------
A0A2I3GEA7_BCL2L2-      --------------------------------------------------
A0A2K5MZX9_BCL2L2-      --------------------------------------------------
A0A2K6EA59_BCL2L2-      --------------------------------------------------
A0A2K5V0Q3_BCL2L2-      --------------------------------------------------
F7G4L5_BCL2L2-01        --------------------------------------------------
A0A2K6AI25_BCL2L2-      --------------------------------------------------
A0A096NX09_BCL2L2-      --------------------------------------------------
A0A2K6RW35_BCL2L2-      --------------------------------------------------
A0A2K6RW35_BCL2L2-      --------------------------------------------------
A0A2K6ME72_BCL2L2-      --------------------------------------------------
A0A0D9RU30_BCL2L2-      --------------------------------------------------
A0A2K5HEJ9_BCL2L2-      --------------------------------------------------
G3TMU7_BCL2L2-01        --------------------------------------------------
O88996_BCL2L2-01        --------------------------------------------------
Q7TS60_BCL2L2-01        -------------------atgtccctttttggtctctgtcaatattttt
A0A287D9B3_BCL2L2-      --------------------------------------------------
P70345_BCL2L2-02        --------------------------------------------------
P70345_BCL2L2-01        --------------------------------------------------
A0A452UF16_BCL2L2-      --------------------------------------------------
A0A452UF16_BCL2L2-      --------------------------------------------------
A0A4D6NWN1_BCL2L2-      --------------------------------------------------
A0A287ATE4_BCL2L2-      --------------------------------------------------
A0A287ATE4_BCL2L2-      --------------------------------------------------
A0A1U7UJF2_BCL2L2-      --------------------------------------------------
A0A2K6GWM6_BCL2L2-      --------------------------------------------------
A0A2R9A2Q3_BCL2L2-      --------------------------------------------------
H2Q805_BCL2L2-02        --------------------------------------------------
A0A2I2YPX6_BCL2L2-      --------------------------------------------------
A0A2I3GEA7_BCL2L2-      --------------------------------------------------
A0A096NX09_BCL2L2-      --------------------------------------------------
A0A2K5V0Q3_BCL2L2-      --------------------------------------------------
F7G4L5_BCL2L2-02        --------------------------------------------------
A0A2K6AI25_BCL2L2-      --------------------------------------------------
A0A2K5MZX9_BCL2L2-      --------------------------------------------------
A0A2K6EA59_BCL2L2-      --------------------------------------------------
A0A2K5HEJ9_BCL2L2-      --------------------------------------------------
A0A2K6ME72_BCL2L2-      --------------------------------------------------
A0A2K6RW35_BCL2L2-      --------------------------------------------------
A0A2R8M4C0_BCL2L2-      --------------------------------------------------
A0A2K5RUN8_BCL2L2-      --------------------------------------------------
A0A2K6TM77_BCL2L2-      --------------------------------------------------
                                                                          

Q5XGJ4_BCL2L2-01        -----------------------------------------------at-
H3AAS7_BCL2L2-02        -----------------------------------------------at-
H3AAS7_BCL2L2-01        -----------------------------------------------at-
F7G6M3_BCL2L2-01        acgcccctccacggcctccccctccccgctgtcctgcagccccccggat-
G3WPT1_BCL2L2-01        atagctcaagccccattttcttctctctgccttttatagccagccagat-
G3WPT1_BCL2L2-02        -----------------------------------------------at-
G1Q051_BCL2L2-01        aattttctctagacaactttatgctctatagttttgattctgttgatatt
G1TV33_BCL2L2-01        -----------------------------------------------at-
G1P3J2_BCL2L2-01        aatatactcatgccagtcttttatccttgacctttacagccgcccggat-
A0A482LX62_BCL2L2-      -----------------------------------------------at-
A0A1U7RC37_BCL2L2-      -----------------------------------------------at-
A0A250YBR2_BCL2L2-      -----------------------------------------------at-
A0A250YBR2_BCL2L2-      -----------------------------------------------at-
W5QDH4_BCL2L2-01        catatattcatgccagtcttttatgtttgactccaacagccgcccggat-
A0A287ATE4_BCL2L2-      -----------------------------------------------at-
A0A3Q9B4M8_BCL2L2-      -----------------------------------------------at-
A0A1U7RC37_BCL2L2-      -----------------------------------------------at-
A0A2I2UAE3_BCL2L2-      -----------------------------------------------at-
M3Y5X5_BCL2L2-01        catatattcacgccagcctttcatccttgactcttacagccgcccggat-
G1LMC3_BCL2L2-01        catatattcatgccagtctttcatccttgactcttacagccgcccggat-
A0A452SHI1_BCL2L2-      -----------------------------------------------at-
A0A286XQQ9_BCL2L2-      -----------------------------------------------at-
L8HP19_BCL2L2-02        -----------------------------------------------at-
L8HP19_BCL2L2-01        -----------------------------------------------at-
Q1RMX3_BCL2L2-01        -----------------------------------------------at-
Q05KI8_BCL2L2-01        -----------------------------------------------at-
A0A452ECF0_BCL2L2-      -----------------------------------------------at-
W5QDH4_BCL2L2-02        catatattcatgccagtcttttatgtttgactccaacagccgcccggat-
H0XR82_BCL2L2-01        -----------------------------------------------at-
A0A2K6GWM6_BCL2L2-      -----------------------------------------------at-
A0A287D9B3_BCL2L2-      -----------------------------------------------at-
A0A1U7UJF2_BCL2L2-      -----------------------------------------------at-
A0A1S3FYD8_BCL2L2-      -----------------------------------------------at-
A0A2K6TM77_BCL2L2-      -----------------------------------------------at-
A0A2K5CWY6_BCL2L2-      --------------catctttcatccttgcctcttatagccgcccggat-
A0A2K5CWY6_BCL2L2-      catatattcatgccagtctttcatccttgcctcttatagccgcccggat-
A0A2K5RUN8_BCL2L2-      -----------------------------------------------at-
A0A2R9A2Q3_BCL2L2-      -----------------------------------------------at-
H2Q805_BCL2L2-01        -----------------------------------------------at-
A0A2I2YPX6_BCL2L2-      -----------------------------------------------at-
A0A2I3GEA7_BCL2L2-      -----------------------------------------------at-
A0A2K5MZX9_BCL2L2-      -----------------------------------------------at-
A0A2K6EA59_BCL2L2-      -----------------------------------------------at-
A0A2K5V0Q3_BCL2L2-      -----------------------------------------------at-
F7G4L5_BCL2L2-01        -----------------------------------------------at-
A0A2K6AI25_BCL2L2-      -----------------------------------------------at-
A0A096NX09_BCL2L2-      -----------------------------------------------at-
A0A2K6RW35_BCL2L2-      -----------------------------------------------at-
A0A2K6RW35_BCL2L2-      -----------------------------------------------at-
A0A2K6ME72_BCL2L2-      -----------------------------------------------at-
A0A0D9RU30_BCL2L2-      -----------------------------------------------at-
A0A2K5HEJ9_BCL2L2-      -----------------------------------------------at-
G3TMU7_BCL2L2-01        --tatattcatgttagtctttcatccctgactcttgcagccgcccgcat-
O88996_BCL2L2-01        -----------------------------------------------at-
Q7TS60_BCL2L2-01        catatatttatgtcagtctgtcatccttgcccctttcagccgcccggat-
A0A287D9B3_BCL2L2-      -----------------------------------------------at-
P70345_BCL2L2-02        --------------------------------------------------
P70345_BCL2L2-01        -----------------------------------------------at-
A0A452UF16_BCL2L2-      -----------------------------------------------at-
A0A452UF16_BCL2L2-      -----------------------------------------------at-
A0A4D6NWN1_BCL2L2-      -----------------------------------------------at-
A0A287ATE4_BCL2L2-      -----------------------------------------------at-
A0A287ATE4_BCL2L2-      -----------------------------------------------at-
A0A1U7UJF2_BCL2L2-      -----------------------------------------------at-
A0A2K6GWM6_BCL2L2-      -----------------------------------------------at-
A0A2R9A2Q3_BCL2L2-      -----------------------------------------------at-
H2Q805_BCL2L2-02        -----------------------------------------------at-
A0A2I2YPX6_BCL2L2-      -----------------------------------------------at-
A0A2I3GEA7_BCL2L2-      -----------------------------------------------at-
A0A096NX09_BCL2L2-      -----------------------------------------------at-
A0A2K5V0Q3_BCL2L2-      -----------------------------------------------at-
F7G4L5_BCL2L2-02        -----------------------------------------------at-
A0A2K6AI25_BCL2L2-      -----------------------------------------------at-
A0A2K5MZX9_BCL2L2-      -----------------------------------------------at-
A0A2K6EA59_BCL2L2-      -----------------------------------------------at-
A0A2K5HEJ9_BCL2L2-      -----------------------------------------------at-
A0A2K6ME72_BCL2L2-      -----------------------------------------------at-
A0A2K6RW35_BCL2L2-      -----------------------------------------------at-
A0A2R8M4C0_BCL2L2-      -----------------------------------------------at-
A0A2K5RUN8_BCL2L2-      -----------------------------------------------at-
A0A2K6TM77_BCL2L2-      -----------------------------------------------at-
                                                                          

Q5XGJ4_BCL2L2-01        ----------------------ggcg----caatctga---------act
H3AAS7_BCL2L2-02        ----------------------ggattc----gcttta---------cag
H3AAS7_BCL2L2-01        ----------------------ggattc----gcttta---------cag
F7G6M3_BCL2L2-01        ----------------------ggcgaccccggccccg-gcctcggtctc
G3WPT1_BCL2L2-01        ----------------------ggcgactccagcctca-gc------ccc
G3WPT1_BCL2L2-02        ----------------------ggcgactccagcctca-gc------ccc
G1Q051_BCL2L2-01        aggcccaaagtgctgggtcctaagagctcccagcctcaggc------ccc
G1TV33_BCL2L2-01        ----------------------ggcgaccccagcctca-gc------ccc
G1P3J2_BCL2L2-01        ----------------------ggcgaccccagcctcg-gc------ccc
A0A482LX62_BCL2L2-      ----------------------ggcgaccccggcctca-gc------ccc
A0A1U7RC37_BCL2L2-      ----------------------ggcgaccccagcctca-gc------ccc
A0A250YBR2_BCL2L2-      ----------------------ggcgaccccagcctcg-gc------ccc
A0A250YBR2_BCL2L2-      ----------------------ggcgaccccagcctcg-gc------ccc
W5QDH4_BCL2L2-01        ----------------------ggcgaccccagcctca-gc------ccc
A0A287ATE4_BCL2L2-      ----------------------ggcgaccccggcctca-gc------ccc
A0A3Q9B4M8_BCL2L2-      ----------------------ggcgaccccggcctca-gc------ccc
A0A1U7RC37_BCL2L2-      ----------------------ggcgaccccagcctca-gc------ccc
A0A2I2UAE3_BCL2L2-      ----------------------ggcgaccccagcctca-gc------ccc
M3Y5X5_BCL2L2-01        ----------------------ggcgaccccggcctca-gc------ccc
G1LMC3_BCL2L2-01        ----------------------ggcgaccccagcttca-gc------ccc
A0A452SHI1_BCL2L2-      ----------------------ggcgaccccagcctca-gc------ccc
A0A286XQQ9_BCL2L2-      ----------------------ggcgaccccagcctcg-gc------ccc
L8HP19_BCL2L2-02        ----------------------ggcgaccccagcctcg-gc------ccc
L8HP19_BCL2L2-01        ----------------------ggcgaccccagcctcg-gc------ccc
Q1RMX3_BCL2L2-01        ----------------------ggcgaccccagcctcg-gc------ccc
Q05KI8_BCL2L2-01        ----------------------ggcgaccccagcctcg-gc------ccc
A0A452ECF0_BCL2L2-      ----------------------ggcgaccccagcctca-gc------ccc
W5QDH4_BCL2L2-02        ----------------------ggcgaccccagcctca-gc------ccc
H0XR82_BCL2L2-01        ----------------------ggcgaccccagcctca-gc------ccc
A0A2K6GWM6_BCL2L2-      ----------------------ggcgaccccagcctca-gc------ccc
A0A287D9B3_BCL2L2-      ----------------------ggcgaccccagcctcg-gc------ccc
A0A1U7UJF2_BCL2L2-      ----------------------ggcgaccccagcctca-gc------ccc
A0A1S3FYD8_BCL2L2-      ----------------------ggcgaccccagcctca-gc------ccc
A0A2K6TM77_BCL2L2-      ----------------------ggcgaccccagcctca-gc------ccc
A0A2K5CWY6_BCL2L2-      ----------------------ggcgaccccagcctcg-gc------ccc
A0A2K5CWY6_BCL2L2-      ----------------------ggcgaccccagcctcg-gc------ccc
A0A2K5RUN8_BCL2L2-      ----------------------ggcgaccccagcctcg-gc------ccc
A0A2R9A2Q3_BCL2L2-      ----------------------ggcgaccccagcctca-gc------ccc
H2Q805_BCL2L2-01        ----------------------ggcgaccccagcctca-gc------ccc
A0A2I2YPX6_BCL2L2-      ----------------------ggcgaccccagcctcg-gc------ccc
A0A2I3GEA7_BCL2L2-      ----------------------ggcgaccccagcctcg-gc------ccc
A0A2K5MZX9_BCL2L2-      ----------------------ggcgaccccagcctcg-gc------ccc
A0A2K6EA59_BCL2L2-      ----------------------ggcgaccccagcctcg-gc------ccc
A0A2K5V0Q3_BCL2L2-      ----------------------ggcgaccccagcctcg-gc------ccc
F7G4L5_BCL2L2-01        ----------------------ggcgaccccagcctcg-gc------ccc
A0A2K6AI25_BCL2L2-      ----------------------ggcgaccccagcctcg-gc------ccc
A0A096NX09_BCL2L2-      ----------------------ggcgaccccagcctcg-gc------ccc
A0A2K6RW35_BCL2L2-      ----------------------ggcgaccccagcctcg-gc------ccc
A0A2K6RW35_BCL2L2-      ----------------------ggcgaccccagcctcg-gc------ccc
A0A2K6ME72_BCL2L2-      ----------------------ggcgaccccagcctcg-gc------ccc
A0A0D9RU30_BCL2L2-      ----------------------ggcgaccccagcctcg-gc------ccc
A0A2K5HEJ9_BCL2L2-      ----------------------ggcgaccccagcctcg-gc------ccc
G3TMU7_BCL2L2-01        ----------------------ggcgaccccagcctca-gc------ccc
O88996_BCL2L2-01        ----------------------ggcgaccccagcctca-ac------ccc
Q7TS60_BCL2L2-01        ----------------------ggcgaccccagcctca-ac------ccc
A0A287D9B3_BCL2L2-      ----------------------ggcgaccccagcctcg-gc------ccc
P70345_BCL2L2-02        --------------------------------------------------
P70345_BCL2L2-01        ----------------------ggcgaccccagcctca-ac------ccc
A0A452UF16_BCL2L2-      ----------------------ggcgaccccagcctca-gc------ccc
A0A452UF16_BCL2L2-      ----------------------ggcgaccccagcctca-gc------ccc
A0A4D6NWN1_BCL2L2-      ----------------------ggcgaccccggcctca-gc------ccc
A0A287ATE4_BCL2L2-      ----------------------ggcgaccccggcctca-gc------ccc
A0A287ATE4_BCL2L2-      ----------------------ggcgaccccggcctca-gc------ccc
A0A1U7UJF2_BCL2L2-      ----------------------ggcgaccccagcctca-gc------ccc
A0A2K6GWM6_BCL2L2-      ----------------------ggcgaccccagcctca-gc------ccc
A0A2R9A2Q3_BCL2L2-      ----------------------ggcgaccccagcctca-gc------ccc
H2Q805_BCL2L2-02        ----------------------ggcgaccccagcctca-gc------ccc
A0A2I2YPX6_BCL2L2-      ----------------------ggcgaccccagcctcg-gc------ccc
A0A2I3GEA7_BCL2L2-      ----------------------ggcgaccccagcctcg-gc------ccc
A0A096NX09_BCL2L2-      ----------------------ggcgaccccagcctcg-gc------ccc
A0A2K5V0Q3_BCL2L2-      ----------------------ggcgaccccagcctcg-gc------ccc
F7G4L5_BCL2L2-02        ----------------------ggcgaccccagcctcg-gc------ccc
A0A2K6AI25_BCL2L2-      ----------------------ggcgaccccagcctcg-gc------ccc
A0A2K5MZX9_BCL2L2-      ----------------------ggcgaccccagcctcg-gc------ccc
A0A2K6EA59_BCL2L2-      ----------------------ggcgaccccagcctcg-gc------ccc
A0A2K5HEJ9_BCL2L2-      ----------------------ggcgaccccagcctcg-gc------ccc
A0A2K6ME72_BCL2L2-      ----------------------ggcgaccccagcctcg-gc------ccc
A0A2K6RW35_BCL2L2-      ----------------------ggcgaccccagcctcg-gc------ccc
A0A2R8M4C0_BCL2L2-      ----------------------ggcgaccccagcctcc-gc------ccc
A0A2K5RUN8_BCL2L2-      ----------------------ggcgaccccagcctcg-gc------ccc
A0A2K6TM77_BCL2L2-      ----------------------ggcgaccccagcctca-gc------ccc
                                                                          

Q5XGJ4_BCL2L2-01        aggatcccgggctttggtagaggattttgtgcgatacaagttatgccagc
H3AAS7_BCL2L2-02        taacagaggag---tggtggaggacttcatttattacaaactcggccaga
H3AAS7_BCL2L2-01        taacagaggag---tggtggaggacttcatttattacaaactcggccaga
F7G6M3_BCL2L2-01        agacacccgggccctggtggcggactttgtgggctacaagctgcggcaga
G3WPT1_BCL2L2-01        agatactcgagccctggtggcagattttgtgggttataagctaaggcaga
G3WPT1_BCL2L2-02        agatactcgagccctggtggcagattttgtgggttataagctaaggcaga
G1Q051_BCL2L2-01        agacacacaggctctggtggcagactttgtaggctacaagctgaggcaga
G1TV33_BCL2L2-01        agacacacgggctctggtggccgactttgtaggctacaagctgaggcaga
G1P3J2_BCL2L2-01        agacacacgggctctggtggcagactttgtaggctacaagctgaggcaga
A0A482LX62_BCL2L2-      agacacacgggctctagtggcagactttgtgggctataagctgaggcaga
A0A1U7RC37_BCL2L2-      agacacacgggctctagtggctgactttgtaggctataagctgaggcaga
A0A250YBR2_BCL2L2-      agacacacgggctctggtggctgactttgtaggctataagctgaggcaga
A0A250YBR2_BCL2L2-      agacacacgggctctggtggctgactttgtaggctataagctgaggcaga
W5QDH4_BCL2L2-01        agacacacgggctctagtggcagactttgtgggctataagctgaggcaga
A0A287ATE4_BCL2L2-      agacacacgggctctagtggcagactttgtgggctataagctgaggcaga
A0A3Q9B4M8_BCL2L2-      agacacacgggctctagtggcagactttgtgggctataagatgaggcaga
A0A1U7RC37_BCL2L2-      agacacacgggctctagtggctgactttgtaggctataagctgaggcaga
A0A2I2UAE3_BCL2L2-      agacacacgggctctagtggcagactttgtaggctataagctgaggcaga
M3Y5X5_BCL2L2-01        agacacacgggctctagtggcagactttgtaggctataagctgaggcaga
G1LMC3_BCL2L2-01        agacacacgggctctagtggcagactttgtaggctataagctgaggcaga
A0A452SHI1_BCL2L2-      agacacacgggctctagtggcagactttgtaggctataagctgaggcaga
A0A286XQQ9_BCL2L2-      agacacacgggctctggtggctgactttgtaggctataagctgaggcaga
L8HP19_BCL2L2-02        agacacacgggctctagtggcagactttgtgggctataagctgaggcaga
L8HP19_BCL2L2-01        agacacacgggctctagtggcagactttgtgggctataagctgaggcaga
Q1RMX3_BCL2L2-01        agacacacgggctctagtggcagactttgtgggctataagctgaggcaga
Q05KI8_BCL2L2-01        agacacacgggctctagtggcagactttgtgggctataagctgaggcaga
A0A452ECF0_BCL2L2-      agacacacgggctctagtggcagactttgtgggctataagctgaggcaga
W5QDH4_BCL2L2-02        agacacacgggctctagtggcagactttgtgggctataagctgaggcaga
H0XR82_BCL2L2-01        agacacacgggctctggtggcagactttgtaggctataagctgaggcaga
A0A2K6GWM6_BCL2L2-      agacacacgggctctggtggcagactttgtaggctataagctgaggcaga
A0A287D9B3_BCL2L2-      agacacacgggctctggtggccgactttgtaggctataagctgaggcaga
A0A1U7UJF2_BCL2L2-      agacacacgggctctggtggcagactttgtaggctataagctgaggcaga
A0A1S3FYD8_BCL2L2-      agacacacgggctctggtggctgactttgtaggctataaactgaggcaga
A0A2K6TM77_BCL2L2-      agacacacgggctctggtggcagactttgtaggttataagctgaggcaga
A0A2K5CWY6_BCL2L2-      agacacacgggctctggtggcagactttgtaggttataagctgaggcaga
A0A2K5CWY6_BCL2L2-      agacacacgggctctggtggcagactttgtaggttataagctgaggcaga
A0A2K5RUN8_BCL2L2-      agacacacgggctctggtggcagactttgtaggttataagctgaggcaga
A0A2R9A2Q3_BCL2L2-      agacacacgggctctggtggcagactttgtaggttataagctgaggcaga
H2Q805_BCL2L2-01        agacacacgggctctggtggcagactttgtaggttataagctgaggcaga
A0A2I2YPX6_BCL2L2-      agacacacgggctctggtggcagactttgtaggttataagctgaggcaga
A0A2I3GEA7_BCL2L2-      agacacacgggctctggtggcagactttgtaggttataagctgaggcaga
A0A2K5MZX9_BCL2L2-      agacacacgggctctggtggcagactttgtaggttataagctgaggcaga
A0A2K6EA59_BCL2L2-      agacacacgggctctggtggcagactttgtaggttataagctgaggcaga
A0A2K5V0Q3_BCL2L2-      agacacacgggctctggtggcagactttgtaggttataagctgaggcaga
F7G4L5_BCL2L2-01        agacacacgggctctggtggcagactttgtaggttataagctgaggcaga
A0A2K6AI25_BCL2L2-      agacacacgggctctggtggcagactttgtaggttataagctgaggcaga
A0A096NX09_BCL2L2-      agacacacgggctctggtggcagactttgtaggttataagctgaggcaga
A0A2K6RW35_BCL2L2-      agacacacgggctctggtggcagactttttaggttataagctgaggcaga
A0A2K6RW35_BCL2L2-      agacacacgggctctggtggcagactttttaggttataagctgaggcaga
A0A2K6ME72_BCL2L2-      agacacacgggctctggtggcagactttgtaggttataagctgaggcaga
A0A0D9RU30_BCL2L2-      agacacacgggctctggtggcagactttgtaggttataagctgaggcaga
A0A2K5HEJ9_BCL2L2-      agacacacgggctctggtggcagactttgtaggttataagctgaggcaga
G3TMU7_BCL2L2-01        agacacacgggctctggtggcagactttgtgggctacaagctgaggcaga
O88996_BCL2L2-01        agacacacgggctctagtggctgactttgtaggctataagctgaggcaga
Q7TS60_BCL2L2-01        agacacacgggctctagtggctgactttgtaggctataagctgaggcaga
A0A287D9B3_BCL2L2-      agacacacgggctctggtggccgactttgtaggctataagctgaggcaga
P70345_BCL2L2-02        --------------------------------------------------
P70345_BCL2L2-01        agacacacgggctctagtggctgactttgtaggctataagctgaggcaga
A0A452UF16_BCL2L2-      agacacacgggctctagtggcagactttgtaggctataagctgaggcaga
A0A452UF16_BCL2L2-      agacacacgggctctagtggcagactttgtaggctataagctgaggcaga
A0A4D6NWN1_BCL2L2-      agacacacgggctctagtggcagactttgtgggctataagctgaggcaga
A0A287ATE4_BCL2L2-      agacacacgggctctagtggcagactttgtgggctataagctgaggcaga
A0A287ATE4_BCL2L2-      agacacacgggctctagtggcagactttgtgggctataagctgaggcaga
A0A1U7UJF2_BCL2L2-      agacacacgggctctggtggcagactttgtaggctataagctgaggcaga
A0A2K6GWM6_BCL2L2-      agacacacgggctctggtggcagactttgtaggctataagctgaggcaga
A0A2R9A2Q3_BCL2L2-      agacacacgggctctggtggcagactttgtaggttataagctgaggcaga
H2Q805_BCL2L2-02        agacacacgggctctggtggcagactttgtaggttataagctgaggcaga
A0A2I2YPX6_BCL2L2-      agacacacgggctctggtggcagactttgtaggttataagctgaggcaga
A0A2I3GEA7_BCL2L2-      agacacacgggctctggtggcagactttgtaggttataagctgaggcaga
A0A096NX09_BCL2L2-      agacacacgggctctggtggcagactttgtaggttataagctgaggcaga
A0A2K5V0Q3_BCL2L2-      agacacacgggctctggtggcagactttgtaggttataagctgaggcaga
F7G4L5_BCL2L2-02        agacacacgggctctggtggcagactttgtaggttataagctgaggcaga
A0A2K6AI25_BCL2L2-      agacacacgggctctggtggcagactttgtaggttataagctgaggcaga
A0A2K5MZX9_BCL2L2-      agacacacgggctctggtggcagactttgtaggttataagctgaggcaga
A0A2K6EA59_BCL2L2-      agacacacgggctctggtggcagactttgtaggttataagctgaggcaga
A0A2K5HEJ9_BCL2L2-      agacacacgggctctggtggcagactttgtaggttataagctgaggcaga
A0A2K6ME72_BCL2L2-      agacacacgggctctggtggcagactttgtaggttataagctgaggcaga
A0A2K6RW35_BCL2L2-      agacacacgggctctggtggcagactttttaggttataagctgaggcaga
A0A2R8M4C0_BCL2L2-      agacacacgggctctggtggcagactttgtaggttataagctgaggcaga
A0A2K5RUN8_BCL2L2-      agacacacgggctctggtggcagactttgtaggttataagctgaggcaga
A0A2K6TM77_BCL2L2-      agacacacgggctctggtggcagactttgtaggttataagctgaggcaga
                                                                          

Q5XGJ4_BCL2L2-01        gtagtctagttc-cggagcctgc--------aggagcagcatcctgttct
H3AAS7_BCL2L2-02        aggggtactctcagcagggtgcccc---aacggatccccccgccaaccca
H3AAS7_BCL2L2-01        aggggtactctcagcagggtgcccc---aacggatccccccgccaaccca
F7G6M3_BCL2L2-01        agggcttcgcctgcggggccgggcccggggagggccccccggcccagccc
G3WPT1_BCL2L2-01        agggctatgcctgtggaactggcccaggagagggccctacaaatgagcct
G3WPT1_BCL2L2-02        agggctatgcctgtggaactggcccaggagagggccctacaaatgagcct
G1Q051_BCL2L2-01        agggttatgtttgtggagcgggtcccggagagggcccagcagctgaccca
G1TV33_BCL2L2-01        agggttatgtctgtggggctggccctggagagggcccggcagctaacccg
G1P3J2_BCL2L2-01        agggttatgtttgtggagcgggtcccggagagggcccagcagctgacccg
A0A482LX62_BCL2L2-      agggttatgtctgtggagctggccccggggagggcccagcagctgacccg
A0A1U7RC37_BCL2L2-      agggctatgtctgtggagctggccctggggagggcccagcagccgacccg
A0A250YBR2_BCL2L2-      agggttatgtctgtggagctggccctggagagggcccagctgctgacccg
A0A250YBR2_BCL2L2-      agggttatgtctgtggagctggccctggagagggcccagctgctgacccg
W5QDH4_BCL2L2-01        aggggtatgtttgtggagctggccccggggagggcccagcagctgacccg
A0A287ATE4_BCL2L2-      agggttatgtctgtggagctggccccggggagggcccagcagctgacccg
A0A3Q9B4M8_BCL2L2-      agggttatgtctgtggagctggccccggggagggcccagcagctgacccg
A0A1U7RC37_BCL2L2-      agggctatgtctgtggagctggccctggggagggcccagcagccgacccg
A0A2I2UAE3_BCL2L2-      agggttatgtttgtggagcaggccctggggagggcccagcagctgaccca
M3Y5X5_BCL2L2-01        agggttatgtttgtggagctggccctggggagggcccagcagctgaccca
G1LMC3_BCL2L2-01        aaggttatgtgtgtggagctggccctggggagggcccagcagctgaccca
A0A452SHI1_BCL2L2-      aaggttatgtgtgtggagctggccctggggagggcccagcagctgaccca
A0A286XQQ9_BCL2L2-      agggttatgtctgtggagctggccctggggagggcccagcagctgacccg
L8HP19_BCL2L2-02        aggggtatgtttgtggagctggccccggggagggcccagcagctgacccg
L8HP19_BCL2L2-01        aggggtatgtttgtggagctggccccggggagggcccagcagctgacccg
Q1RMX3_BCL2L2-01        aggggtatgtttgtggagctggccccggggagggcccagcagctgacccg
Q05KI8_BCL2L2-01        aggggtatgtttgtggagctggccccggggagggcccagcagctgacccg
A0A452ECF0_BCL2L2-      aggggtatgtttgtggagctggccccggggagggcccagcagctgacccg
W5QDH4_BCL2L2-02        aggggtatgtttgtggagctggccccggggagggcccagcagctgacccg
H0XR82_BCL2L2-01        agggttatgtctgtggagctggcccaggggagggcccagcaactgacccg
A0A2K6GWM6_BCL2L2-      agggttatgtctgtggagctggcccgggggagggcccagcagctgacccg
A0A287D9B3_BCL2L2-      agggttacgtctgtggagctggccctggggagggcccagcagctgatcca
A0A1U7UJF2_BCL2L2-      agggttatgtctgtggagccggccctggggagggcccagcagccgacccg
A0A1S3FYD8_BCL2L2-      agggttatgtctgtggagcgggccctggggagggcccagcagctgaccca
A0A2K6TM77_BCL2L2-      agggttatgtctgtggagctggccccggggagggcccagcagctgacccg
A0A2K5CWY6_BCL2L2-      agggttatgtctgtggagctggccccggggagggcccagcagctgacccg
A0A2K5CWY6_BCL2L2-      agggttatgtctgtggagctggccccggggagggcccagcagctgacccg
A0A2K5RUN8_BCL2L2-      agggttatgtctgtggagctggccccggggagggcccagcagctgacccg
A0A2R9A2Q3_BCL2L2-      agggttatgtctgtggagctggccccggggagggcccagcagctgacccg
H2Q805_BCL2L2-01        agggttatgtctgtggagctggccccggggagggcccagcagctgacccg
A0A2I2YPX6_BCL2L2-      agggttatgtctgtggagctggccccggggagggcccagcagctgacccg
A0A2I3GEA7_BCL2L2-      agggttatgtctgtggagctggccccggggagggcccagcagctgacccg
A0A2K5MZX9_BCL2L2-      agggttatgtctgtggagctggccctggggagggcccagcagctgacccg
A0A2K6EA59_BCL2L2-      agggttatgtctgtggagctggccctggggagggcccagcagctgacccg
A0A2K5V0Q3_BCL2L2-      agggttatgtctgtggagctggccccggggagggcccagcagctgacccg
F7G4L5_BCL2L2-01        agggttatgtctgtggagctggccccggggagggcccagcagctgacccg
A0A2K6AI25_BCL2L2-      agggttatgtctgtggagctggccccggggagggcccagcagctgacccg
A0A096NX09_BCL2L2-      agggttatgtctgtggagctggccccggggagggcccagcagctgacccg
A0A2K6RW35_BCL2L2-      agggttatgtctgtggagctggccctggggagggcccagcagctgacccg
A0A2K6RW35_BCL2L2-      agggttatgtctgtggagctggccctggggagggcccagcagctgacccg
A0A2K6ME72_BCL2L2-      agggttatgtctgtggagctggccctggggagggcccagcagctgacccg
A0A0D9RU30_BCL2L2-      agggttatgtctgtggagctggccccggggagggcccagcagctgacccg
A0A2K5HEJ9_BCL2L2-      agggttatgtctgtggagctggccccggggagggcccagcagctgacccg
G3TMU7_BCL2L2-01        agggttatgtttgtggagctggccccggggagggcccagcagctgacccg
O88996_BCL2L2-01        agggttatgtctgtggagctggccctggggaaggcccagcagccgacccg
Q7TS60_BCL2L2-01        agggttatgtctgtggagctggccctggggaaggcccagcagccgacccg
A0A287D9B3_BCL2L2-      agggttacgtctgtggagctggccctggggagggcccagcagctgatcca
P70345_BCL2L2-02        --------------------------------------------------
P70345_BCL2L2-01        agggttatgtctgtggagctggccctggggaaggcccagccgccgacccg
A0A452UF16_BCL2L2-      aaggttatgtgtgtggagctggccctggggagggcccagcagctgaccca
A0A452UF16_BCL2L2-      aaggttatgtgtgtggagctggccctggggagggcccagcagctgaccca
A0A4D6NWN1_BCL2L2-      agggttatgtctgtggagctggccccggggagggcccagcagctgacccg
A0A287ATE4_BCL2L2-      agggttatgtctgtggagctggccccggggagggcccagcagctgacccg
A0A287ATE4_BCL2L2-      agggttatgtctgtggagctggccccggggagggcccagcagctgacccg
A0A1U7UJF2_BCL2L2-      agggttatgtctgtggagccggccctggggagggcccagcagccgacccg
A0A2K6GWM6_BCL2L2-      agggttatgtctgtggagctggcccgggggagggcccagcagctgacccg
A0A2R9A2Q3_BCL2L2-      agggttatgtctgtggagctggccccggggagggcccagcagctgacccg
H2Q805_BCL2L2-02        agggttatgtctgtggagctggccccggggagggcccagcagctgacccg
A0A2I2YPX6_BCL2L2-      agggttatgtctgtggagctggccccggggagggcccagcagctgacccg
A0A2I3GEA7_BCL2L2-      agggttatgtctgtggagctggccccggggagggcccagcagctgacccg
A0A096NX09_BCL2L2-      agggttatgtctgtggagctggccccggggagggcccagcagctgacccg
A0A2K5V0Q3_BCL2L2-      agggttatgtctgtggagctggccccggggagggcccagcagctgacccg
F7G4L5_BCL2L2-02        agggttatgtctgtggagctggccccggggagggcccagcagctgacccg
A0A2K6AI25_BCL2L2-      agggttatgtctgtggagctggccccggggagggcccagcagctgacccg
A0A2K5MZX9_BCL2L2-      agggttatgtctgtggagctggccctggggagggcccagcagctgacccg
A0A2K6EA59_BCL2L2-      agggttatgtctgtggagctggccctggggagggcccagcagctgacccg
A0A2K5HEJ9_BCL2L2-      agggttatgtctgtggagctggccccggggagggcccagcagctgacccg
A0A2K6ME72_BCL2L2-      agggttatgtctgtggagctggccctggggagggcccagcagctgacccg
A0A2K6RW35_BCL2L2-      agggttatgtctgtggagctggccctggggagggcccagcagctgacccg
A0A2R8M4C0_BCL2L2-      aaggttatgtctgtggaactggccccggggagggcccagcagctgacccg
A0A2K5RUN8_BCL2L2-      agggttatgtctgtggagctggccccggggagggcccagcagctgacccg
A0A2K6TM77_BCL2L2-      agggttatgtctgtggagctggccccggggagggcccagcagctgacccg
                                                                          

Q5XGJ4_BCL2L2-01        ttgcattcagccatgcgtgctgcaggggatgaatttgaagagagattcag
H3AAS7_BCL2L2-02        ctctaccgtgccatgcgggaggcgggggatgagtttgaggcccgcttcca
H3AAS7_BCL2L2-01        ctctaccgtgccatgcgggaggcgggggatgagtttgaggcccgcttcca
F7G6M3_BCL2L2-01        ctgcaccgggccatgcgggccgccggggacgagttcgagtcacgcttccg
G3WPT1_BCL2L2-01        ctgcaccgggccatgcgagccgctggagatgagtttgagtcccgtttccg
G3WPT1_BCL2L2-02        ctgcaccgggccatgcgagccgctggagatgagtttgagtcccgtttccg
G1Q051_BCL2L2-01        ctgcaccaagccatgcgggcagctggagatgagtttgagacccatttccg
G1TV33_BCL2L2-01        ctgcaccaagccatgcgggcagccggagatgagttcgagacccgcttccg
G1P3J2_BCL2L2-01        ctgcaccaagccatgcgggcagctggagatgagttcgagacccgtttccg
A0A482LX62_BCL2L2-      ctgcaccaagccatgcgggcagctggagatgagttcgagacccgcttccg
A0A1U7RC37_BCL2L2-      ctgcaccaagccatgcgggctgctggagacgagtttgagacccgcttccg
A0A250YBR2_BCL2L2-      ttacaccaagccatgcgggcagctggagatgagtttgagacccgcttccg
A0A250YBR2_BCL2L2-      ttacaccaagccatgcgggcagctggagatgagtttgagacccgcttccg
W5QDH4_BCL2L2-01        ctacaccaagccatgcgggcagctggagatgagtttgagacccgcttccg
A0A287ATE4_BCL2L2-      ctgcaccaagccatgcgggcagctggagatgagttcgagacccgcttccg
A0A3Q9B4M8_BCL2L2-      ctgcaccaagccatgcgggcagctggagatgagttcgagacccgcttccg
A0A1U7RC37_BCL2L2-      ctgcaccaagccatgcgggctgctggagacgagtttgagacccgcttccg
A0A2I2UAE3_BCL2L2-      ctgcaccaagccatgcgtgcagctggagatgagtttgagacccgcttccg
M3Y5X5_BCL2L2-01        ctgcaccaagccatgcgggcagctggagatgagtttgagacccgcttccg
G1LMC3_BCL2L2-01        ctgcaccaagccatgcgggcagctggagatgagtttgagacccgcttccg
A0A452SHI1_BCL2L2-      ctgcaccaagccatgcgggcagctggagatgagtttgagacccgcttccg
A0A286XQQ9_BCL2L2-      ctgcaccaagccatgcgggcagctggggatgagttcgagacccgattccg
L8HP19_BCL2L2-02        ctacaccaagccatgcgggcagctggagatgagttcgagacccgcttccg
L8HP19_BCL2L2-01        ctacaccaagccatgcgggcagctggagatgagttcgagacccgcttccg
Q1RMX3_BCL2L2-01        ctacaccaagccatgcgggcagctggagatgagttcgagacccgcttccg
Q05KI8_BCL2L2-01        ctacaccaagccatgcgggcagctggagatgagttcgagacccgcttccg
A0A452ECF0_BCL2L2-      ctacaccaagccatgcgggcagctggagatgagtttgagacccgcttccg
W5QDH4_BCL2L2-02        ctacaccaagccatgcgggcagctggagatgagtttgagacccgcttccg
H0XR82_BCL2L2-01        ttgcaccaagccatgcgggcagctggagatgagttcgagacccgcttccg
A0A2K6GWM6_BCL2L2-      ctgcaccaagccatgcgggcagctggagatgagtttgagacccgcttccg
A0A287D9B3_BCL2L2-      ctgcaccaagccatgcgggcagctggagatgagttcgagacccgcttccg
A0A1U7UJF2_BCL2L2-      ctgcaccaagccatgcgggcagctggagatgagttcgagacccgcttccg
A0A1S3FYD8_BCL2L2-      ctgcatcaagccatgcgggcagctggagatgaatttgagacccgcttccg
A0A2K6TM77_BCL2L2-      ctgcaccaagcaatgcgggcagctggagatgagttcgagacccgcttccg
A0A2K5CWY6_BCL2L2-      ctgcaccaagcaatgcgggcagctggagatgagttcgagacccgcttccg
A0A2K5CWY6_BCL2L2-      ctgcaccaagcaatgcgggcagctggagatgagttcgagacccgcttccg
A0A2K5RUN8_BCL2L2-      ctgcaccaagcaatgcgggcagctggagatgagttcgagacccgcttccg
A0A2R9A2Q3_BCL2L2-      ctgcaccaagccatgcgggcagctggagatgagttcgagacccgcttccg
H2Q805_BCL2L2-01        ctgcaccaagccatgcgggcagctggagatgagttcgagacccgcttccg
A0A2I2YPX6_BCL2L2-      ctgcaccaagccatgcgggcagctggagatgagttcgagacccgcttccg
A0A2I3GEA7_BCL2L2-      ctgcaccaagccatgcgggcagctggagatgagttcgagacccgcttccg
A0A2K5MZX9_BCL2L2-      ctgcaccaagccatgcgggcagctggagatgagttcgagacccgcttccg
A0A2K6EA59_BCL2L2-      ctgcaccaagccatgcgggcagctggagatgagttcgagacccgcttccg
A0A2K5V0Q3_BCL2L2-      ctgcaccaagccatgcgggcagctggagatgagttcgagacccgcttccg
F7G4L5_BCL2L2-01        ctgcaccaagccatgcgggcagctggagatgagttcgagacccgcttccg
A0A2K6AI25_BCL2L2-      ctgcaccaagccatgcgggcagctggagatgagttcgagacccgcttccg
A0A096NX09_BCL2L2-      ctgcaccaagccatgcgggcagctggagatgagttcgagacccgcttccg
A0A2K6RW35_BCL2L2-      ctgcaccaagccatgcgggcagctggagatgagttcgagacccgcttccg
A0A2K6RW35_BCL2L2-      ctgcaccaagccatgcgggcagctggagatgagttcgagacccgcttccg
A0A2K6ME72_BCL2L2-      ctgcaccaagccatgcgggcagctggagatgagttcgagacccgcttccg
A0A0D9RU30_BCL2L2-      ctgcaccaagccatgcgggcagctggagatgagttcgagacccgcttccg
A0A2K5HEJ9_BCL2L2-      ctgcaccaagccatgcgggcagctggagatgagttcgagacccgcttccg
G3TMU7_BCL2L2-01        ctgcaccaagccatgcgggcagctggagatgagttcgagacccgcttccg
O88996_BCL2L2-01        ctgcaccaagccatgcgggcagctggagacgagtttgagacccgcttccg
Q7TS60_BCL2L2-01        ctgcaccaagccatgcgggcagctggagacgagtttgagacccgcttccg
A0A287D9B3_BCL2L2-      ctgcaccaagccatgcgggcagctggagatgagttcgagacccgcttccg
P70345_BCL2L2-02        --------------------------------------------------
P70345_BCL2L2-01        ctgcaccaagccatgcgggctgctggagacgagtttgagacccgtttccg
A0A452UF16_BCL2L2-      ctgcaccaagccatgcgggcagctggagatgagtttgagacccgcttccg
A0A452UF16_BCL2L2-      ctgcaccaagccatgcgggcagctggagatgagtttgagacccgcttccg
A0A4D6NWN1_BCL2L2-      ctgcaccaagccatgcgggcagctggagatgagttcgagacccgcttccg
A0A287ATE4_BCL2L2-      ctgcaccaagccatgcgggcagctggagatgagttcgagacccgcttccg
A0A287ATE4_BCL2L2-      ctgcaccaagccatgcgggcagctggagatgagttcgagacccgcttccg
A0A1U7UJF2_BCL2L2-      ctgcaccaagccatgcgggcagctggagatgagttcgagacccgcttccg
A0A2K6GWM6_BCL2L2-      ctgcaccaagccatgcgggcagctggagatgagtttgagacccgcttccg
A0A2R9A2Q3_BCL2L2-      ctgcaccaagccatgcgggcagctggagatgagttcgagacccgcttccg
H2Q805_BCL2L2-02        ctgcaccaagccatgcgggcagctggagatgagttcgagacccgcttccg
A0A2I2YPX6_BCL2L2-      ctgcaccaagccatgcgggcagctggagatgagttcgagacccgcttccg
A0A2I3GEA7_BCL2L2-      ctgcaccaagccatgcgggcagctggagatgagttcgagacccgcttccg
A0A096NX09_BCL2L2-      ctgcaccaagccatgcgggcagctggagatgagttcgagacccgcttccg
A0A2K5V0Q3_BCL2L2-      ctgcaccaagccatgcgggcagctggagatgagttcgagacccgcttccg
F7G4L5_BCL2L2-02        ctgcaccaagccatgcgggcagctggagatgagttcgagacccgcttccg
A0A2K6AI25_BCL2L2-      ctgcaccaagccatgcgggcagctggagatgagttcgagacccgcttccg
A0A2K5MZX9_BCL2L2-      ctgcaccaagccatgcgggcagctggagatgagttcgagacccgcttccg
A0A2K6EA59_BCL2L2-      ctgcaccaagccatgcgggcagctggagatgagttcgagacccgcttccg
A0A2K5HEJ9_BCL2L2-      ctgcaccaagccatgcgggcagctggagatgagttcgagacccgcttccg
A0A2K6ME72_BCL2L2-      ctgcaccaagccatgcgggcagctggagatgagttcgagacccgcttccg
A0A2K6RW35_BCL2L2-      ctgcaccaagccatgcgggcagctggagatgagttcgagacccgcttccg
A0A2R8M4C0_BCL2L2-      ctgcaccaagcaatgcgggcagctggagatgaattcgagacccgcttccg
A0A2K5RUN8_BCL2L2-      ctgcaccaagcaatgcgggcagctggagatgagttcgagacccgcttccg
A0A2K6TM77_BCL2L2-      ctgcaccaagcaatgcgggcagctggagatgagttcgagacccgcttccg
                                                                          

Q5XGJ4_BCL2L2-01        acaagcattcagtgagatctccacacagatccatgtgacccctggcacag
H3AAS7_BCL2L2-02        ccgcaccttcaactccttgtcgtcacaccttcacatcacaccgggcacgg
H3AAS7_BCL2L2-01        ccgcaccttcaactccttgtcgtcacaccttcacatcacaccgggcacgg
F7G6M3_BCL2L2-01        gcgggccttctcggacttggcgtcccagctgcacgtgacgcccggctcgg
G3WPT1_BCL2L2-01        acgcacattttctgatctggctgctcagttgcatgtgactcctggctcag
G3WPT1_BCL2L2-02        acgcacattttctgatctggctgctcagttgcatgtgactcctggctcag
G1Q051_BCL2L2-01        atgcaccttctctgatctggtggctcagctgcatgtgaccccaggttcag
G1TV33_BCL2L2-01        gcaaaacttctccgacctggccgctcagttgcatgtgaccccaggctcag
G1P3J2_BCL2L2-01        tcgcaccttctctgatctggcggctcagctgcatgtgaccccgggctcag
A0A482LX62_BCL2L2-      gcgcaccttctcagatttggcagctcagttgcatgtgaccccgggctcgg
A0A1U7RC37_BCL2L2-      gcgcaccttctccgacctggctgctcagctccacgtgaccccaggctcag
A0A250YBR2_BCL2L2-      gcgcacattctctgatctggcggctcagctacatgtgaccccaggctcag
A0A250YBR2_BCL2L2-      gcgcacattctctgatctggcggctcagctacatgtgaccccaggctcag
W5QDH4_BCL2L2-01        gcgcaccttctccgatttggcagctcagctgcatgtgaccccgggttcgg
A0A287ATE4_BCL2L2-      gcgcaccttctcagatttggcagctcagttgcatgtgaccccgggctcgg
A0A3Q9B4M8_BCL2L2-      gcgcaccttctcagatttggcagctcagttgcatgtgaccccgggctcgg
A0A1U7RC37_BCL2L2-      gcgcaccttctccgacctggctgctcagctccacgtgaccccaggctcag
A0A2I2UAE3_BCL2L2-      gcgcaccttctctgatttggcagcccagttgcatgtgacccctgggtcag
M3Y5X5_BCL2L2-01        gcgtaccttctctgatttggcagcccagctgcatgtgaccccaggctcgg
G1LMC3_BCL2L2-01        gcgcaccttctctgatttggcagcccagctgcatgtgaccccaggctcag
A0A452SHI1_BCL2L2-      gcgcaccttctctgatttggcagcccagctgcatgtgaccccaggctcag
A0A286XQQ9_BCL2L2-      gcgcaccttctctgatctggctgctcagctgcatgtgacccctggctcag
L8HP19_BCL2L2-02        gcgcaccttctccgatctggcagctcagctgcatgtgaccccgggctcgg
L8HP19_BCL2L2-01        gcgcaccttctccgatctggcagctcagctgcatgtgaccccgggctcgg
Q1RMX3_BCL2L2-01        gcgcaccttctccgatctggcagctcagctgcatgtgaccccgggctcgg
Q05KI8_BCL2L2-01        gcgcaccttctccgatctggcagctcagctgcatgtgaccccgggctcgg
A0A452ECF0_BCL2L2-      gcgcaccttctccgatctggcagctcagctgcatgtgaccccgggttcgg
W5QDH4_BCL2L2-02        gcgcaccttctccgatttggcagctcagctgcatgtgaccccgggttcgg
H0XR82_BCL2L2-01        gcgtaccttctctgatctggcagctcagctacatgtgaccccaggctcag
A0A2K6GWM6_BCL2L2-      gcgtaccttctctgatctggcggctcagctgcatgtgacccccggctcag
A0A287D9B3_BCL2L2-      gcgcaccttctctgatctggcagctcagctgcatgtgaccccgggttcag
A0A1U7UJF2_BCL2L2-      gcgcacgttctctgatctggcggctcagctgcatgtgaccccaggctcag
A0A1S3FYD8_BCL2L2-      gcgcaccttctctgatctggcagctcagctgcatgtgaccccaggctcag
A0A2K6TM77_BCL2L2-      gcgcaccttctctgatctggcggctcagctgcatgtgaccccaggctcag
A0A2K5CWY6_BCL2L2-      gcgcaccttctctgatctggcggctcagctgcatgtgaccccaggctcag
A0A2K5CWY6_BCL2L2-      gcgcaccttctctgatctggcggctcagctgcatgtgaccccaggctcag
A0A2K5RUN8_BCL2L2-      gcgcaccttctctgatctggcggctcagctgcatgtgaccccaggctcag
A0A2R9A2Q3_BCL2L2-      gcgcaccttctctgatctggcggctcagctgcatgtgaccccaggctcag
H2Q805_BCL2L2-01        gcgcaccttctctgatctggcggctcagctgcatgtgaccccaggctcag
A0A2I2YPX6_BCL2L2-      gcgcaccttctctgatctggcggctcagctgcatgtgaccccaggctcag
A0A2I3GEA7_BCL2L2-      gcgcaccttctctgatctggcggctcagctgcatgtgaccccaggctcag
A0A2K5MZX9_BCL2L2-      gcgcaccttctctgatctggcggctcagctgcatgtgaccccaggctcag
A0A2K6EA59_BCL2L2-      gcgcaccttctctgatctggcggctcagctgcatgtgaccccaggctcag
A0A2K5V0Q3_BCL2L2-      gcgcaccttctctgatctggcggctcagctgcatgtgaccccaggctcag
F7G4L5_BCL2L2-01        gcgcaccttctctgatctggcggctcagctgcatgtgaccccaggctcag
A0A2K6AI25_BCL2L2-      gcgcaccttctctgatctggcggctcagctgcatgtgaccccaggctcag
A0A096NX09_BCL2L2-      gcgcaccttctctgatctggcggctcagctgcatgtgaccccaggctcag
A0A2K6RW35_BCL2L2-      gcgcaccttctctgatctggcggctcagctgcatgtgaccccaggctcag
A0A2K6RW35_BCL2L2-      gcgcaccttctctgatctggcggctcagctgcatgtgaccccaggctcag
A0A2K6ME72_BCL2L2-      gcgcaccttctctgatctggcggctcagctgcatgtgaccccaggctcag
A0A0D9RU30_BCL2L2-      gcgcaccttctctgatctggcggctcagctgcatgtgaccccaggctcag
A0A2K5HEJ9_BCL2L2-      gcgcaccttctctgatctggcggctcagctgcatgtgaccccaggctcag
G3TMU7_BCL2L2-01        gcgcaccttctctgatctggcagcccagctgcatgtgaccccaggctcag
O88996_BCL2L2-01        gcgcaccttctctgacctggccgctcagctacacgtgaccccaggctcag
Q7TS60_BCL2L2-01        gcgcaccttctctgacctggccgctcagctacacgtgaccccaggctcag
A0A287D9B3_BCL2L2-      gcgcaccttctctgatctggcagctcagctgcatgtgaccccgggttcag
P70345_BCL2L2-02        --------------------------------------------------
P70345_BCL2L2-01        ccgcaccttctctgacctggccgctcagctacacgtgaccccaggctcag
A0A452UF16_BCL2L2-      gcgcaccttctctgatttggcagcccagctgcatgtgaccccaggctcag
A0A452UF16_BCL2L2-      gcgcaccttctctgatttggcagcccagctgcatgtgaccccaggctcag
A0A4D6NWN1_BCL2L2-      gcgcaccttctcagatttggcagctcagttgcatgtgaccccgggctcgg
A0A287ATE4_BCL2L2-      gcgcaccttctcagatttggcagctcagttgcatgtgaccccgggctcgg
A0A287ATE4_BCL2L2-      gcgcaccttctcagatttggcagctcagttgcatgtgaccccgggctcgg
A0A1U7UJF2_BCL2L2-      gcgcacgttctctgatctggcggctcagctgcatgtgaccccaggctcag
A0A2K6GWM6_BCL2L2-      gcgtaccttctctgatctggcggctcagctgcatgtgacccccggctcag
A0A2R9A2Q3_BCL2L2-      gcgcaccttctctgatctggcggctcagctgcatgtgaccccaggctcag
H2Q805_BCL2L2-02        gcgcaccttctctgatctggcggctcagctgcatgtgaccccaggctcag
A0A2I2YPX6_BCL2L2-      gcgcaccttctctgatctggcggctcagctgcatgtgaccccaggctcag
A0A2I3GEA7_BCL2L2-      gcgcaccttctctgatctggcggctcagctgcatgtgaccccaggctcag
A0A096NX09_BCL2L2-      gcgcaccttctctgatctggcggctcagctgcatgtgaccccaggctcag
A0A2K5V0Q3_BCL2L2-      gcgcaccttctctgatctggcggctcagctgcatgtgaccccaggctcag
F7G4L5_BCL2L2-02        gcgcaccttctctgatctggcggctcagctgcatgtgaccccaggctcag
A0A2K6AI25_BCL2L2-      gcgcaccttctctgatctggcggctcagctgcatgtgaccccaggctcag
A0A2K5MZX9_BCL2L2-      gcgcaccttctctgatctggcggctcagctgcatgtgaccccaggctcag
A0A2K6EA59_BCL2L2-      gcgcaccttctctgatctggcggctcagctgcatgtgaccccaggctcag
A0A2K5HEJ9_BCL2L2-      gcgcaccttctctgatctggcggctcagctgcatgtgaccccaggctcag
A0A2K6ME72_BCL2L2-      gcgcaccttctctgatctggcggctcagctgcatgtgaccccaggctcag
A0A2K6RW35_BCL2L2-      gcgcaccttctctgatctggcggctcagctgcatgtgaccccaggctcag
A0A2R8M4C0_BCL2L2-      gcgcaccttctctgatctggcggctcagctgcatgtgaccccaggttcag
A0A2K5RUN8_BCL2L2-      gcgcaccttctctgatctggcggctcagctgcatgtgaccccaggctcag
A0A2K6TM77_BCL2L2-      gcgcaccttctctgatctggcggctcagctgcatgtgaccccaggctcag
                                                                          

Q5XGJ4_BCL2L2-01        catatgcacgctttgcagaagtagcaggtagcctgttccaaggtggggtg
H3AAS7_BCL2L2-02        cttaccggcgatttgctgagacggcagacagcctcttccaggatggggtg
H3AAS7_BCL2L2-01        cttaccggcgatttgctgagacggcagacagcctcttccaggatggggtg
F7G6M3_BCL2L2-01        cccagcagcgcttcacccaggtgtcggacgagctcttccagggggggccc
G3WPT1_BCL2L2-01        cccagcagcgctttacccaggtctcagatgagctcttccaggggggggcc
G3WPT1_BCL2L2-02        cccagcagcgctttacccaggtctcagatgagctcttccaggggggggcc
G1Q051_BCL2L2-01        cccagcaatgtttcacccaggtctctgatgaactcttccaggggggcccc
G1TV33_BCL2L2-01        cacagcagagcttcacccaggtctgcgatgaacttttccaaaggggtccc
G1P3J2_BCL2L2-01        cccagcaacgcttcacccaggtctctgatgaactcttccaagggggcccc
A0A482LX62_BCL2L2-      cccagcagcgcttcacccaggtctctgatgaactcttccaagggggcccc
A0A1U7RC37_BCL2L2-      cccagcaacgcttcacccaggtttccgacgaacttttccaagggggcccc
A0A250YBR2_BCL2L2-      cccagcaacgcttcacccaggtctctgatgaacttttccaagggggcccc
A0A250YBR2_BCL2L2-      cccagcaacgcttcacccaggtctctgatgaacttttccaagggggcccc
W5QDH4_BCL2L2-01        cccagcagcgcttcacccaggtctctgatgaactcttccaagggggcccc
A0A287ATE4_BCL2L2-      cccagcagcgcttcacccaggtctctgatgaactcttccaaggaggcccc
A0A3Q9B4M8_BCL2L2-      cccagcagcgcttcacccaggtctctgatgaactcttccaagggggcccc
A0A1U7RC37_BCL2L2-      cccagcaacgcttcacccaggtttccgacgaacttttccaagggggcccc
A0A2I2UAE3_BCL2L2-      cccagcaacgcttcacccaggtctctgatgaactcttccaagggggcccc
M3Y5X5_BCL2L2-01        cccagcagcgcttcacccaggtctctgacgaactcttccaagggggcccc
G1LMC3_BCL2L2-01        cccagcaacgcttcacccaggtctctgatgaactcttccaagggggcccc
A0A452SHI1_BCL2L2-      cccagcaacgcttcacccaggtctctgacgaactcttccaagggggcccc
A0A286XQQ9_BCL2L2-      cccagcaacgcttcacccaggtctccgacgaacttttccaaggtggcccc
L8HP19_BCL2L2-02        cccagcaacgcttcacccaggtctctgatgaactcttccaagggggcccc
L8HP19_BCL2L2-01        cccagcaacgcttcacccaggtctctgatgaactcttccaagggggcccc
Q1RMX3_BCL2L2-01        cccagcaacgcttcacccaggtctctgatgaactcttccaagggggcccc
Q05KI8_BCL2L2-01        cccagcaacgcttcacccaggtctctgatgaactcttccaagggggcccc
A0A452ECF0_BCL2L2-      cccagcagcgcttcacccaggtctctgatgaactcttccaagggggcccc
W5QDH4_BCL2L2-02        cccagcagcgcttcacccaggtctctgatgaactcttccaagggggcccc
H0XR82_BCL2L2-01        cccagcaacgcttcacccaggtctctgatgaacttttccaagggggcccc
A0A2K6GWM6_BCL2L2-      cccagcagcgcttcacccaggtctccgatgaacttttccaagggggcccc
A0A287D9B3_BCL2L2-      ctcagcaacgcttcacccaggtctctgacgaacttttccaagggggtccc
A0A1U7UJF2_BCL2L2-      cccagcaacgcttcacccaggtctctgatgaacttttccaagggggcccc
A0A1S3FYD8_BCL2L2-      cccagcaacgcttcacccaggtctctgatgaacttttccaaggaggcccc
A0A2K6TM77_BCL2L2-      cccaacaacgcttcacccaggtctccgatgaacttttccaagggggtccc
A0A2K5CWY6_BCL2L2-      cccaacaacgcttcacccaggtctccgatgaacttttccaagggggccct
A0A2K5CWY6_BCL2L2-      cccaacaacgcttcacccaggtctccgatgaacttttccaagggggccct
A0A2K5RUN8_BCL2L2-      cccaacaacgcttcacccaggtctccgatgaacttttccaagggggcccc
A0A2R9A2Q3_BCL2L2-      cccaacaacgcttcacccaggtctccgatgaactttttcaagggggcccc
H2Q805_BCL2L2-01        cccaacaacgcttcacccaggtctccgatgaactttttcaagggggcccc
A0A2I2YPX6_BCL2L2-      cccaacaacgcttcacccaggtctccgatgaactttttcaagggggcccc
A0A2I3GEA7_BCL2L2-      cccaacaacgcttcacccaggtctccgatgaactttttcaagggggcccc
A0A2K5MZX9_BCL2L2-      cacagcaacgcttcacccaggtctccgatgaacttttccaagggggcccc
A0A2K6EA59_BCL2L2-      cacagcaacgcttcacccaggtctccgatgaacttttccaagggggcccc
A0A2K5V0Q3_BCL2L2-      cacagcaacgcttcacccaggtctccgatgaacttttccaagggggcccc
F7G4L5_BCL2L2-01        cacagcaacgcttcacccaggtctccgatgaacttttccaagggggcccc
A0A2K6AI25_BCL2L2-      cacagcaacgcttcacccaggtctccgatgaacttttccaagggggcccc
A0A096NX09_BCL2L2-      cacagcaacgcttcacccaggtctccgatgaacttttccaagggggcccc
A0A2K6RW35_BCL2L2-      cgcagcaacgcttcacccaggtctctgatgaacttttccaagggggcccc
A0A2K6RW35_BCL2L2-      cgcagcaacgcttcacccaggtctctgatgaacttttccaagggggcccc
A0A2K6ME72_BCL2L2-      cgcagcaacgcttcacccaggtctctgatgaacttttccaagggggcccc
A0A0D9RU30_BCL2L2-      cgcagcaacgcttcacccaggtctccgatgaacttttccaagggggcccc
A0A2K5HEJ9_BCL2L2-      cgcagcaacgcttcacccaggtctctgatgaacttttccaagggggcccc
G3TMU7_BCL2L2-01        cccagcaacgcttcacccaggtctctgatgaactcttccaagggggcccc
O88996_BCL2L2-01        cccagcaacgcttcacccaggtttccgacgaacttttccaagggggcccc
Q7TS60_BCL2L2-01        cccagcaacgcttcacccaggtttccgacgaacttttccaagggggcccc
A0A287D9B3_BCL2L2-      ctcagcaacgcttcacccaggtctctgacgaacttttccaagggggtccc
P70345_BCL2L2-02        --------------------------------------------------
P70345_BCL2L2-01        cccagcaacgcttcacccaggtttccgacgaacttttccaagggggccct
A0A452UF16_BCL2L2-      cccagcaacgcttcacccaggtctctgacgaactcttccaagggggcccc
A0A452UF16_BCL2L2-      cccagcaacgcttcacccaggtctctgacgaactcttccaagggggcccc
A0A4D6NWN1_BCL2L2-      cccagcagcgcttcacccaggtctctgatgaactcttccaagggggcccc
A0A287ATE4_BCL2L2-      cccagcagcgcttcacccaggtctctgatgaactcttccaaggaggcccc
A0A287ATE4_BCL2L2-      cccagcagcgcttcacccaggtctctgatgaactcttccaaggaggcccc
A0A1U7UJF2_BCL2L2-      cccagcaacgcttcacccaggtctctgatgaacttttccaagggggcccc
A0A2K6GWM6_BCL2L2-      cccagcagcgcttcacccaggtctccgatgaacttttccaagggggcccc
A0A2R9A2Q3_BCL2L2-      cccaacaacgcttcacccaggtctccgatgaactttttcaagggggcccc
H2Q805_BCL2L2-02        cccaacaacgcttcacccaggtctccgatgaactttttcaagggggcccc
A0A2I2YPX6_BCL2L2-      cccaacaacgcttcacccaggtctccgatgaactttttcaagggggcccc
A0A2I3GEA7_BCL2L2-      cccaacaacgcttcacccaggtctccgatgaactttttcaagggggcccc
A0A096NX09_BCL2L2-      cacagcaacgcttcacccaggtctccgatgaacttttccaagggggcccc
A0A2K5V0Q3_BCL2L2-      cacagcaacgcttcacccaggtctccgatgaacttttccaagggggcccc
F7G4L5_BCL2L2-02        cacagcaacgcttcacccaggtctccgatgaacttttccaagggggcccc
A0A2K6AI25_BCL2L2-      cacagcaacgcttcacccaggtctccgatgaacttttccaagggggcccc
A0A2K5MZX9_BCL2L2-      cacagcaacgcttcacccaggtctccgatgaacttttccaagggggcccc
A0A2K6EA59_BCL2L2-      cacagcaacgcttcacccaggtctccgatgaacttttccaagggggcccc
A0A2K5HEJ9_BCL2L2-      cgcagcaacgcttcacccaggtctctgatgaacttttccaagggggcccc
A0A2K6ME72_BCL2L2-      cgcagcaacgcttcacccaggtctctgatgaacttttccaagggggcccc
A0A2K6RW35_BCL2L2-      cgcagcaacgcttcacccaggtctctgatgaacttttccaagggggcccc
A0A2R8M4C0_BCL2L2-      cccaacaacgcttcacccaggtctccgatgaacttttccaagggggtccc
A0A2K5RUN8_BCL2L2-      cccaacaacgcttcacccaggtctccgatgaacttttccaagggggcccc
A0A2K6TM77_BCL2L2-      cccaacaacgcttcacccaggtctccgatgaacttttccaagggggtccc
                                                                          

Q5XGJ4_BCL2L2-01        aattggggtcgtatagttgcattttttgtttttggtgccgcactgtgtgc
H3AAS7_BCL2L2-02        aactggggccgggtggtggcgctgttcgtcttcagcgcagcactctgtgt
H3AAS7_BCL2L2-01        aactggggccgggtggtggcgctgttcgtcttcagcgcagcactctgtgt
F7G6M3_BCL2L2-01        aactggggccggctggtggccttcttcgtgttcggggccgcgctctgcgc
G3WPT1_BCL2L2-01        aactggggccgtcttgtggcattcttcgtctttggggcagcgctctgtgc
G3WPT1_BCL2L2-02        aactggggccgtcttgtggcattcttcgtctttggggcagcgctctgtgc
G1Q051_BCL2L2-01        aactggggttaccttgtggccttctttgtctttggagctgctctgtgtgt
G1TV33_BCL2L2-01        aactggggccgcgtggtggccttctttgcctttggggccgcactgtgtgc
G1P3J2_BCL2L2-01        aactggggtcgccttgtggccttctttgtctttggagctgctctgtgtgc
A0A482LX62_BCL2L2-      aactggggccgccttgtggccttctttgtcttcggagctgcactgtgtgc
A0A1U7RC37_BCL2L2-      aattggggccgtcttgtggcattctttgtctttggggccgccctatgtgc
A0A250YBR2_BCL2L2-      aactggggccgtcttgtggccttctttgtctttggggctgccctgtgtgc
A0A250YBR2_BCL2L2-      aactggggccgtcttgtggccttctttgtctttggggctgccctgtgtgc
W5QDH4_BCL2L2-01        aactggggtcgccttgtggccttctttgtctttggagccgcattgtgtgc
A0A287ATE4_BCL2L2-      aactggggccgccttgtggccttctttgtcttcggagctgcactgtgtgc
A0A3Q9B4M8_BCL2L2-      aactggggccgccttgtggccttctttgtcttcggagctgcactgtgtgc
A0A1U7RC37_BCL2L2-      aattggggccgtcttgtggcattctttgtctttggggccgccctatgtgc
A0A2I2UAE3_BCL2L2-      aactggggccgccttgtggccttctttgtctttggagccgcactgtgtgc
M3Y5X5_BCL2L2-01        aactggggccgccttgtggccttctttgtctttggagccgcactgtgtgc
G1LMC3_BCL2L2-01        aactggggccgcctggtggccttctttgtctttggagccgcactgtgtgc
A0A452SHI1_BCL2L2-      aactggggccgcctggtggccttctttgtctttggagccgcactgtgtgc
A0A286XQQ9_BCL2L2-      aactggggccgtcttgtggccttctttgtctttggcgctgccctgtgtgc
L8HP19_BCL2L2-02        aactggggccgccttgtggccttctttgtctttggagccgcgttgtgtgc
L8HP19_BCL2L2-01        aactggggccgccttgtggccttctttgtctttggagccgcgttgtgtgc
Q1RMX3_BCL2L2-01        aactggggccgccttgtggccttctttgtctttggagccgcgttgtgtgc
Q05KI8_BCL2L2-01        aactggggccgccttgtggccttctttgtctttggagccgcgttgtgtgc
A0A452ECF0_BCL2L2-      aactggggtcgccttgtggccttctttgtctttggagccgcactgtgtgc
W5QDH4_BCL2L2-02        aactggggtcgccttgtggccttctttgtctttggagccgcattgtgtgc
H0XR82_BCL2L2-01        aactggggccgccttgtggccttcttcgtctttggggccgcactgtgtgc
A0A2K6GWM6_BCL2L2-      aactggggccgccttgtggccttcttcgtctttggggctgcactgtgtgc
A0A287D9B3_BCL2L2-      aactggggtcgtcttgtggccttctttgtctttggggctgccctgtgtgc
A0A1U7UJF2_BCL2L2-      aactggggccgccttgtggccttctttgtctttggggctgcactctgtgc
A0A1S3FYD8_BCL2L2-      aactggggccgtcttgtggccttctttgtctttggggctgccctgtgtgc
A0A2K6TM77_BCL2L2-      aactggggccgccttgtagccttctttgtctttggggctgcactgtgtgc
A0A2K5CWY6_BCL2L2-      aactggggccgccttgtagccttctttgtctttggggctgcactgtgtgc
A0A2K5CWY6_BCL2L2-      aactggggccgccttgtagccttctttgtctttggggctgcactgtgtgc
A0A2K5RUN8_BCL2L2-      aactggggccgccttgtagccttctttgtctttggggctgcactgtgtgc
A0A2R9A2Q3_BCL2L2-      aactggggccgccttgtagccttctttgtctttggggctgcactgtgtgc
H2Q805_BCL2L2-01        aactggggccgccttgtagccttctttgtctttggggctgcactgtgtgc
A0A2I2YPX6_BCL2L2-      aactggggccgccttgtagccttctttgtctttggggctgcactgtgtgc
A0A2I3GEA7_BCL2L2-      aactggggccgccttgtagccttctttgtctttggggctgcactgtgtgc
A0A2K5MZX9_BCL2L2-      aactggggccgccttgtagccttctttgtctttggggctgcactgtgtgc
A0A2K6EA59_BCL2L2-      aactggggccgccttgtagccttctttgtctttggggctgcactgtgtgc
A0A2K5V0Q3_BCL2L2-      aactggggccgccttgtagccttctttgtctttggggctgcactgtgtgc
F7G4L5_BCL2L2-01        aactggggccgccttgtagccttctttgtctttggggctgcactgtgtgc
A0A2K6AI25_BCL2L2-      aactggggccgccttgtagccttctttgtctttggggctgcactgtgtgc
A0A096NX09_BCL2L2-      aactggggccgccttgtagccttctttgtctttggggctgcactgtgtgc
A0A2K6RW35_BCL2L2-      aactggggccgccttgtagccttctttgtctttggggctgcactgtgtgc
A0A2K6RW35_BCL2L2-      aactggggccgccttgtagccttctttgtctttggggctgcactgtgtgc
A0A2K6ME72_BCL2L2-      aactggggccgccttgtagccttctttgtctttggggctgcactgtgtgc
A0A0D9RU30_BCL2L2-      aactggggccgccttgtagccttctttgtctttggggctgcactgtgtgc
A0A2K5HEJ9_BCL2L2-      aactggggccgccttgtagccttctttgtctttggggctgcactgtgtgc
G3TMU7_BCL2L2-01        aactggggccgccttgtggccttctttgtctttggggctgctctgtgtgc
O88996_BCL2L2-01        aactggggccgtcttgtggcattctttgtctttggggctgccctgtgtgc
Q7TS60_BCL2L2-01        aactggggccgtcttgtggcattctttgtctttggggctgccctgtgtgc
A0A287D9B3_BCL2L2-      aactggggtcgtcttgtggccttctttgtctttggggctgccctgtgtgc
P70345_BCL2L2-02        --------------------------------------------------
P70345_BCL2L2-01        aactggggccgtcttgtggcattctttgtctttggggctgccctgtgtgc
A0A452UF16_BCL2L2-      aactggggccgcctggtggccttctttgtctttggagccgcactgtgtgc
A0A452UF16_BCL2L2-      aactggggccgcctggtggccttctttgtctttggagccgcactgtgtgc
A0A4D6NWN1_BCL2L2-      aactggggccgccttgtggccttctttgtcttcggagctgcactgtgtgc
A0A287ATE4_BCL2L2-      aactggggccgccttgtggccttctttgtcttcggagctgcactgtgtgc
A0A287ATE4_BCL2L2-      aactggggccgccttgtggccttctttgtcttcggagctgcactgtgtgc
A0A1U7UJF2_BCL2L2-      aactggggccgccttgtggccttctttgtctttggggctgcactctgtgc
A0A2K6GWM6_BCL2L2-      aactggggccgccttgtggccttcttcgtctttggggctgcactgtgtgc
A0A2R9A2Q3_BCL2L2-      aactggggccgccttgtagccttctttgtctttggggctgcactgtgtgc
H2Q805_BCL2L2-02        aactggggccgccttgtagccttctttgtctttggggctgcactgtgtgc
A0A2I2YPX6_BCL2L2-      aactggggccgccttgtagccttctttgtctttggggctgcactgtgtgc
A0A2I3GEA7_BCL2L2-      aactggggccgccttgtagccttctttgtctttggggctgcactgtgtgc
A0A096NX09_BCL2L2-      aactggggccgccttgtagccttctttgtctttggggctgcactgtgtgc
A0A2K5V0Q3_BCL2L2-      aactggggccgccttgtagccttctttgtctttggggctgcactgtgtgc
F7G4L5_BCL2L2-02        aactggggccgccttgtagccttctttgtctttggggctgcactgtgtgc
A0A2K6AI25_BCL2L2-      aactggggccgccttgtagccttctttgtctttggggctgcactgtgtgc
A0A2K5MZX9_BCL2L2-      aactggggccgccttgtagccttctttgtctttggggctgcactgtgtgc
A0A2K6EA59_BCL2L2-      aactggggccgccttgtagccttctttgtctttggggctgcactgtgtgc
A0A2K5HEJ9_BCL2L2-      aactggggccgccttgtagccttctttgtctttggggctgcactgtgtgc
A0A2K6ME72_BCL2L2-      aactggggccgccttgtagccttctttgtctttggggctgcactgtgtgc
A0A2K6RW35_BCL2L2-      aactggggccgccttgtagccttctttgtctttggggctgcactgtgtgc
A0A2R8M4C0_BCL2L2-      aactggggccgccttgtagccttctttgtctttggggctgcactgtgtgc
A0A2K5RUN8_BCL2L2-      aactggggccgccttgtagccttctttgtctttggggctgcactgtgtgc
A0A2K6TM77_BCL2L2-      aactggggccgccttgtagccttctttgtctttggggctgcactgtgtgc
                                                                          

Q5XGJ4_BCL2L2-01        tgagagtgtcaacaaggagatgtcccctcttctgccacggattcaggact
H3AAS7_BCL2L2-02        ggagagcgtggataaggaaatggcttcgctggtgggacggattattgact
H3AAS7_BCL2L2-01        ggagagcgtggataaggaaatggcttcgctggtgggacggattattgact
F7G6M3_BCL2L2-01        cgagagcgtcaacaaggagatggagcccctggtggggcaggtgcaggact
G3WPT1_BCL2L2-01        agagagcgtcaacaaagagatggagccactggtgggacaagaaaaaagat
G3WPT1_BCL2L2-02        agagagcgtcaacaaagagatggagccactggtgggacaggttcaggatt
G1Q051_BCL2L2-01        tgagagtgtcaacaaggagatggagccacttgtgggacaagtacaggagt
G1TV33_BCL2L2-01        tgagagcgtcaacaaggagatggagcccctggtgggacaagtgcaggagt
G1P3J2_BCL2L2-01        tgagagtgtcaacaaggagatggagccacttgtgggacaagtacaggagt
A0A482LX62_BCL2L2-      tgagagtgtcaataaggagatggagccactcgtgggacaagtgcaggagt
A0A1U7RC37_BCL2L2-      tgaaagtgtcaacaaagaaatggagccacttgtgggacaagtgcaggatt
A0A250YBR2_BCL2L2-      tgagagcatcaacaaagagatggaaccactggtgggacaagtacaggagt
A0A250YBR2_BCL2L2-      tgagagcatcaacaaagagatggaaccactggtgggacaagtacaggagt
W5QDH4_BCL2L2-01        tgagagtgtcaacaaggagatggagccacttgtgggacaagtgcaggagt
A0A287ATE4_BCL2L2-      tgagagtgtcaataaggagatggagccactcgtgggacaagtgcaggagt
A0A3Q9B4M8_BCL2L2-      tgagagtgtcaataaggagatggagccactcgtgggacaagtgccggagt
A0A1U7RC37_BCL2L2-      tgaaagtgtcaacaaagaaatggagccacttgtgggacaagtgcaggatt
A0A2I2UAE3_BCL2L2-      tgagagtgtcaacaaggagatggagccacttgtgggacaagtgcaagagt
M3Y5X5_BCL2L2-01        tgagagtgtcaacaaagagatggagccacttgtgggccaagtgcaagagt
G1LMC3_BCL2L2-01        tgagagtgtcaacaaagagatggaaccacttgtgggacaagtgcaagagt
A0A452SHI1_BCL2L2-      tgagagtgtcaacaaagagatggagccacttgtgggacaagtgcaagagt
A0A286XQQ9_BCL2L2-      tgagagtgtcaacaaagagatgcaaccactggtgggccaagtgcaggagt
L8HP19_BCL2L2-02        tgagagtgtcaacaaggagatggagccacttgtgggacaagtgcaggagt
L8HP19_BCL2L2-01        tgagagtgtcaacaaggagatggagccacttgtgggacaagtgcaggagt
Q1RMX3_BCL2L2-01        tgagagtgtcaacaaggagatggagccacttgtgggacaagtgcaggagt
Q05KI8_BCL2L2-01        tgagagtgtcaacaaggagatggagccacttgtgggacaagtgcaggagt
A0A452ECF0_BCL2L2-      tgagagtgtcaacaaggagatggagccacttgtgggacaagtgcaggagt
W5QDH4_BCL2L2-02        tgagagtgtcaacaaggagatggagccacttgtgggacaagtgcaggagt
H0XR82_BCL2L2-01        tgagagtgtcaacaaggagatggagccactggtgggacaagtgcaggagt
A0A2K6GWM6_BCL2L2-      tgagagtgtcaacaaggagatggagccactggtgggacaagtgcaggagt
A0A287D9B3_BCL2L2-      tgagagtgtcaacaaagagatggagccactggtgggacaagtgcaggagt
A0A1U7UJF2_BCL2L2-      tgaaagtgtcaacaaggagatggagccactggtgggacaagtgcaggagt
A0A1S3FYD8_BCL2L2-      cgagagtgtcaacaaagaaatggaaccactggtgggacaagtgcaggagt
A0A2K6TM77_BCL2L2-      tgagagtgtcaacaaggagatggaaccactggtgggacaagtgcaggagt
A0A2K5CWY6_BCL2L2-      tgagagtgtcaacaaggagatggaaccactggtgggacaagtgcaggagt
A0A2K5CWY6_BCL2L2-      tgagagtgtcaacaaggagatggaaccactggtgggacaagtgcaggagt
A0A2K5RUN8_BCL2L2-      tgagagtgtcaacaaggagatggaaccactggtgggacaagtgcaggagt
A0A2R9A2Q3_BCL2L2-      tgagagtgtcaacaaggagatggaaccactggtgggacaagtgcaggagt
H2Q805_BCL2L2-01        tgagagtgtcaacaaggagatggaaccactggtgggacaagtgcaggagt
A0A2I2YPX6_BCL2L2-      tgagagtgtcaacaaggagatggaaccactggtgggacaagtgcaggagt
A0A2I3GEA7_BCL2L2-      tgagagtgtcaacaaggagatggaaccactggtgggacaagtgcaggagt
A0A2K5MZX9_BCL2L2-      tgagagtgtcaacaaggagatggaaccactggtgggacaagtgcaggagt
A0A2K6EA59_BCL2L2-      tgagagtgtcaacaaggagatggaaccactggtgggacaagtgcaggagt
A0A2K5V0Q3_BCL2L2-      tgagagtgtcaacaaggagatggaaccactggtgggacaagtgcaggagt
F7G4L5_BCL2L2-01        tgagagtgtcaacaaggagatggaaccactggtgggacaagtgcaggagt
A0A2K6AI25_BCL2L2-      tgagagtgtcaacaaggagatggaaccactggtgggacaagtgcaggagt
A0A096NX09_BCL2L2-      tgagagtgtcaacaaggagatggaaccactggtgggacaagtgcaggagt
A0A2K6RW35_BCL2L2-      tgagagtgtcaacaaggagatggaaccactggtgggacaagtgcaggagt
A0A2K6RW35_BCL2L2-      tgagagtgtcaacaaggagatggaaccactggtgggacaagtgcaggagt
A0A2K6ME72_BCL2L2-      tgagagtgtcaacaaggagatggaaccactggtgggacaagtgcaggagt
A0A0D9RU30_BCL2L2-      tgagagtgtcaacaaggagatggaaccactggtgggacaagtgcaggagt
A0A2K5HEJ9_BCL2L2-      tgagagtgtcaacaaggagatggaaccactggtgggacaagtgcaggagt
G3TMU7_BCL2L2-01        tgagagtgtcaacaaggagatggagccactggtgggacaagtgcaggagt
O88996_BCL2L2-01        tgagagtgtcaacaaagaaatggagccattggtgggacaagtgcaggatt
Q7TS60_BCL2L2-01        tgagagtgtcaacaaagaaatggagccattggtgggacaagtgcaggatt
A0A287D9B3_BCL2L2-      tgagagtgtcaacaaagagatggagccactggtgggacaagtgcaggagt
P70345_BCL2L2-02        -------------------atggagcctttggtgggacaagtgcaggatt
P70345_BCL2L2-01        tgagagtgtcaacaaagaaatggagcctttggtgggacaagtgcaggatt
A0A452UF16_BCL2L2-      tgagagtgtcaacaaagagatggagccacttgtgggacaagtgcaagagt
A0A452UF16_BCL2L2-      tgagagtgtcaacaaagagatggagccacttgtgggacaagtgcaagagt
A0A4D6NWN1_BCL2L2-      tgagagtgtcaataaggagatggagccactcgtgggacaagtgcaggagt
A0A287ATE4_BCL2L2-      tgagagtgtcaataaggagatggagccactcgtgggacaagtgcaggagt
A0A287ATE4_BCL2L2-      tgagagtgtcaataaggagatggagccactcgtgggacaagtgcaggagt
A0A1U7UJF2_BCL2L2-      tgaaagtgtcaacaaggagatggagccactggtgggacaagtgcaggagt
A0A2K6GWM6_BCL2L2-      tgagagtgtcaacaaggagatggagccactggtgggacaagtgcaggagt
A0A2R9A2Q3_BCL2L2-      tgagagtgtcaacaaggagatggaaccactggtgggacaagtgcaggagt
H2Q805_BCL2L2-02        tgagagtgtcaacaaggagatggaaccactggtgggacaagtgcaggagt
A0A2I2YPX6_BCL2L2-      tgagagtgtcaacaaggagatggaaccactggtgggacaagtgcaggagt
A0A2I3GEA7_BCL2L2-      tgagagtgtcaacaaggagatggaaccactggtgggacaagtgcaggagt
A0A096NX09_BCL2L2-      tgagagtgtcaacaaggagatggaaccactggtgggacaagtgcaggagt
A0A2K5V0Q3_BCL2L2-      tgagagtgtcaacaaggagatggaaccactggtgggacaagtgcaggagt
F7G4L5_BCL2L2-02        tgagagtgtcaacaaggagatggaaccactggtgggacaagtgcaggagt
A0A2K6AI25_BCL2L2-      tgagagtgtcaacaaggagatggaaccactggtgggacaagtgcaggagt
A0A2K5MZX9_BCL2L2-      tgagagtgtcaacaaggagatggaaccactggtgggacaagtgcaggagt
A0A2K6EA59_BCL2L2-      tgagagtgtcaacaaggagatggaaccactggtgggacaagtgcaggagt
A0A2K5HEJ9_BCL2L2-      tgagagtgtcaacaaggagatggaaccactggtgggacaagtgcaggagt
A0A2K6ME72_BCL2L2-      tgagagtgtcaacaaggagatggaaccactggtgggacaagtgcaggagt
A0A2K6RW35_BCL2L2-      tgagagtgtcaacaaggagatggaaccactggtgggacaagtgcaggagt
A0A2R8M4C0_BCL2L2-      tgagagtgtcaacaaggagatggaaccactggtgggacaagtgcaggagt
A0A2K5RUN8_BCL2L2-      tgagagtgtcaacaaggagatggaaccactggtgggacaagtgcaggagt
A0A2K6TM77_BCL2L2-      tgagagtgtcaacaaggagatggaaccactggtgggacaagtgcaggagt
                                           ***    *  *  **   *           *

Q5XGJ4_BCL2L2-01        ggatggtgacatatctggagacaaacctgagagactggattcagagca--
H3AAS7_BCL2L2-02        ggacagtaacttatgtagagagcagccttcaggattggatcaaccaca--
H3AAS7_BCL2L2-01        ggacagtaacttatgtagagagcagccttcaggattggatcaaccaca--
F7G6M3_BCL2L2-01        ggatggtggcctacctggacacccagctggccgactggatccgcagca--
G3WPT1_BCL2L2-01        atggggtgcacttgaagcagggaattttagcaaggtatttaccaagcaag
G3WPT1_BCL2L2-02        ggatggtgacctacctagagacacagctggcagactggatccacagca--
G1Q051_BCL2L2-01        ggacggtggcctacctggagatgcggctggctgactggatccacagta--
G1TV33_BCL2L2-01        ggatggtgacctacctggagacgcagctggccggctggatccacagca--
G1P3J2_BCL2L2-01        ggatggtggcctacctggagacgcggctggccgactggatccacagta--
A0A482LX62_BCL2L2-      ggatggtgacctacctggagacacggctggccgactggatccacagca--
A0A1U7RC37_BCL2L2-      ggatggtgacttacctggagacacgcctggctgactggatccacagca--
A0A250YBR2_BCL2L2-      ggatggtggcctacctggagacacgcctagccgactggatccacagca--
A0A250YBR2_BCL2L2-      ggatggtggcctacctggagacacgcctagccgactggatccacagca--
W5QDH4_BCL2L2-01        ggatggtggcctacctggagacgcggctggctgactggatccacagca--
A0A287ATE4_BCL2L2-      ggatggtgacctacctggagacacggctggccgactggatccacagca--
A0A3Q9B4M8_BCL2L2-      ggatggtgacctacctggagacacggctggccgactggatccacagca--
A0A1U7RC37_BCL2L2-      ggatggtgacttacctggagacacgcctggctgactggatccacagca--
A0A2I2UAE3_BCL2L2-      ggatggtggcctacctggagacacggctggccgactggattcacagca--
M3Y5X5_BCL2L2-01        ggatggtggcctacctggagacgcggctggccgactggatccacagca--
G1LMC3_BCL2L2-01        ggatggtggcctacctggagacacggctggctgactggatccacagca--
A0A452SHI1_BCL2L2-      ggatggtggcctacctggagacacggctggctgactggatccacagca--
A0A286XQQ9_BCL2L2-      ggatggtggcctacctggagacgcgcctggccgactggatccacagca--
L8HP19_BCL2L2-02        ggatggtggcctacctggagacgaggctggctgactggatccacagca--
L8HP19_BCL2L2-01        ggatggtggcctacctggagacgaggctggctgactggatccacagca--
Q1RMX3_BCL2L2-01        ggatggtggcctacctggagacgaggctggctgactggatccacagca--
Q05KI8_BCL2L2-01        ggatggtggcctacctggagacgaggctggctgactggatccacagca--
A0A452ECF0_BCL2L2-      ggatggtggcctacctggagacgcggctggctgactggatccacagca--
W5QDH4_BCL2L2-02        ggatggtggcctacctggagacgcggctggctgactggatccacagca--
H0XR82_BCL2L2-01        ggatggtagcctacctggagacacggctggctgactggatccatagca--
A0A2K6GWM6_BCL2L2-      ggatggtggcctacctggagacacggctggccgactggatccacagca--
A0A287D9B3_BCL2L2-      ggatggtggcctacctggagacgcggctggctgactggatccacagca--
A0A1U7UJF2_BCL2L2-      ggatggtggcctacctggagacgcggctggccgactggatccacagca--
A0A1S3FYD8_BCL2L2-      ggatggtggcctacctggagacgcgcctggccgactggatccacagca--
A0A2K6TM77_BCL2L2-      ggatggtggcctacctggagacgcggctggccgactggatccacagca--
A0A2K5CWY6_BCL2L2-      ggatggtggcctacctggagacgcggctggccgactggatccacagca--
A0A2K5CWY6_BCL2L2-      ggatggtggcctacctggagacgcggctggccgactggatccacagca--
A0A2K5RUN8_BCL2L2-      ggatggtggcctacctggagacgcggctggccgactggatccacagca--
A0A2R9A2Q3_BCL2L2-      ggatggtggcctacctggagacgcggctggctgactggatccacagca--
H2Q805_BCL2L2-01        ggatggtggcctacctggagacgcggctggctgactggatccacagca--
A0A2I2YPX6_BCL2L2-      ggatggtggcctacctggagacgcggctggctgactggatccacagca--
A0A2I3GEA7_BCL2L2-      ggatggtggcctacttggagacgcggctggctgactggatccacagca--
A0A2K5MZX9_BCL2L2-      ggatggtggcctacctggagacgcggctggctgactggatccacagca--
A0A2K6EA59_BCL2L2-      ggatggtggcctacctggagacgcggctggctgactggatccacagca--
A0A2K5V0Q3_BCL2L2-      ggatggtggcctacctggagacgcggctggctgactggatccacagca--
F7G4L5_BCL2L2-01        ggatggtggcctacctggagacgcggctggctgactggatccacagca--
A0A2K6AI25_BCL2L2-      ggatggtggcctacctggagacgcggctggctgactggatccacagca--
A0A096NX09_BCL2L2-      ggatggtggcctacctggagacgcggctggctgactggatccacagca--
A0A2K6RW35_BCL2L2-      ggatggtggcctacctggagacgcggctggctgactggatccacagca--
A0A2K6RW35_BCL2L2-      ggatggtggcctacctggagacgcggctggctgactggatccacagca--
A0A2K6ME72_BCL2L2-      ggatggtggcctacctggagacgcggctggctgactggatccacagca--
A0A0D9RU30_BCL2L2-      ggatggtggcctacctggagacgcggctggctgactggatccacagca--
A0A2K5HEJ9_BCL2L2-      ggatggtggcctacctggagacgcggctggctgactggatccacagca--
G3TMU7_BCL2L2-01        ggatggtggtctacctggagacgcggctggctgactggatccacagca--
O88996_BCL2L2-01        ggatggtgacctacctggagacacgcttggctgactggatccacagca--
Q7TS60_BCL2L2-01        ggatggtgacctacctggagacacgcttggctgactggatccacagca--
A0A287D9B3_BCL2L2-      ggatggtggcctacctggagacgcggctggctgactggatccacagca--
P70345_BCL2L2-02        ggatggtggcctacctggagacacgtctggctgactggatccacagca--
P70345_BCL2L2-01        ggatggtggcctacctggagacacgtctggctgactggatccacagca--
A0A452UF16_BCL2L2-      ggatggtggcctacctggagacacggctggctgactggatccacagca--
A0A452UF16_BCL2L2-      ggatggtggcctacctggagacacggctggctgactggatccacagca--
A0A4D6NWN1_BCL2L2-      ggatggtgacctacctggagtcacggctggccgactggatccacagca--
A0A287ATE4_BCL2L2-      ggatggtgacctacctggagacacggctggccgactggatccacagca--
A0A287ATE4_BCL2L2-      ggatggtgacctacctggagacacggctggccgactggatccacagca--
A0A1U7UJF2_BCL2L2-      ggatggtggcctacctggagacgcggctggccgactggatccacagca--
A0A2K6GWM6_BCL2L2-      ggatggtggcctacctggagacacggctggccgactggatccacagca--
A0A2R9A2Q3_BCL2L2-      ggatggtggcctacctggagacgcggctggctgactggatccacagca--
H2Q805_BCL2L2-02        ggatggtggcctacctggagacgcggctggctgactggatccacagca--
A0A2I2YPX6_BCL2L2-      ggatggtggcctacctggagacgcggctggctgactggatccacagca--
A0A2I3GEA7_BCL2L2-      ggatggtggcctacttggagacgcggctggctgactggatccacagca--
A0A096NX09_BCL2L2-      ggatggtggcctacctggagacgcggctggctgactggatccacagca--
A0A2K5V0Q3_BCL2L2-      ggatggtggcctacctggagacgcggctggctgactggatccacagca--
F7G4L5_BCL2L2-02        ggatggtggcctacctggagacgcggctggctgactggatccacagca--
A0A2K6AI25_BCL2L2-      ggatggtggcctacctggagacgcggctggctgactggatccacagca--
A0A2K5MZX9_BCL2L2-      ggatggtggcctacctggagacgcggctggctgactggatccacagca--
A0A2K6EA59_BCL2L2-      ggatggtggcctacctggagacgcggctggctgactggatccacagca--
A0A2K5HEJ9_BCL2L2-      ggatggtggcctacctggagacgcggctggctgactggatccacagca--
A0A2K6ME72_BCL2L2-      ggatggtggcctacctggagacgcggctggctgactggatccacagca--
A0A2K6RW35_BCL2L2-      ggatggtggcctacctggagacgcggctggctgactggatccacagca--
A0A2R8M4C0_BCL2L2-      ggatggtggcctacctggagacgcggctggccgactggatccacagca--
A0A2K5RUN8_BCL2L2-      ggatggtggcctacctggagacgcggctggccgactggatccacagca--
A0A2K6TM77_BCL2L2-      ggatggtggcctacctggagacgcggctggccgactggatccacagca--
                             **    *      *        *       *   *       *  

Q5XGJ4_BCL2L2-01        atg--------gaggctggaat------ggatttctaactcta--tatgg
H3AAS7_BCL2L2-02        gtg--------gaggatggagt------gctttcgtgtgtctg--tatgg
H3AAS7_BCL2L2-01        gtg--------gaggatggagt------gctttcgtgtgtctg--tatgg
F7G6M3_BCL2L2-01        gcg--------ggggctgggcg------gagttcacggccctg--tacgg
G3WPT1_BCL2L2-01        gct--------ggagct--gcg------gaattcacggctctg--tacgg
G3WPT1_BCL2L2-02        gcg--------ggggctgggcg------gaattcacggctctg--tacgg
G1Q051_BCL2L2-01        ttg--------ggggctgggca------gagttcacagctcta--tacgg
G1TV33_BCL2L2-01        ccg--------ggggctgggcg------gagttcacagctctg--tacgg
G1P3J2_BCL2L2-01        gtg--------ggggctgggcg------gagttcacagctcta--tacgg
A0A482LX62_BCL2L2-      gcgcttcacccaggtctctgat-------------gaactcttccaagga
A0A1U7RC37_BCL2L2-      gtg--------gcggctgggagctagaagcgatcaaagcccgagtcaggg
A0A250YBR2_BCL2L2-      gtg--------ggggctgggcg------gagttcacagctctg--tacgg
A0A250YBR2_BCL2L2-      gtg--------ggggctgggcg------gagttcacagctctg--tacgg
W5QDH4_BCL2L2-01        gtg--------ggggctgggagctggaagcgatcaaagctcgagttaggg
A0A287ATE4_BCL2L2-      gtg--------ggggctgggcg------gagttcacagctcta--tacgg
A0A3Q9B4M8_BCL2L2-      gtg--------ggggctgggcg------gagttcacagctcta--tacgg
A0A1U7RC37_BCL2L2-      gtg--------gcggctgggcg------gagttcacagctctg--tacgg
A0A2I2UAE3_BCL2L2-      gtg--------ggggctgggcg------gagttcacagctcta--tacgg
M3Y5X5_BCL2L2-01        gtg--------ggggctgggcg------gagttcacagctcta--tacgg
G1LMC3_BCL2L2-01        gtg--------ggggctgggcg------gagttcacagctcta--tacgg
A0A452SHI1_BCL2L2-      gtg--------ggggctgggcg------gagttcacagctcta--tacgg
A0A286XQQ9_BCL2L2-      gtg--------ggggctgggcg------gagttcacagctcta--tacgg
L8HP19_BCL2L2-02        gtg--------ggggctgggcg------gagttcacagctcta--tacgg
L8HP19_BCL2L2-01        gtg--------ggggctgggcg------gagttcacagctcta--tacgg
Q1RMX3_BCL2L2-01        gtg--------ggggctgggcg------gagttcacagctcta--tacgg
Q05KI8_BCL2L2-01        gtg--------ggggctgggcg------gagttcacagctcta--tacgg
A0A452ECF0_BCL2L2-      gtg--------ggggctgggcg------gagttcacagctcta--tacgg
W5QDH4_BCL2L2-02        gtg--------ggggctgggcg------gagttcacagctcta--tacgg
H0XR82_BCL2L2-01        gtg--------gtggctgggcg------gagttcacagctcta--tacgg
A0A2K6GWM6_BCL2L2-      gtg--------ggggctgggcg------gagttcacagctcta--tacgg
A0A287D9B3_BCL2L2-      gtg--------ggggctgg----------------ctgttctc--caggg
A0A1U7UJF2_BCL2L2-      gtg--------ggggctgggcg------gagttcacagctcta--tacgg
A0A1S3FYD8_BCL2L2-      gtg--------ggggctgggcg------gagttcacagctcta--tacgg
A0A2K6TM77_BCL2L2-      gtg--------ggggctgggcg------gagttcacagctcta--tacgg
A0A2K5CWY6_BCL2L2-      gtg--------ggggctgggcg------gagttcacagctcta--tacgg
A0A2K5CWY6_BCL2L2-      gtg--------ggggctgggcg------gagttcacagctcta--tacgg
A0A2K5RUN8_BCL2L2-      gtg--------ggggctgggcg------gagttcacagctcta--tacgg
A0A2R9A2Q3_BCL2L2-      gtg--------ggggctgggcg------gagttcacagctcta--tacgg
H2Q805_BCL2L2-01        gtg--------ggggctgggcg------gagttcacagctcta--tacgg
A0A2I2YPX6_BCL2L2-      gtg--------ggggctgggcg------gagttcacagctcta--tacgg
A0A2I3GEA7_BCL2L2-      gtg--------ggggctgggcg------gagttcacagctcta--tacgg
A0A2K5MZX9_BCL2L2-      gtg--------ggggctgggcg------gagttcacagctcta--tacgg
A0A2K6EA59_BCL2L2-      gtg--------ggggctgggcg------gagttcacagctcta--tacgg
A0A2K5V0Q3_BCL2L2-      gtg--------ggggctgggcg------gagttcacagctcta--tacgg
F7G4L5_BCL2L2-01        gtg--------ggggctgggcg------gagttcacagctcta--tacgg
A0A2K6AI25_BCL2L2-      gtg--------ggggctgggcg------gagttcacagctcta--tacgg
A0A096NX09_BCL2L2-      gtg--------ggggctgggcg------gagttcacagctcta--tacgg
A0A2K6RW35_BCL2L2-      gtg--------ggggctgggcg------gagttcacagctcta--tacgg
A0A2K6RW35_BCL2L2-      gtg--------ggggctgggcg------gagttcacagctcta--tacgg
A0A2K6ME72_BCL2L2-      gtg--------ggggctgggcg------gagttcacagctcta--tacgg
A0A0D9RU30_BCL2L2-      gtg--------ggggctgggcg------gagttcacagctcta--tacgg
A0A2K5HEJ9_BCL2L2-      gtg--------ggggctgggcg------gagttcacagctcta--tacgg
G3TMU7_BCL2L2-01        gtg--------ggggctgggcg------gagttcacagctcta--tacgg
O88996_BCL2L2-01        gtg--------ggggctgggcg------gagttcacagctcta--tacgg
Q7TS60_BCL2L2-01        gtg--------ggggctgggcg------gagttcacagctcta--tacgg
A0A287D9B3_BCL2L2-      gtg--------ggggctgggcg------gagttcacagctcta--tacgg
P70345_BCL2L2-02        gtg--------ggggctgggcg------gagttcacagctcta--tacgg
P70345_BCL2L2-01        gtg--------ggggctgggcg------gagttcacagctcta--tacgg
A0A452UF16_BCL2L2-      gtg--------ggggctgggagctggaagcgatcaaagctcgagtcaggg
A0A452UF16_BCL2L2-      gtg--------ggggctgggagctggaagcgatcaaagctcgagtcaggg
A0A4D6NWN1_BCL2L2-      gtg--------ggggctgggagctggaagcgatcaaagctcgagtcaggg
A0A287ATE4_BCL2L2-      gtg--------ggggctgggagctggaagcgatcaaagctcgagtcaggg
A0A287ATE4_BCL2L2-      gtg--------ggggctgggagctggaagcgatcaaagctcgagtcaggg
A0A1U7UJF2_BCL2L2-      gtg--------ggggctgggagctggaagcgatcaaagcccgagtcaggg
A0A2K6GWM6_BCL2L2-      gtg--------ggggctgggagctggaagccatcaaagctcgggtcaggg
A0A2R9A2Q3_BCL2L2-      gtg--------ggggctgggagctggaagctatcaaagctcgagtcaggg
H2Q805_BCL2L2-02        gtg--------ggggctgggagctggaagctatcaaagctcgagtcaggg
A0A2I2YPX6_BCL2L2-      gtg--------ggggctgggagctggaagctatcaaagctcgagtcaggg
A0A2I3GEA7_BCL2L2-      gtg--------ggggctgggagctggaagctatcaaagctcgagtcaggg
A0A096NX09_BCL2L2-      gtg--------ggggctgggagctggaagctatcaaagctcgagtcaggg
A0A2K5V0Q3_BCL2L2-      gtg--------ggggctgggagctggaagctatcaaagctcgagtcaggg
F7G4L5_BCL2L2-02        gtg--------ggggctgggagctggaagctatcaaagctcgagtcaggg
A0A2K6AI25_BCL2L2-      gtg--------ggggctgggagctggaagctatcaaagctcgagtcaggg
A0A2K5MZX9_BCL2L2-      gtg--------ggggctgggagctggaagctatcaaagctcgagtcaggg
A0A2K6EA59_BCL2L2-      gtg--------ggggctgggagctggaagctatcaaagctcgagtcaggg
A0A2K5HEJ9_BCL2L2-      gtg--------ggggctgggagctggaagctatcaaagctcgagtcaggg
A0A2K6ME72_BCL2L2-      gtg--------ggggctgggagctggaagctatcaaagctcgagtcaggg
A0A2K6RW35_BCL2L2-      gtg--------ggggctgggagctggaagctatcaaagctcgagtcaggg
A0A2R8M4C0_BCL2L2-      gtg--------ggggctgggagctggaagctatcaaagctcgagtcaggg
A0A2K5RUN8_BCL2L2-      gtg--------ggggctgggagctggaagctatcaaagctcgagtcaggg
A0A2K6TM77_BCL2L2-      gtg--------ggggctgggagctggaagctatcaaagctcgagtcaggg
                                        *                       *     * * 

Q5XGJ4_BCL2L2-01        ggat----gg-------------tgccatagaagaggccaggaggcagcg
H3AAS7_BCL2L2-02        gaat----gg-------------tgcagtgggcggagccaggaggtttca
H3AAS7_BCL2L2-01        gaat----gg-------------tgcagtgggcggagccaggaggtttca
F7G6M3_BCL2L2-01        ggac----gg-------------ggccctggaggacgcccggcgcctgcg
G3WPT1_BCL2L2-01        ggat----gg-------------ggccctggaggaggcaaggcgtctgcg
G3WPT1_BCL2L2-02        ggat----gg-------------ggccctggaggaggcaaggcgtctgcg
G1Q051_BCL2L2-01        gaac----------------------------------------------
G1TV33_BCL2L2-01        ggat----cg-------------ggccctggaggaggcgcggcgtctgcg
G1P3J2_BCL2L2-01        ggac----gg-------------ggccctggaggaggctcgacgcctgcg
A0A482LX62_BCL2L2-      ggcc-------------------ccaactggggccgccttgtggccttct
A0A1U7RC37_BCL2L2-      agat----ggaggaggaggctgagaagctaaaggagctacaaaa--cgag
A0A250YBR2_BCL2L2-      ggac----gg-------------ggccctggaggaggcgcggcgcctgcg
A0A250YBR2_BCL2L2-      ggac----gg-------------ggccctggaggaggcgcggcgcctgcg
W5QDH4_BCL2L2-01        agat----ggaggaagaagctgagaagctaaaggagctacagaa--cgag
A0A287ATE4_BCL2L2-      ggac----gg-------------ggccctggaggaggcgcggcgtctgcg
A0A3Q9B4M8_BCL2L2-      ggac----gg-------------ggccctggaggaggcgcggcgtctgcg
A0A1U7RC37_BCL2L2-      ggac----gg-------------ggccctggaggaggcgcggcgtctgcg
A0A2I2UAE3_BCL2L2-      ggac----gg-------------ggccctggaggaggcgcggcgtctgcg
M3Y5X5_BCL2L2-01        ggac----gg-------------ggccctggaggaggcgcggcgtctgcg
G1LMC3_BCL2L2-01        ggac----gg-------------ggccctggaggaggcgcggcgtctgcg
A0A452SHI1_BCL2L2-      ggac----gg-------------ggccctggaggaggcgcggcgtctgcg
A0A286XQQ9_BCL2L2-      ggac----gg-------------ggccctggaggaggcgcggcgtctgcg
L8HP19_BCL2L2-02        ggac----gg-------------ggccctggaggaggcgcggcgtctgcg
L8HP19_BCL2L2-01        ggac----gg-------------ggccctggaggaggcgcggcgtctgcg
Q1RMX3_BCL2L2-01        ggac----gg-------------ggccctggaggaggcgcggcgtctgcg
Q05KI8_BCL2L2-01        ggtc----gg-------------ggccctggaggaggcgcggcgtctgcg
A0A452ECF0_BCL2L2-      ggac----gg-------------ggccctggaggaggcgcggcgtctgcg
W5QDH4_BCL2L2-02        ggac----gg-------------ggccctggaggaggcgcggcgtctgcg
H0XR82_BCL2L2-01        ggac----gg-------------ggccctggaggaggctcggcgtctgcg
A0A2K6GWM6_BCL2L2-      ggac----gg-------------ggccctggaggaggcgcggcgtctgcg
A0A287D9B3_BCL2L2-      ggaatatggg-------------ggctctga-------ttggaggctggg
A0A1U7UJF2_BCL2L2-      ggac----gg-------------ggccctggaggaggcgcggcgtctgcg
A0A1S3FYD8_BCL2L2-      ggac----gg-------------ggccctggaggaggcgcggcgtctgcg
A0A2K6TM77_BCL2L2-      ggac----gg-------------ggccctggaggaggcgcggcgtctgcg
A0A2K5CWY6_BCL2L2-      ggac----gg-------------ggccctggaggaggcgcggcgtctgcg
A0A2K5CWY6_BCL2L2-      ggac----gg-------------ggccctggaggaggcgcggcgtctgcg
A0A2K5RUN8_BCL2L2-      ggac----gg-------------ggccctggaggaggcgcggcgtctgcg
A0A2R9A2Q3_BCL2L2-      ggac----gg-------------ggccctggaggaggcgcggcgtctgcg
H2Q805_BCL2L2-01        ggac----gg-------------ggccctggaggaggcgcggcgtctgcg
A0A2I2YPX6_BCL2L2-      ggac----gg-------------ggccctggaggaggcgcggcgtctgcg
A0A2I3GEA7_BCL2L2-      ggac----gg-------------ggccctggaggaggcgcggcgtctgcg
A0A2K5MZX9_BCL2L2-      ggac----gg-------------ggccctggaggaggcgcggcgtctgcg
A0A2K6EA59_BCL2L2-      ggac----gg-------------ggccctggaggaggcgcggcgtctgcg
A0A2K5V0Q3_BCL2L2-      ggac----gg-------------ggccctggaggaggcgcggcgtctgcg
F7G4L5_BCL2L2-01        ggac----gg-------------ggccctggaggaggcgcggcgtctgcg
A0A2K6AI25_BCL2L2-      ggac----gg-------------ggccctggaggaggcgcggcgtctgcg
A0A096NX09_BCL2L2-      ggac----gg-------------ggccctggaggaggcgcggcgtctgcg
A0A2K6RW35_BCL2L2-      ggac----gg-------------ggccctggaggaggcgcggcgtctgcg
A0A2K6RW35_BCL2L2-      ggac----gg-------------ggccctggaggaggcgcggcgtctgcg
A0A2K6ME72_BCL2L2-      ggac----gg-------------ggccctggaggaggcgcggcgtctgcg
A0A0D9RU30_BCL2L2-      ggac----gg-------------ggccctggaggaggcgcggcgtctgcg
A0A2K5HEJ9_BCL2L2-      ggac----gg-------------ggccctggaggaggcgcggcgtctgcg
G3TMU7_BCL2L2-01        ggac----gg-------------ggccctggaggaggcacggcgtctgcg
O88996_BCL2L2-01        ggac----gg-------------ggccctggaggaggcacggcgtctgcg
Q7TS60_BCL2L2-01        ggac----gg-------------ggccctggaggaggcacggcgtctgcg
A0A287D9B3_BCL2L2-      ggac----gg-------------ggccctggaggaggcacggcgtctgcg
P70345_BCL2L2-02        ggac----gg-------------ggccctggaggaggcacggcgtctgcg
P70345_BCL2L2-01        ggac----gg-------------ggccctggaggaggcacggcgtctgcg
A0A452UF16_BCL2L2-      agat----ggaggaagaagctgagaagctaaaggagctacagaa--cgag
A0A452UF16_BCL2L2-      agat----ggaggaagaagctgagaagctaaaggagctacagaa--cgag
A0A4D6NWN1_BCL2L2-      agat----ggaggaagaagctgagaagctaaaggagctacagaa--cgaa
A0A287ATE4_BCL2L2-      agat----ggaggaagaagctgagaagctaaaggagctacagaa--cgaa
A0A287ATE4_BCL2L2-      agat----ggaggaagaagctgagaagctaaaggagctacagaa--cgaa
A0A1U7UJF2_BCL2L2-      agat----ggaggaggaagctgaaaagctaaaagagctacagaa--cgag
A0A2K6GWM6_BCL2L2-      agat----ggaggaagaagctgagaagttaaaagagctacagaa--cgag
A0A2R9A2Q3_BCL2L2-      agat----ggaggaagaagctgagaagctaaaggagctacagaa--cgag
H2Q805_BCL2L2-02        agat----ggaggaagaagctgagaagctaaaggagctacagaa--cgag
A0A2I2YPX6_BCL2L2-      agat----ggaggaagaagctgagaagctaaaggagctacagaa--cgag
A0A2I3GEA7_BCL2L2-      agat----ggaggaagaagctgagaagctaaaggagctacagaa--cgag
A0A096NX09_BCL2L2-      agat----ggaggaagaagctgagaagctaaaggagctacagaa--cgag
A0A2K5V0Q3_BCL2L2-      agat----ggaggaagaagctgagaagctaaaggagctacagaa--cgag
F7G4L5_BCL2L2-02        agat----ggaggaagaagctgagaagctaaaggagctacagaa--cgag
A0A2K6AI25_BCL2L2-      agat----ggaggaagaagctgagaagctaaaggagctacagaa--cgag
A0A2K5MZX9_BCL2L2-      agat----ggaggaagaagctgagaagctaaaggagctacagaa--cgag
A0A2K6EA59_BCL2L2-      agat----ggaggaagaagctgagaagctaaaggagctacagaa--cgag
A0A2K5HEJ9_BCL2L2-      agat----ggaggaagaagctgagaagctaaaggagctacagaa--cgag
A0A2K6ME72_BCL2L2-      agat----ggaggaagaagctgagaagctaaaggagctacagaa--cgag
A0A2K6RW35_BCL2L2-      agat----ggaggaagaagctgagaagctaaaggagctacagaa--cgag
A0A2R8M4C0_BCL2L2-      agat----ggaggaagaagctgagaagctaaaggaactacagaa--cgag
A0A2K5RUN8_BCL2L2-      agat----ggaggaagaagctgagaagctaaaggaactacagaa--cgag
A0A2K6TM77_BCL2L2-      agat----ggaggaagaagctgagaagctaaaggaactacagaa--cgag
                                                                          

Q5XGJ4_BCL2L2-01        --------tgaggggaat---tgggcatcac------tgaagactgtctt
H3AAS7_BCL2L2-02        --------ggaaggctac---tggtcatcca------tgaagacggttgt
H3AAS7_BCL2L2-01        --------ggaaggctac---tggtcatcca------tgaagacggttgt
F7G6M3_BCL2L2-01        --------ggagggcaac---tgggcctccg------tccggaccgtgct
G3WPT1_BCL2L2-01        --------ggaggggaac---tgggcctcag------tgcgtacagtgct
G3WPT1_BCL2L2-02        --------ggaggggaac---tgggcctcag------tgcgtacagtgct
G1Q051_BCL2L2-01        ---------------------tgggcctcag------tgaggacagtgct
G1TV33_BCL2L2-01        --------ggaggggacc---tgggcgtcag------tgaggacagtgct
G1P3J2_BCL2L2-01        --------ggaggggaac---tgggcctcag------tgaggacagtgct
A0A482LX62_BCL2L2-      ttgtcttcggagctgcac---tgtg------------tgctgagagtgtc
A0A1U7RC37_BCL2L2-      --------gtagagaagcagatgaatatgagtccacccccaggcaatgct
A0A250YBR2_BCL2L2-      --------ggaggggaac---tgggcatcag------tgaggacagtgct
A0A250YBR2_BCL2L2-      --------ggaggggaac---tgggcatcag------tgaggacagtgct
W5QDH4_BCL2L2-01        --------gtagagaagcagatgaatatgagtccacctccgggcaatgct
A0A287ATE4_BCL2L2-      --------ggaggggaac---tgggcctcag------tgaggacagtgct
A0A3Q9B4M8_BCL2L2-      --------ggaggggaac---tgggcctcag------tgaggacagtgct
A0A1U7RC37_BCL2L2-      --------ggaggggaac---tgggcctcag------tgaggacagtgct
A0A2I2UAE3_BCL2L2-      --------ggaggggaac---tgggcctcag------tgaggacagtgct
M3Y5X5_BCL2L2-01        --------ggaggggaac---tgggcctcag------tgaggacagtgct
G1LMC3_BCL2L2-01        --------ggaggggaac---tgggcctcag------tgaggacagtgct
A0A452SHI1_BCL2L2-      --------ggaggggaac---tgggcctcag------tgaggacagtgct
A0A286XQQ9_BCL2L2-      --------ggaggggaac---tgggcatcag------tgaggacagtgct
L8HP19_BCL2L2-02        --------ggaggggaac---tgggcttcag------tgaggacagtgct
L8HP19_BCL2L2-01        --------ggaggggaac---tgggcttcag------tgaggacagtgct
Q1RMX3_BCL2L2-01        --------ggaggggaac---tgggcttcag------tgaggacagtgct
Q05KI8_BCL2L2-01        --------ggaggggaac---tgggcttcag------tgaggacagtgct
A0A452ECF0_BCL2L2-      --------ggaggggaac---tgggcctcag------tgaggacagtgct
W5QDH4_BCL2L2-02        --------ggaggggaac---tgggcttcag------tgaggacagtgct
H0XR82_BCL2L2-01        --------ggaggggaac---tgggcatcag------tgaggacagtgct
A0A2K6GWM6_BCL2L2-      --------ggaggggaac---tgggcatcag------tgaggacagtgct
A0A287D9B3_BCL2L2-      --------acagctgtgc---tgggaa-----------------------
A0A1U7UJF2_BCL2L2-      --------ggaggggaac---tgggcatcag------tgaggacagtgct
A0A1S3FYD8_BCL2L2-      --------ggaggggaac---tgggcatcag------tgaggacagtgct
A0A2K6TM77_BCL2L2-      --------ggaggggaac---tgggcatcag------tgaggacagtgct
A0A2K5CWY6_BCL2L2-      --------ggaggggaac---tgggcatcag------tgaggacagtgct
A0A2K5CWY6_BCL2L2-      --------ggaggggaac---tgggcatcag------tgaggacagtgct
A0A2K5RUN8_BCL2L2-      --------ggaggggaac---tgggcatcag------tgaggacagtgct
A0A2R9A2Q3_BCL2L2-      --------ggaggggaac---tgggcatcag------tgaggacagtgct
H2Q805_BCL2L2-01        --------ggaggggaac---tgggcatcag------tgaggacagtgct
A0A2I2YPX6_BCL2L2-      --------ggaggggaac---tgggcatcag------tgaggacagtgct
A0A2I3GEA7_BCL2L2-      --------ggaggggaac---tgggcatcag------tgaggacagtgct
A0A2K5MZX9_BCL2L2-      --------ggaggggaac---tgggcatcag------tgaggacagtgct
A0A2K6EA59_BCL2L2-      --------ggaggggaac---tgggcatcag------tgaggacagtgct
A0A2K5V0Q3_BCL2L2-      --------ggaggggaac---tgggcatcag------tgaggacagtgct
F7G4L5_BCL2L2-01        --------ggaggggaac---tgggcatcag------tgaggacagtgct
A0A2K6AI25_BCL2L2-      --------ggaggggaac---tgggcatcag------tgaggacagtgct
A0A096NX09_BCL2L2-      --------ggaggggaac---tgggcatcag------tgaggacagtgct
A0A2K6RW35_BCL2L2-      --------ggaggggaac---tgggcatcag------tgaggacagtgct
A0A2K6RW35_BCL2L2-      --------ggaggggaac---tgggcatcag------tgaggacagtgct
A0A2K6ME72_BCL2L2-      --------ggaggggaac---tgggcatcag------tgaggacagtgct
A0A0D9RU30_BCL2L2-      --------ggaggggaac---tgggcatcag------tgaggacagtgct
A0A2K5HEJ9_BCL2L2-      --------ggaggggaac---tgggcatcag------tgaggacagtgct
G3TMU7_BCL2L2-01        --------ggaggggaac---tgggcatcag------tgaggacagtgct
O88996_BCL2L2-01        --------ggaggggaac---tgggcatcag------tgaggacagtgct
Q7TS60_BCL2L2-01        --------ggaggggaac---tgggcatcag------tgaggacagtgct
A0A287D9B3_BCL2L2-      --------ggaggggaac---tgggcatcag------tgaggacagtgct
P70345_BCL2L2-02        --------ggaggggaac---tgggcatcag------tgaggacagtgct
P70345_BCL2L2-01        --------ggaggggaac---tgggcatcag------tgaggacagtgct
A0A452UF16_BCL2L2-      --------gtagagaaacagatgaatatgagtccacctccaggcaatgct
A0A452UF16_BCL2L2-      --------gtagagaaacagatgaatatgagtccacctccaggcaatgct
A0A4D6NWN1_BCL2L2-      --------gtagagaagcagatgaatatgagtccaccaccaggcaatgct
A0A287ATE4_BCL2L2-      --------gtagagaagcagatgaatatgagtccaccaccaggcaatgct
A0A287ATE4_BCL2L2-      --------gtagagaagcagatgaatatgagtccaccaccaggcaatgct
A0A1U7UJF2_BCL2L2-      --------gtagagaagcagatgaatatgagtccacctccaggcaatgct
A0A2K6GWM6_BCL2L2-      --------gtagagaagcagatgaatatgagtccacctccaggcaatgct
A0A2R9A2Q3_BCL2L2-      --------gtagagaagcagatgaatatgagtccaccaccaggcaatgct
H2Q805_BCL2L2-02        --------gtagagaagcagatgaatatgagtccaccaccaggcaatgct
A0A2I2YPX6_BCL2L2-      --------gtagagaagcagatgaatatgagtccacctccaggcaatgct
A0A2I3GEA7_BCL2L2-      --------gtagagaagcagatgaatatgagtccacctccaggcaatgct
A0A096NX09_BCL2L2-      --------gtagagaagcagatgaatatgagtccacctccaggcaatgct
A0A2K5V0Q3_BCL2L2-      --------gtagagaagcagatgaatatgagtccacctccaggcaatgct
F7G4L5_BCL2L2-02        --------gtagagaagcagatgaatatgagtccacctccaggcaatgct
A0A2K6AI25_BCL2L2-      --------gtagagaagcagatgaatatgagtccacctccaggcaatgct
A0A2K5MZX9_BCL2L2-      --------gtagagaagcagatgaatatgagtccacctccaggcaatgct
A0A2K6EA59_BCL2L2-      --------gtagagaagcagatgaatatgagtccacctccaggcaatgct
A0A2K5HEJ9_BCL2L2-      --------gtagagaagcagatgaatatgagtccacctccaggcaatgct
A0A2K6ME72_BCL2L2-      --------gtagagaagcagatgaatatgagtccacctccaggcaatgct
A0A2K6RW35_BCL2L2-      --------gtagagaagcagatgaatatgagtccacctccaggcaatgct
A0A2R8M4C0_BCL2L2-      --------gtagagaagcagatgaatatgagtccacctccaggcaatgct
A0A2K5RUN8_BCL2L2-      --------gtagagaagcagatgaatatgagtccacctccaggcaatgct
A0A2K6TM77_BCL2L2-      --------gtagagaagcagatgaatatgagtccacctccaggcaatgct
                                             **                           

Q5XGJ4_BCL2L2-01        aac-----------------------------tggagcag----------
H3AAS7_BCL2L2-02        gac-----------------------------gggggctg----------
H3AAS7_BCL2L2-01        gac-----------------------------gggggctg----------
F7G6M3_BCL2L2-01        gac-----------------------------gggggccg----------
G3WPT1_BCL2L2-01        aac-----------------------------aggggctg----------
G3WPT1_BCL2L2-02        aac-----------------------------aggggctg----------
G1Q051_BCL2L2-01        gac-----------------------------gggggccc----------
G1TV33_BCL2L2-01        gac-----------------------------gggggccg----------
G1P3J2_BCL2L2-01        gac-----------------------------gggggccg----------
A0A482LX62_BCL2L2-      aat---------------------------aaggag--------------
A0A1U7RC37_BCL2L2-      ggcccagtgatcatgtctcttgaggagaagatggaggctgatgcccgttc
A0A250YBR2_BCL2L2-      gac-----------------------------gggggctg----------
A0A250YBR2_BCL2L2-      gac-----------------------------gggggctg----------
W5QDH4_BCL2L2-01        ggcccagtgatcatgtccattgaggagaagatggaggctgatgcccgttc
A0A287ATE4_BCL2L2-      gac-----------------------------gggggccg----------
A0A3Q9B4M8_BCL2L2-      gac-----------------------------gggggccg----------
A0A1U7RC37_BCL2L2-      gac-----------------------------gggggccg----------
A0A2I2UAE3_BCL2L2-      gac-----------------------------aggggccg----------
M3Y5X5_BCL2L2-01        gac-----------------------------aggggccg----------
G1LMC3_BCL2L2-01        gac-----------------------------aggggccg----------
A0A452SHI1_BCL2L2-      gac-----------------------------aggggccg----------
A0A286XQQ9_BCL2L2-      gac-----------------------------aggggccg----------
L8HP19_BCL2L2-02        gac-----------------------------gggggctg----------
L8HP19_BCL2L2-01        gac-----------------------------gggggctg----------
Q1RMX3_BCL2L2-01        gac-----------------------------gggggctg----------
Q05KI8_BCL2L2-01        gac-----------------------------gggggctg----------
A0A452ECF0_BCL2L2-      gac-----------------------------gggggctg----------
W5QDH4_BCL2L2-02        gac-----------------------------gggggccg----------
H0XR82_BCL2L2-01        gac-----------------------------aggggccg----------
A0A2K6GWM6_BCL2L2-      gac-----------------------------aggggccg----------
A0A287D9B3_BCL2L2-      ---------------------------------ggaggca----------
A0A1U7UJF2_BCL2L2-      gac-----------------------------gggagccg----------
A0A1S3FYD8_BCL2L2-      gac-----------------------------gggggccg----------
A0A2K6TM77_BCL2L2-      gac-----------------------------aggggccg----------
A0A2K5CWY6_BCL2L2-      gac-----------------------------aggggccg----------
A0A2K5CWY6_BCL2L2-      gac-----------------------------aggggccg----------
A0A2K5RUN8_BCL2L2-      gac-----------------------------aggggccg----------
A0A2R9A2Q3_BCL2L2-      gac-----------------------------gggggccg----------
H2Q805_BCL2L2-01        gac-----------------------------gggggccg----------
A0A2I2YPX6_BCL2L2-      gac-----------------------------gggggccg----------
A0A2I3GEA7_BCL2L2-      gac-----------------------------gggggccg----------
A0A2K5MZX9_BCL2L2-      gac-----------------------------gggggccg----------
A0A2K6EA59_BCL2L2-      gac-----------------------------gggggccg----------
A0A2K5V0Q3_BCL2L2-      gac-----------------------------gggggccg----------
F7G4L5_BCL2L2-01        gac-----------------------------gggggccg----------
A0A2K6AI25_BCL2L2-      gac-----------------------------gggggccg----------
A0A096NX09_BCL2L2-      gac-----------------------------gggggccg----------
A0A2K6RW35_BCL2L2-      gac-----------------------------gggggccg----------
A0A2K6RW35_BCL2L2-      gac-----------------------------gggggccg----------
A0A2K6ME72_BCL2L2-      gac-----------------------------gggggccg----------
A0A0D9RU30_BCL2L2-      gac-----------------------------gggggccg----------
A0A2K5HEJ9_BCL2L2-      gac-----------------------------gggggccg----------
G3TMU7_BCL2L2-01        gac-----------------------------gggggctg----------
O88996_BCL2L2-01        gac-----------------------------gggggctg----------
Q7TS60_BCL2L2-01        gac-----------------------------gggggctg----------
A0A287D9B3_BCL2L2-      gac-----------------------------gggggccg----------
P70345_BCL2L2-02        gac-----------------------------gggggccg----------
P70345_BCL2L2-01        gac-----------------------------gggggccg----------
A0A452UF16_BCL2L2-      ggcccagtgatcatgtctattgaagagaagatggaggctgatgcccgttc
A0A452UF16_BCL2L2-      ggcccagtgatcatgtctattgaagagaagatggaggctgatgcccgttc
A0A4D6NWN1_BCL2L2-      ggcccagttatcatgtccattgaggagaagatggaggcagatgcccgatc
A0A287ATE4_BCL2L2-      ggcccagttatcatgtccattgaggagaagatggaggcagatgcccgatc
A0A287ATE4_BCL2L2-      ggcccagttatcatgtccattgaggagaagatggaggcagatgcccgatc
A0A1U7UJF2_BCL2L2-      ggcccagtgatcatgtccattgaggaaaagatggaggctgatgctcgttc
A0A2K6GWM6_BCL2L2-      ggtccagtgatcatgtccattgaagagaaaatggaggctgatgcccgttc
A0A2R9A2Q3_BCL2L2-      ggcccagtgatcatgtccattgaggagaagatggaggctgatgcccgttc
H2Q805_BCL2L2-02        ggcccagtgatcatgtccattgaggagaagatggaggctgatgcccgttc
A0A2I2YPX6_BCL2L2-      ggaccagtgatcatgtccattgaggagaagatggaggctgatgcccgttc
A0A2I3GEA7_BCL2L2-      ggcccagtgatcatgtccattgaggagaagatggaggctgatgcccgttc
A0A096NX09_BCL2L2-      ggcccagtgatcatgtccattgaggagaagatggaggctgatgcccgttc
A0A2K5V0Q3_BCL2L2-      ggcccagtgatcatgtccattgaggagaagatggaggctgatgcccgttc
F7G4L5_BCL2L2-02        ggcccagtgatcatgtccattgaggagaagatggaggctgatgcccgttc
A0A2K6AI25_BCL2L2-      ggcccagtgatcatgtccattgaggagaagatggaggctgatgcccgttc
A0A2K5MZX9_BCL2L2-      ggcccagtgatcatgtccattgaggagaagatggaggctgatgcccgttc
A0A2K6EA59_BCL2L2-      ggcccagtgatcatgtccattgaggagaagatggaggctgatgcccgttc
A0A2K5HEJ9_BCL2L2-      ggcccagtgatcatgtccattgaggagaagatggaggctgatgcccgttc
A0A2K6ME72_BCL2L2-      ggcccagtgatcatgtccattgaggagaagatggaggctgatgcccgttc
A0A2K6RW35_BCL2L2-      ggcccagtgatcatgtccattgaggagaagatggaggctgatgcccgttc
A0A2R8M4C0_BCL2L2-      ggcccagtgatcatgtccattgaggagaagatggaggctgatgcccgttc
A0A2K5RUN8_BCL2L2-      ggcccagtgatcatgtccattgaggagaagatggaggctgatgcccgttc
A0A2K6TM77_BCL2L2-      ggaccagtgatcatgtccattgaggagaagatggaggctgatgcccgttc
                                                         *                

Q5XGJ4_BCL2L2-01        ---------tagct----------ctgggtgctttaat------------
H3AAS7_BCL2L2-02        ---------tggcg----------ctaggggcggtgat------------
H3AAS7_BCL2L2-01        ---------tggcg----------ctaggggcggtgat------------
F7G6M3_BCL2L2-01        ---------tggcg----------ctgggagccctggt------------
G3WPT1_BCL2L2-01        ---------tggca----------ctgggggctctggt------------
G3WPT1_BCL2L2-02        ---------tggca----------ctgggggctctggt------------
G1Q051_BCL2L2-01        ---------tggca----------ctaagggccttgtt------------
G1TV33_BCL2L2-01        ---------tggca----------ctgggggccctggt------------
G1P3J2_BCL2L2-01        ---------tggca----------ctaggggccttggt------------
A0A482LX62_BCL2L2-      ------------------------atggagccactcgt------------
A0A1U7RC37_BCL2L2-      tatctatgttggca----------atgtggactatggtgcgacagcagaa
A0A250YBR2_BCL2L2-      ---------tggca----------ctgggggccctggt------------
A0A250YBR2_BCL2L2-      ---------tggca----------ctgggggccctggt------------
W5QDH4_BCL2L2-01        catctatgttggca----------atgtggactatggtgcaacagcagaa
A0A287ATE4_BCL2L2-      ---------tggca----------ctgggggccctggt------------
A0A3Q9B4M8_BCL2L2-      ---------tggca----------ctgggggccctggt------------
A0A1U7RC37_BCL2L2-      ---------tggca----------ctgggggccctggt------------
A0A2I2UAE3_BCL2L2-      ---------tggca----------ctgggggccctggt------------
M3Y5X5_BCL2L2-01        ---------tggca----------ctgggggccctggt------------
G1LMC3_BCL2L2-01        ---------tggca----------ctgggggccctggt------------
A0A452SHI1_BCL2L2-      ---------tggca----------ctgggggccctggt------------
A0A286XQQ9_BCL2L2-      ---------tggca----------ctgggggccctggt------------
L8HP19_BCL2L2-02        ---------tggca----------ctgggggccctggt------------
L8HP19_BCL2L2-01        ---------tggca----------ctgggggccctggt------------
Q1RMX3_BCL2L2-01        ---------tggca----------ctgggggccctggt------------
Q05KI8_BCL2L2-01        ---------tggca----------ctgggggccctggt------------
A0A452ECF0_BCL2L2-      ---------tggca----------ctgggggccctggt------------
W5QDH4_BCL2L2-02        ---------tggcactttcgctagctgagggctctgg-------------
H0XR82_BCL2L2-01        ---------tggca----------ctgggggccctggt------------
A0A2K6GWM6_BCL2L2-      ---------tggca----------ctgggggccctggt------------
A0A287D9B3_BCL2L2-      ---------tgggg----------ctga----------------------
A0A1U7UJF2_BCL2L2-      ---------tggca----------ctgggggccctggt------------
A0A1S3FYD8_BCL2L2-      ---------tggca----------ctgggggccctggt------------
A0A2K6TM77_BCL2L2-      ---------tggca----------ctgggggccctggt------------
A0A2K5CWY6_BCL2L2-      ---------tggca----------ctgggggccctggt------------
A0A2K5CWY6_BCL2L2-      ---------tggca----------ctgggggccctggt------------
A0A2K5RUN8_BCL2L2-      ---------tggca----------ctgggggccctggt------------
A0A2R9A2Q3_BCL2L2-      ---------tggca----------ctgggggccctggt------------
H2Q805_BCL2L2-01        ---------tggca----------ctgggggccctggt------------
A0A2I2YPX6_BCL2L2-      ---------tggca----------ctgggggccctggt------------
A0A2I3GEA7_BCL2L2-      ---------tggca----------ctgggggccctggt------------
A0A2K5MZX9_BCL2L2-      ---------tggca----------ctgggggccctggt------------
A0A2K6EA59_BCL2L2-      ---------tggca----------ctgggggccctggt------------
A0A2K5V0Q3_BCL2L2-      ---------tggca----------ctgggggccctggt------------
F7G4L5_BCL2L2-01        ---------tggca----------ctgggggccctggt------------
A0A2K6AI25_BCL2L2-      ---------tggca----------ctgggggccctggt------------
A0A096NX09_BCL2L2-      ---------tggca----------ctgggggccctggt------------
A0A2K6RW35_BCL2L2-      ---------tggca----------ctgggggccctggt------------
A0A2K6RW35_BCL2L2-      ---------tggca----------ctgggggccctggt------------
A0A2K6ME72_BCL2L2-      ---------tggca----------ctgggggccctggt------------
A0A0D9RU30_BCL2L2-      ---------tggca----------ctgggggccctggt------------
A0A2K5HEJ9_BCL2L2-      ---------tggca----------ctgggggccctggt------------
G3TMU7_BCL2L2-01        ---------tggca----------ctgggggccctggt------------
O88996_BCL2L2-01        ---------tggca----------ctgggggccctggt------------
Q7TS60_BCL2L2-01        ---------tggca----------ctgggggccctggt------------
A0A287D9B3_BCL2L2-      ---------tggca----------ctgggggccctggt------------
P70345_BCL2L2-02        ---------tggca----------ctgggggccctggt------------
P70345_BCL2L2-01        ---------tggca----------ctgggggccctggt------------
A0A452UF16_BCL2L2-      catctatgttggca----------acgtggactatggtgcaacagcagaa
A0A452UF16_BCL2L2-      catctatgttggca----------acgtggactatggtgcaacagcagaa
A0A4D6NWN1_BCL2L2-      tatctatgttggca----------atgtggactatggtgcaacagcagaa
A0A287ATE4_BCL2L2-      tatctatgttggca----------atgtggactatggtgcaacagcagaa
A0A287ATE4_BCL2L2-      tatctatgttggca----------atgtggactatggtgcaacagcagaa
A0A1U7UJF2_BCL2L2-      catctatgttggca----------atgtggactatggtgcaacagcagaa
A0A2K6GWM6_BCL2L2-      catctatgttggca----------atgtggactatggtgcaacagcagaa
A0A2R9A2Q3_BCL2L2-      catctatgttggca----------atgtggactatggtgcaacagcagaa
H2Q805_BCL2L2-02        catctatgttggca----------atgtggactatggtgcaacagcagaa
A0A2I2YPX6_BCL2L2-      catctatgttggca----------atgtggactatggtgcaacagcagaa
A0A2I3GEA7_BCL2L2-      catctatgttggca----------atgtggactatggtgcaacagcagaa
A0A096NX09_BCL2L2-      catctatgttggca----------atgtggactatggtgcaacagcagaa
A0A2K5V0Q3_BCL2L2-      catctatgttggca----------atgtggactatggtgcaacagcagaa
F7G4L5_BCL2L2-02        catctatgttggca----------atgtggactatggtgcaacagcagaa
A0A2K6AI25_BCL2L2-      catctatgttggca----------atgtggactatggtgcaacagcagaa
A0A2K5MZX9_BCL2L2-      catctatgttggca----------atgtggactatggtgcaacagcagaa
A0A2K6EA59_BCL2L2-      catctatgttggca----------atgtggactatggtgcaacagcagaa
A0A2K5HEJ9_BCL2L2-      catctatgttggca----------atgtggactatggtgcaacagcagaa
A0A2K6ME72_BCL2L2-      catctatgttggca----------atgtggactatggtgcaacagcagaa
A0A2K6RW35_BCL2L2-      catctatgttggca----------atgtggactatggtgcaacagcagaa
A0A2R8M4C0_BCL2L2-      catctatgttggca----------atgtggactatggtgcaacagcagaa
A0A2K5RUN8_BCL2L2-      catctatgttggca----------atgtggactacggtgcaacagcagaa
A0A2K6TM77_BCL2L2-      catctatgttggca----------atgtggactatggtgcaacagcagaa
                                                                          

Q5XGJ4_BCL2L2-01        --------------------------------------------------
H3AAS7_BCL2L2-02        --------------------------------------------------
H3AAS7_BCL2L2-01        --------------------------------------------------
F7G6M3_BCL2L2-01        --------------------------------------------------
G3WPT1_BCL2L2-01        --------------------------------------------------
G3WPT1_BCL2L2-02        --------------------------------------------------
G1Q051_BCL2L2-01        --------------------------------------------------
G1TV33_BCL2L2-01        --------------------------------------------------
G1P3J2_BCL2L2-01        --------------------------------------------------
A0A482LX62_BCL2L2-      --------------------------------------------------
A0A1U7RC37_BCL2L2-      gagctggaagcccactttcatggctgtggttcagtcaaccgtgtcactat
A0A250YBR2_BCL2L2-      --------------------------------------------------
A0A250YBR2_BCL2L2-      --------------------------------------------------
W5QDH4_BCL2L2-01        gagctagaagcacacttccatggctgtggttcagtcaaccgcgttactat
A0A287ATE4_BCL2L2-      --------------------------------------------------
A0A3Q9B4M8_BCL2L2-      --------------------------------------------------
A0A1U7RC37_BCL2L2-      --------------------------------------------------
A0A2I2UAE3_BCL2L2-      --------------------------------------------------
M3Y5X5_BCL2L2-01        --------------------------------------------------
G1LMC3_BCL2L2-01        --------------------------------------------------
A0A452SHI1_BCL2L2-      --------------------------------------------------
A0A286XQQ9_BCL2L2-      --------------------------------------------------
L8HP19_BCL2L2-02        --------------------------------------------------
L8HP19_BCL2L2-01        --------------------------------------------------
Q1RMX3_BCL2L2-01        --------------------------------------------------
Q05KI8_BCL2L2-01        --------------------------------------------------
A0A452ECF0_BCL2L2-      --------------------------------------------------
W5QDH4_BCL2L2-02        --------------------------------------------------
H0XR82_BCL2L2-01        --------------------------------------------------
A0A2K6GWM6_BCL2L2-      --------------------------------------------------
A0A287D9B3_BCL2L2-      --------------------------------------------------
A0A1U7UJF2_BCL2L2-      --------------------------------------------------
A0A1S3FYD8_BCL2L2-      --------------------------------------------------
A0A2K6TM77_BCL2L2-      --------------------------------------------------
A0A2K5CWY6_BCL2L2-      --------------------------------------------------
A0A2K5CWY6_BCL2L2-      --------------------------------------------------
A0A2K5RUN8_BCL2L2-      --------------------------------------------------
A0A2R9A2Q3_BCL2L2-      --------------------------------------------------
H2Q805_BCL2L2-01        --------------------------------------------------
A0A2I2YPX6_BCL2L2-      --------------------------------------------------
A0A2I3GEA7_BCL2L2-      --------------------------------------------------
A0A2K5MZX9_BCL2L2-      --------------------------------------------------
A0A2K6EA59_BCL2L2-      --------------------------------------------------
A0A2K5V0Q3_BCL2L2-      --------------------------------------------------
F7G4L5_BCL2L2-01        --------------------------------------------------
A0A2K6AI25_BCL2L2-      --------------------------------------------------
A0A096NX09_BCL2L2-      --------------------------------------------------
A0A2K6RW35_BCL2L2-      --------------------------------------------------
A0A2K6RW35_BCL2L2-      --------------------------------------------------
A0A2K6ME72_BCL2L2-      --------------------------------------------------
A0A0D9RU30_BCL2L2-      --------------------------------------------------
A0A2K5HEJ9_BCL2L2-      --------------------------------------------------
G3TMU7_BCL2L2-01        --------------------------------------------------
O88996_BCL2L2-01        --------------------------------------------------
Q7TS60_BCL2L2-01        --------------------------------------------------
A0A287D9B3_BCL2L2-      --------------------------------------------------
P70345_BCL2L2-02        --------------------------------------------------
P70345_BCL2L2-01        --------------------------------------------------
A0A452UF16_BCL2L2-      gagctggaagcacactttcatggctgtggttcagtcaatcgtgttaccat
A0A452UF16_BCL2L2-      gagctggaagcacactttcatggctgtggttcagtcaatcgtgttaccat
A0A4D6NWN1_BCL2L2-      gagctggaagcacactttcatggctgtggttcagtcaaccgcgttactat
A0A287ATE4_BCL2L2-      gagctggaagcacactttcatggctgtggttcagtcaaccgcgttactat
A0A287ATE4_BCL2L2-      gagctggaagcacactttcatggctgtggttcagtcaaccgcgttactat
A0A1U7UJF2_BCL2L2-      gagctagaagctcactttcatggctgtggttcagtcaaccgtgttaccat
A0A2K6GWM6_BCL2L2-      gagctggaagctcactttcatggttgtggttcagtcaaccgtgttaccat
A0A2R9A2Q3_BCL2L2-      gagctggaagctcactttcatggctgtggttcagtcaaccgtgttaccat
H2Q805_BCL2L2-02        gagctggaagctcactttcatggctgtggttcagtcaaccgtgttaccat
A0A2I2YPX6_BCL2L2-      gagctggaagctcactttcatggctgtggttcagtcaaccgtgttaccat
A0A2I3GEA7_BCL2L2-      gagctggaagctcactttcatggctgtggttcagtcaaccgtgttaccat
A0A096NX09_BCL2L2-      gagttggaagctcactttcatggctgtggatcagtcaaccgtgttaccat
A0A2K5V0Q3_BCL2L2-      gagctggaagctcactttcatggctgtggatcagtcaaccgtgttaccat
F7G4L5_BCL2L2-02        gagctggaagctcactttcatggctgtggatcagtcaaccgtgttaccat
A0A2K6AI25_BCL2L2-      gagctggaagctcactttcatggctgtggatcagtcaaccgtgttaccat
A0A2K5MZX9_BCL2L2-      gagctggaagctcactttcatggctgtggatcagtcaaccgtgttaccat
A0A2K6EA59_BCL2L2-      gagctggaagctcactttcatggctgtggatcagtcaaccgtgttaccat
A0A2K5HEJ9_BCL2L2-      gagctggaagctcactttcatggctgtggatcagtcaaccgtgttaccat
A0A2K6ME72_BCL2L2-      gagctggaagctcactttcatggctgtggatcagtcaaccgtgttaccat
A0A2K6RW35_BCL2L2-      gagctggaagctcactttcatggctgtggatcagtcaaccgtgttaccat
A0A2R8M4C0_BCL2L2-      gagctggaagctcactttcatggctgtggttcagtcaaccgtgttaccat
A0A2K5RUN8_BCL2L2-      gagctggaagctcactttcatggctgtggttcagtcaaccgtgttaccat
A0A2K6TM77_BCL2L2-      gagctggaagctcactttcatggctgtggttcagtcaaccgtgttaccat
                                                                          

Q5XGJ4_BCL2L2-01        ----------gacagtaggagcctt-------------------------
H3AAS7_BCL2L2-02        ----------gacggtcggagcgct-------------------------
H3AAS7_BCL2L2-01        ----------gacggtcggagcgct-------------------------
F7G6M3_BCL2L2-01        ----------gaccgtcggggcctt-------------------------
G3WPT1_BCL2L2-01        ----------gactgtgggggcctt-------------------------
G3WPT1_BCL2L2-02        ----------gactgtgggggcctt-------------------------
G1Q051_BCL2L2-01        ----------aactgtaggagcatt-------------------------
G1TV33_BCL2L2-01        ----------aactgtaggggcctt-------------------------
G1P3J2_BCL2L2-01        ----------aactgtaggagcatt-------------------------
A0A482LX62_BCL2L2-      -----gggacaagtgcaggag-----------------------------
A0A1U7RC37_BCL2L2-      actctgtgacaaatttagcggccatcctaaagggtttgcatatatagagt
A0A250YBR2_BCL2L2-      ----------aactgtaggggcctt-------------------------
A0A250YBR2_BCL2L2-      ----------aactgtaggggcctt-------------------------
W5QDH4_BCL2L2-01        actctgtgacaaatttagtggccatcccaaagggtttgcgtatatagagt
A0A287ATE4_BCL2L2-      ----------aactgtaggggcctt-------------------------
A0A3Q9B4M8_BCL2L2-      ----------aactgtaggggcctt-------------------------
A0A1U7RC37_BCL2L2-      ----------aactgtaggggcctt-------------------------
A0A2I2UAE3_BCL2L2-      ----------aactgtaggggcctt-------------------------
M3Y5X5_BCL2L2-01        ----------aactgtaggggcctt-------------------------
G1LMC3_BCL2L2-01        ----------aactgtaggggcctt-------------------------
A0A452SHI1_BCL2L2-      ----------aactgtaggggcctt-------------------------
A0A286XQQ9_BCL2L2-      ----------aactgtaggggcctt-------------------------
L8HP19_BCL2L2-02        ----------aactgtaggggcctt-------------------------
L8HP19_BCL2L2-01        ----------aactgtaggggcctt-------------------------
Q1RMX3_BCL2L2-01        ----------aactgtaggggcctt-------------------------
Q05KI8_BCL2L2-01        ----------aactgtaggggcctt-------------------------
A0A452ECF0_BCL2L2-      ----------aaccgtaggggcctt-------------------------
W5QDH4_BCL2L2-02        ------------ccg-------ctt-------------------------
H0XR82_BCL2L2-01        ----------aactgtaggggcctt-------------------------
A0A2K6GWM6_BCL2L2-      ----------aactgtaggggcctt-------------------------
A0A287D9B3_BCL2L2-      --------------------------------------------------
A0A1U7UJF2_BCL2L2-      ----------aactgtaggggcctt-------------------------
A0A1S3FYD8_BCL2L2-      ----------aactgtaggggcctt-------------------------
A0A2K6TM77_BCL2L2-      ----------aactgtaggggcctt-------------------------
A0A2K5CWY6_BCL2L2-      ----------aactgtaggggcctt-------------------------
A0A2K5CWY6_BCL2L2-      ----------aactgtaggggcctt-------------------------
A0A2K5RUN8_BCL2L2-      ----------aactgtaggggcctt-------------------------
A0A2R9A2Q3_BCL2L2-      ----------aactgtaggggcctt-------------------------
H2Q805_BCL2L2-01        ----------aactgtaggggcctt-------------------------
A0A2I2YPX6_BCL2L2-      ----------aactgtaggggcctt-------------------------
A0A2I3GEA7_BCL2L2-      ----------aactgtaggggcctt-------------------------
A0A2K5MZX9_BCL2L2-      ----------aactgtaggggcctt-------------------------
A0A2K6EA59_BCL2L2-      ----------aactgtaggggcctt-------------------------
A0A2K5V0Q3_BCL2L2-      ----------aactgtaggggcctt-------------------------
F7G4L5_BCL2L2-01        ----------aactgtaggggcctt-------------------------
A0A2K6AI25_BCL2L2-      ----------aactgtaggggcctt-------------------------
A0A096NX09_BCL2L2-      ----------aactgtaggggcctt-------------------------
A0A2K6RW35_BCL2L2-      ----------aactgtaggggcctt-------------------------
A0A2K6RW35_BCL2L2-      ----------aactgtaggggcctt-------------------------
A0A2K6ME72_BCL2L2-      ----------aactgtaggggcctt-------------------------
A0A0D9RU30_BCL2L2-      ----------aactgtaggggcctt-------------------------
A0A2K5HEJ9_BCL2L2-      ----------aactgtaggggcctt-------------------------
G3TMU7_BCL2L2-01        ----------aactgtaggggcctt-------------------------
O88996_BCL2L2-01        ----------aactgtaggggcctt-------------------------
Q7TS60_BCL2L2-01        ----------aactgtaggggcctt-------------------------
A0A287D9B3_BCL2L2-      ----------aactgtaggggcctt-------------------------
P70345_BCL2L2-02        ----------aactgtaggggcctt-------------------------
P70345_BCL2L2-01        ----------aactgtaggggcctt-------------------------
A0A452UF16_BCL2L2-      actctgtgacaaatttagtggccatcctaaagggtttgcatatatagagt
A0A452UF16_BCL2L2-      actctgtgacaaatttagtggccatcctaaagggtttgcatatatagagt
A0A4D6NWN1_BCL2L2-      actctgtgacaaatttagtggccatcccaaagggtttgcatatatagagt
A0A287ATE4_BCL2L2-      actctgtgacaaatttagtggccatcccaaagggtttgcatatatagagt
A0A287ATE4_BCL2L2-      actctgtgacaaatttagtggccatcccaaagggtttgcatatatagagt
A0A1U7UJF2_BCL2L2-      actctgtgacaaatttagtggccatcccaaaggttttgcttatatagagt
A0A2K6GWM6_BCL2L2-      actgtgtgacaaatttagtggccatcccaaagggtttgcatatatagagt
A0A2R9A2Q3_BCL2L2-      actctgtgacaaatttagtggccatcccaaagggtttgcgtatatagagt
H2Q805_BCL2L2-02        actctgtgacaaatttagtggccatcccaaagggtttgcgtatatagagt
A0A2I2YPX6_BCL2L2-      actctgtgacaaatttagtggccatcccaaagggtttgcatatatagagt
A0A2I3GEA7_BCL2L2-      actctgtgacaaatttagtggccatcccaaagggtttgcatatatagagt
A0A096NX09_BCL2L2-      actctgtgacaaatttagtggccatcccaaaggatttgcgtatatagagt
A0A2K5V0Q3_BCL2L2-      actctgtgacaaatttagtggccatcccaaaggatttgcgtatatagagt
F7G4L5_BCL2L2-02        actctgtgacaaatttagtggccatcccaaaggatttgcgtatatagagt
A0A2K6AI25_BCL2L2-      actctgtgacaaatttagtggccatcccaaaggatttgcgtatatagagt
A0A2K5MZX9_BCL2L2-      actctgtgacaaatttagtggccatcccaaaggatttgcgtatatagagt
A0A2K6EA59_BCL2L2-      actctgtgacaaatttagtggccatcccaaaggatttgcgtatatagagt
A0A2K5HEJ9_BCL2L2-      actctgtgacaaatttagtggccatcccaaagggtttgcgtatatagagt
A0A2K6ME72_BCL2L2-      actctgtgacaaatttagtggccatcccaaagggtttgcgtatatagagt
A0A2K6RW35_BCL2L2-      actctgtgacaaatttagtggccatcccaaagggtttgcgtatatagagt
A0A2R8M4C0_BCL2L2-      actctgtgacaaatttagtggccatcccaaagggtttgcatatatagagt
A0A2K5RUN8_BCL2L2-      actctgtgacaaatttagtggccatcccaaagggtttgcatatatagagt
A0A2K6TM77_BCL2L2-      actctgtgacaaatttagtggccatcccaaagggtttgcatatatagagt
                                                                          

Q5XGJ4_BCL2L2-01        --------------------------------------------------
H3AAS7_BCL2L2-02        --------------------------------------------------
H3AAS7_BCL2L2-01        --------------------------------------------------
F7G6M3_BCL2L2-01        --------------------------------------------------
G3WPT1_BCL2L2-01        --------------------------------------------------
G3WPT1_BCL2L2-02        --------------------------------------------------
G1Q051_BCL2L2-01        --------------------------------------------------
G1TV33_BCL2L2-01        --------------------------------------------------
G1P3J2_BCL2L2-01        --------------------------------------------------
A0A482LX62_BCL2L2-      --------------------------------------------------
A0A1U7RC37_BCL2L2-      tctcagacaaagagtcggtgaggacttccctggccttagacgagtccctg
A0A250YBR2_BCL2L2-      --------------------------------------------------
A0A250YBR2_BCL2L2-      --------------------------------------------------
W5QDH4_BCL2L2-01        tctcagacaaagagtcagtgaggacttccctggccttagatgaatcctta
A0A287ATE4_BCL2L2-      --------------------------------------------------
A0A3Q9B4M8_BCL2L2-      --------------------------------------------------
A0A1U7RC37_BCL2L2-      --------------------------------------------------
A0A2I2UAE3_BCL2L2-      --------------------------------------------------
M3Y5X5_BCL2L2-01        --------------------------------------------------
G1LMC3_BCL2L2-01        --------------------------------------------------
A0A452SHI1_BCL2L2-      --------------------------------------------------
A0A286XQQ9_BCL2L2-      --------------------------------------------------
L8HP19_BCL2L2-02        --------------------------------------------------
L8HP19_BCL2L2-01        --------------------------------------------------
Q1RMX3_BCL2L2-01        --------------------------------------------------
Q05KI8_BCL2L2-01        --------------------------------------------------
A0A452ECF0_BCL2L2-      --------------------------------------------------
W5QDH4_BCL2L2-02        --------------------------------------------------
H0XR82_BCL2L2-01        --------------------------------------------------
A0A2K6GWM6_BCL2L2-      --------------------------------------------------
A0A287D9B3_BCL2L2-      --------------------------------------------------
A0A1U7UJF2_BCL2L2-      --------------------------------------------------
A0A1S3FYD8_BCL2L2-      --------------------------------------------------
A0A2K6TM77_BCL2L2-      --------------------------------------------------
A0A2K5CWY6_BCL2L2-      --------------------------------------------------
A0A2K5CWY6_BCL2L2-      --------------------------------------------------
A0A2K5RUN8_BCL2L2-      --------------------------------------------------
A0A2R9A2Q3_BCL2L2-      --------------------------------------------------
H2Q805_BCL2L2-01        --------------------------------------------------
A0A2I2YPX6_BCL2L2-      --------------------------------------------------
A0A2I3GEA7_BCL2L2-      --------------------------------------------------
A0A2K5MZX9_BCL2L2-      --------------------------------------------------
A0A2K6EA59_BCL2L2-      --------------------------------------------------
A0A2K5V0Q3_BCL2L2-      --------------------------------------------------
F7G4L5_BCL2L2-01        --------------------------------------------------
A0A2K6AI25_BCL2L2-      --------------------------------------------------
A0A096NX09_BCL2L2-      --------------------------------------------------
A0A2K6RW35_BCL2L2-      --------------------------------------------------
A0A2K6RW35_BCL2L2-      --------------------------------------------------
A0A2K6ME72_BCL2L2-      --------------------------------------------------
A0A0D9RU30_BCL2L2-      --------------------------------------------------
A0A2K5HEJ9_BCL2L2-      --------------------------------------------------
G3TMU7_BCL2L2-01        --------------------------------------------------
O88996_BCL2L2-01        --------------------------------------------------
Q7TS60_BCL2L2-01        --------------------------------------------------
A0A287D9B3_BCL2L2-      --------------------------------------------------
P70345_BCL2L2-02        --------------------------------------------------
P70345_BCL2L2-01        --------------------------------------------------
A0A452UF16_BCL2L2-      tctcagataaagagtcagtgaggacttccttggccttagatgagtccctg
A0A452UF16_BCL2L2-      tctcagataaagagtcagtgaggacttccttggccttagatgagtccctg
A0A4D6NWN1_BCL2L2-      tctcagacaaagagtcagtgaggacttccttggccttagatgagtcccta
A0A287ATE4_BCL2L2-      tctcagacaaagagtcagtgaggacttccttggccttagatgagtcccta
A0A287ATE4_BCL2L2-      tctcagacaaagagtcagtgaggacttccttggccttagatgagtcccta
A0A1U7UJF2_BCL2L2-      tctcagacaaagagtcagtgaggacttccctggccttagatgagtcccta
A0A2K6GWM6_BCL2L2-      tctcagacaaagagtcagtgaggacttccctggccttagatgagtccctg
A0A2R9A2Q3_BCL2L2-      tctcagacaaagagtcagtgaggacttccttggccttagatgagtcccta
H2Q805_BCL2L2-02        tctcagacaaagagtcagtgaggacttccttggccttagatgagtcccta
A0A2I2YPX6_BCL2L2-      tctcagacaaagagtcagtgaggacttccttggccttagatgagtcccta
A0A2I3GEA7_BCL2L2-      tctcagacaaagagtcagtgaggacttccttggccttagatgagtccctg
A0A096NX09_BCL2L2-      tctcagacaaagagtcagtgaggacttccttggccttagatgagtcccta
A0A2K5V0Q3_BCL2L2-      tctcagacaaagagtcagtgaggacttccttggccttagatgagtcccta
F7G4L5_BCL2L2-02        tctcagacaaagagtcagtgaggacttccttggccttagatgagtcccta
A0A2K6AI25_BCL2L2-      tctcagacaaagagtcagtgaggacttccttggccttagatgagtcccta
A0A2K5MZX9_BCL2L2-      tctcagacaaagagtcagtgaggacttccttggccttagatgagtcccta
A0A2K6EA59_BCL2L2-      tctcagacaaagagtcagtgaggacttccttggccttagatgagtcccta
A0A2K5HEJ9_BCL2L2-      tctcagacaaagagtcagtgaggacgtccttggccttagatgagtcccta
A0A2K6ME72_BCL2L2-      tctcagacaaagagtcagtgaggacttccttggccttagatgagtcccta
A0A2K6RW35_BCL2L2-      tctcagacaaagagtcagtgaggacttccttggccttagatgagtcccta
A0A2R8M4C0_BCL2L2-      tctcagacaaagagtcagtgaggacttccttggccttagatgagtcccta
A0A2K5RUN8_BCL2L2-      tctcagacaaagagtcagtgaggacttccttggccttagacgagtcccta
A0A2K6TM77_BCL2L2-      tctcagacaaagagtcagtgaggacttccttggccttagacgagtcccta
                                                                          

Q5XGJ4_BCL2L2-01        --------------------------------------------------
H3AAS7_BCL2L2-02        --------------------------------------------------
H3AAS7_BCL2L2-01        --------------------------------------------------
F7G6M3_BCL2L2-01        --------------------------------------------------
G3WPT1_BCL2L2-01        --------------------------------------------------
G3WPT1_BCL2L2-02        --------------------------------------------------
G1Q051_BCL2L2-01        --------------------------------------------------
G1TV33_BCL2L2-01        --------------------------------------------------
G1P3J2_BCL2L2-01        --------------------------------------------------
A0A482LX62_BCL2L2-      --------------------------------------------------
A0A1U7RC37_BCL2L2-      tttagaggaagacaaatca-------------------------------
A0A250YBR2_BCL2L2-      --------------------------------------------------
A0A250YBR2_BCL2L2-      --------------------------------------------------
W5QDH4_BCL2L2-01        tttagaggaagacagatca-------------------------------
A0A287ATE4_BCL2L2-      --------------------------------------------------
A0A3Q9B4M8_BCL2L2-      --------------------------------------------------
A0A1U7RC37_BCL2L2-      --------------------------------------------------
A0A2I2UAE3_BCL2L2-      --------------------------------------------------
M3Y5X5_BCL2L2-01        --------------------------------------------------
G1LMC3_BCL2L2-01        --------------------------------------------------
A0A452SHI1_BCL2L2-      --------------------------------------------------
A0A286XQQ9_BCL2L2-      --------------------------------------------------
L8HP19_BCL2L2-02        --------------------------------------------------
L8HP19_BCL2L2-01        --------------------------------------------------
Q1RMX3_BCL2L2-01        --------------------------------------------------
Q05KI8_BCL2L2-01        --------------------------------------------------
A0A452ECF0_BCL2L2-      --------------------------------------------------
W5QDH4_BCL2L2-02        --------------------------------------------------
H0XR82_BCL2L2-01        --------------------------------------------------
A0A2K6GWM6_BCL2L2-      --------------------------------------------------
A0A287D9B3_BCL2L2-      --------------------------------------------------
A0A1U7UJF2_BCL2L2-      --------------------------------------------------
A0A1S3FYD8_BCL2L2-      --------------------------------------------------
A0A2K6TM77_BCL2L2-      --------------------------------------------------
A0A2K5CWY6_BCL2L2-      --------------------------------------------------
A0A2K5CWY6_BCL2L2-      --------------------------------------------------
A0A2K5RUN8_BCL2L2-      --------------------------------------------------
A0A2R9A2Q3_BCL2L2-      --------------------------------------------------
H2Q805_BCL2L2-01        --------------------------------------------------
A0A2I2YPX6_BCL2L2-      --------------------------------------------------
A0A2I3GEA7_BCL2L2-      --------------------------------------------------
A0A2K5MZX9_BCL2L2-      --------------------------------------------------
A0A2K6EA59_BCL2L2-      --------------------------------------------------
A0A2K5V0Q3_BCL2L2-      --------------------------------------------------
F7G4L5_BCL2L2-01        --------------------------------------------------
A0A2K6AI25_BCL2L2-      --------------------------------------------------
A0A096NX09_BCL2L2-      --------------------------------------------------
A0A2K6RW35_BCL2L2-      --------------------------------------------------
A0A2K6RW35_BCL2L2-      --------------------------------------------------
A0A2K6ME72_BCL2L2-      --------------------------------------------------
A0A0D9RU30_BCL2L2-      --------------------------------------------------
A0A2K5HEJ9_BCL2L2-      --------------------------------------------------
G3TMU7_BCL2L2-01        --------------------------------------------------
O88996_BCL2L2-01        --------------------------------------------------
Q7TS60_BCL2L2-01        --------------------------------------------------
A0A287D9B3_BCL2L2-      --------------------------------------------------
P70345_BCL2L2-02        --------------------------------------------------
P70345_BCL2L2-01        --------------------------------------------------
A0A452UF16_BCL2L2-      tttagaggaagacaaatca-------------------------------
A0A452UF16_BCL2L2-      tttagaggaagacaaatca-------------------------------
A0A4D6NWN1_BCL2L2-      tttagaggaagacaaatca-------------------------------
A0A287ATE4_BCL2L2-      tttagaggaagacaaatca-------------------------------
A0A287ATE4_BCL2L2-      tttagaggaagacaaatca-------------------------------
A0A1U7UJF2_BCL2L2-      tttagaggaagacaaatca-------------------------------
A0A2K6GWM6_BCL2L2-      tttagaggaagacaaatcaaggtaagcctgtgctttccattgtacatcct
A0A2R9A2Q3_BCL2L2-      tttagaggaaggcaaatca-------------------------------
H2Q805_BCL2L2-02        tttagaggaaggcaaatca-------------------------------
A0A2I2YPX6_BCL2L2-      tttagaggaaggcaaatcaaggttgactttaaggctatcatttgttcatc
A0A2I3GEA7_BCL2L2-      tttagaggaaggcaaatca-------------------------------
A0A096NX09_BCL2L2-      tttagaggaaggcaaatca-------------------------------
A0A2K5V0Q3_BCL2L2-      tttagaggaaggcaaatca-------------------------------
F7G4L5_BCL2L2-02        tttagaggaaggcaaatca-------------------------------
A0A2K6AI25_BCL2L2-      tttagaggaaggcaaatca-------------------------------
A0A2K5MZX9_BCL2L2-      tttagaggaaggcaaatca-------------------------------
A0A2K6EA59_BCL2L2-      tttagaggaaggcaaatca-------------------------------
A0A2K5HEJ9_BCL2L2-      tttagaggaaggcaaatca-------------------------------
A0A2K6ME72_BCL2L2-      tttagaggaaggcaaatca-------------------------------
A0A2K6RW35_BCL2L2-      tttagaggaaggcaaatca-------------------------------
A0A2R8M4C0_BCL2L2-      tttagaggaaggcagatca-------------------------------
A0A2K5RUN8_BCL2L2-      tttagaggaaggcaaatcaaggttgacgttaaggctttcatttattcatc
A0A2K6TM77_BCL2L2-      tttagaggacggcaaatcaaggttgactttaaggctttcatttattcatc
                                                                          

Q5XGJ4_BCL2L2-01        --------------------------------------------------
H3AAS7_BCL2L2-02        --------------------------------------------------
H3AAS7_BCL2L2-01        --------------------------------------------------
F7G6M3_BCL2L2-01        --------------------------------------------------
G3WPT1_BCL2L2-01        --------------------------------------------------
G3WPT1_BCL2L2-02        --------------------------------------------------
G1Q051_BCL2L2-01        --------------------------------------------------
G1TV33_BCL2L2-01        --------------------------------------------------
G1P3J2_BCL2L2-01        --------------------------------------------------
A0A482LX62_BCL2L2-      --------------------------------------------------
A0A1U7RC37_BCL2L2-      --------aggtgattcccaaacggaccaacagaccaggcatcagtacaa
A0A250YBR2_BCL2L2-      --------------------------------------------------
A0A250YBR2_BCL2L2-      --------------------------------------------------
W5QDH4_BCL2L2-01        --------aggtgatccctaaacgaaccaacagaccaggcatcagcacaa
A0A287ATE4_BCL2L2-      --------------------------------------------------
A0A3Q9B4M8_BCL2L2-      --------------------------------------------------
A0A1U7RC37_BCL2L2-      --------------------------------------------------
A0A2I2UAE3_BCL2L2-      --------------------------------------------------
M3Y5X5_BCL2L2-01        --------------------------------------------------
G1LMC3_BCL2L2-01        --------------------------------------------------
A0A452SHI1_BCL2L2-      --------------------------------------------------
A0A286XQQ9_BCL2L2-      --------------------------------------------------
L8HP19_BCL2L2-02        --------------------------------------------------
L8HP19_BCL2L2-01        --------------------------------------------------
Q1RMX3_BCL2L2-01        --------------------------------------------------
Q05KI8_BCL2L2-01        --------------------------------------------------
A0A452ECF0_BCL2L2-      --------------------------------------------------
W5QDH4_BCL2L2-02        --------------------------------------------------
H0XR82_BCL2L2-01        --------------------------------------------------
A0A2K6GWM6_BCL2L2-      --------------------------------------------------
A0A287D9B3_BCL2L2-      --------------------------------------------------
A0A1U7UJF2_BCL2L2-      --------------------------------------------------
A0A1S3FYD8_BCL2L2-      --------------------------------------------------
A0A2K6TM77_BCL2L2-      --------------------------------------------------
A0A2K5CWY6_BCL2L2-      --------------------------------------------------
A0A2K5CWY6_BCL2L2-      --------------------------------------------------
A0A2K5RUN8_BCL2L2-      --------------------------------------------------
A0A2R9A2Q3_BCL2L2-      --------------------------------------------------
H2Q805_BCL2L2-01        --------------------------------------------------
A0A2I2YPX6_BCL2L2-      --------------------------------------------------
A0A2I3GEA7_BCL2L2-      --------------------------------------------------
A0A2K5MZX9_BCL2L2-      --------------------------------------------------
A0A2K6EA59_BCL2L2-      --------------------------------------------------
A0A2K5V0Q3_BCL2L2-      --------------------------------------------------
F7G4L5_BCL2L2-01        --------------------------------------------------
A0A2K6AI25_BCL2L2-      --------------------------------------------------
A0A096NX09_BCL2L2-      --------------------------------------------------
A0A2K6RW35_BCL2L2-      --------------------------------------------------
A0A2K6RW35_BCL2L2-      --------------------------------------------------
A0A2K6ME72_BCL2L2-      --------------------------------------------------
A0A0D9RU30_BCL2L2-      --------------------------------------------------
A0A2K5HEJ9_BCL2L2-      --------------------------------------------------
G3TMU7_BCL2L2-01        --------------------------------------------------
O88996_BCL2L2-01        --------------------------------------------------
Q7TS60_BCL2L2-01        --------------------------------------------------
A0A287D9B3_BCL2L2-      --------------------------------------------------
P70345_BCL2L2-02        --------------------------------------------------
P70345_BCL2L2-01        --------------------------------------------------
A0A452UF16_BCL2L2-      --------aggtgatcccaaaacgaaccaacagaccaggcatcagcacaa
A0A452UF16_BCL2L2-      --------aggtgatcccaaaacgaaccaacagaccaggcatcagcacaa
A0A4D6NWN1_BCL2L2-      --------aggtgatcccaaaacgaaccaacagaccaggcatcagcacaa
A0A287ATE4_BCL2L2-      --------aggtgatcccaaaacgaaccaacagaccaggcatcagcacaa
A0A287ATE4_BCL2L2-      --------aggtgatcccaaaacgaaccaacagaccaggcatcagcacaa
A0A1U7UJF2_BCL2L2-      --------aggtgatcccaaaacgaaccaacagaccaggcatcagcacaa
A0A2K6GWM6_BCL2L2-      ttactctcaggtgatcccaaaacgaaccaacagaccaggcatcagcacaa
A0A2R9A2Q3_BCL2L2-      --------aggtgatcccaaaacgaaccaacagaccaggcatcagcacaa
H2Q805_BCL2L2-02        --------aggtgatcccaaaacgaaccaacagaccaggcatcagcacaa
A0A2I2YPX6_BCL2L2-      tctgactcaggtgatcccaaaacgaaccaacagaccaggcatcagcacaa
A0A2I3GEA7_BCL2L2-      --------aggtgatcccaaaacgaaccaacagaccaggcatcagcacaa
A0A096NX09_BCL2L2-      --------aggtgatcccaaaacgaaccaacagaccaggcatcagcacaa
A0A2K5V0Q3_BCL2L2-      --------aggtgatcccaaaacgaaccaacagaccaggcatcagcacaa
F7G4L5_BCL2L2-02        --------aggtgatcccaaaacgaaccaacagaccaggcatcagcacaa
A0A2K6AI25_BCL2L2-      --------aggtgatcccaaaacgaaccaacagaccaggcatcagcacaa
A0A2K5MZX9_BCL2L2-      --------aggtgatcccaaaacgaaccaacagaccaggcatcagcacaa
A0A2K6EA59_BCL2L2-      --------aggtgatcccaaaacgaaccaacagaccaggcatcagcacaa
A0A2K5HEJ9_BCL2L2-      --------aggtgatcccaaaacgaaccaacagaccaggcatcagcacaa
A0A2K6ME72_BCL2L2-      --------aggtgatcccaaaacgaaccaacagaccaggcatcagcacaa
A0A2K6RW35_BCL2L2-      --------aggtgatcccaaaacgaaccaacagaccaggcatcagcacaa
A0A2R8M4C0_BCL2L2-      --------aggtgatcccaaaacgaaccaacagaccaggcatcagcacaa
A0A2K5RUN8_BCL2L2-      tctgactcaggtgatcccaaaacgaaccaacagaccaggcatcagcacaa
A0A2K6TM77_BCL2L2-      tctgactcaggtgatcccaaaacgaaccaacagaccaggcatcagcacaa
                                                                          

Q5XGJ4_BCL2L2-01        --------------------------------------------------
H3AAS7_BCL2L2-02        --------------------------------------------------
H3AAS7_BCL2L2-01        --------------------------------------------------
F7G6M3_BCL2L2-01        --------------------------------------------------
G3WPT1_BCL2L2-01        --------------------------------------------------
G3WPT1_BCL2L2-02        --------------------------------------------------
G1Q051_BCL2L2-01        --------------------------------------------------
G1TV33_BCL2L2-01        --------------------------------------------------
G1P3J2_BCL2L2-01        --------------------------------------------------
A0A482LX62_BCL2L2-      --------------------------------------------------
A0A1U7RC37_BCL2L2-      cagaccggggtttcccgcgtgcccgataccgtgcccggactaccaattac
A0A250YBR2_BCL2L2-      --------------------------------------------------
A0A250YBR2_BCL2L2-      --------------------------------------------------
W5QDH4_BCL2L2-01        cagaccgaggtttcccacgagcccgataccgtgcccgaaccaccaactac
A0A287ATE4_BCL2L2-      --------------------------------------------------
A0A3Q9B4M8_BCL2L2-      --------------------------------------------------
A0A1U7RC37_BCL2L2-      --------------------------------------------------
A0A2I2UAE3_BCL2L2-      --------------------------------------------------
M3Y5X5_BCL2L2-01        --------------------------------------------------
G1LMC3_BCL2L2-01        --------------------------------------------------
A0A452SHI1_BCL2L2-      --------------------------------------------------
A0A286XQQ9_BCL2L2-      --------------------------------------------------
L8HP19_BCL2L2-02        --------------------------------------------------
L8HP19_BCL2L2-01        --------------------------------------------------
Q1RMX3_BCL2L2-01        --------------------------------------------------
Q05KI8_BCL2L2-01        --------------------------------------------------
A0A452ECF0_BCL2L2-      --------------------------------------------------
W5QDH4_BCL2L2-02        --------------------------------------------------
H0XR82_BCL2L2-01        --------------------------------------------------
A0A2K6GWM6_BCL2L2-      --------------------------------------------------
A0A287D9B3_BCL2L2-      --------------------------------------------------
A0A1U7UJF2_BCL2L2-      --------------------------------------------------
A0A1S3FYD8_BCL2L2-      --------------------------------------------------
A0A2K6TM77_BCL2L2-      --------------------------------------------------
A0A2K5CWY6_BCL2L2-      --------------------------------------------------
A0A2K5CWY6_BCL2L2-      --------------------------------------------------
A0A2K5RUN8_BCL2L2-      --------------------------------------------------
A0A2R9A2Q3_BCL2L2-      --------------------------------------------------
H2Q805_BCL2L2-01        --------------------------------------------------
A0A2I2YPX6_BCL2L2-      --------------------------------------------------
A0A2I3GEA7_BCL2L2-      --------------------------------------------------
A0A2K5MZX9_BCL2L2-      --------------------------------------------------
A0A2K6EA59_BCL2L2-      --------------------------------------------------
A0A2K5V0Q3_BCL2L2-      --------------------------------------------------
F7G4L5_BCL2L2-01        --------------------------------------------------
A0A2K6AI25_BCL2L2-      --------------------------------------------------
A0A096NX09_BCL2L2-      --------------------------------------------------
A0A2K6RW35_BCL2L2-      --------------------------------------------------
A0A2K6RW35_BCL2L2-      --------------------------------------------------
A0A2K6ME72_BCL2L2-      --------------------------------------------------
A0A0D9RU30_BCL2L2-      --------------------------------------------------
A0A2K5HEJ9_BCL2L2-      --------------------------------------------------
G3TMU7_BCL2L2-01        --------------------------------------------------
O88996_BCL2L2-01        --------------------------------------------------
Q7TS60_BCL2L2-01        --------------------------------------------------
A0A287D9B3_BCL2L2-      --------------------------------------------------
P70345_BCL2L2-02        --------------------------------------------------
P70345_BCL2L2-01        --------------------------------------------------
A0A452UF16_BCL2L2-      cagaccggggtttcccacgagcccgataccgtgcccggaccaccaactac
A0A452UF16_BCL2L2-      cagaccggggtttcccacgagcccgataccgtgcccggaccaccaactac
A0A4D6NWN1_BCL2L2-      cagaccggggttttccacgagctcgataccgtgcccggaccaccaactac
A0A287ATE4_BCL2L2-      cagaccggggttttccacgagctcgataccgtgcccggaccaccaactac
A0A287ATE4_BCL2L2-      cagaccggggttttccacgagctcgataccgtgcccggaccaccaactac
A0A1U7UJF2_BCL2L2-      cagaccggggtttcccacgagcccgctaccgtgcccggaccaccaattac
A0A2K6GWM6_BCL2L2-      cagaccggggtttcccacgagcccgctaccgtgcccggactaccaactac
A0A2R9A2Q3_BCL2L2-      cagaccggggttttccacgagcccgctaccgcgcccggaccaccaactac
H2Q805_BCL2L2-02        cagaccggggttttccacgagcccgctaccgcgcccggaccaccaactac
A0A2I2YPX6_BCL2L2-      cagaccggggttttccacgagcccgctaccgcgcccggaccaccaactac
A0A2I3GEA7_BCL2L2-      cagaccggggttttccacgagcccgctaccgcgcccggaccaccaactac
A0A096NX09_BCL2L2-      cagaccggggttttccacgagcccgctaccgcgcccggaccaccaactac
A0A2K5V0Q3_BCL2L2-      cagaccggggttttccacgagcccgctaccgcgcccggaccaccaactac
F7G4L5_BCL2L2-02        cagaccggggttttccacgagcccgctaccgcgcccggaccaccaactac
A0A2K6AI25_BCL2L2-      cagaccggggttttccacgagcccgctaccgcgcccggaccaccaactac
A0A2K5MZX9_BCL2L2-      cagaccggggttttccacgagcccgctaccgcgcccggaccaccaactac
A0A2K6EA59_BCL2L2-      cagaccggggttttccacgagcccgctaccgcgcccggaccaccaactac
A0A2K5HEJ9_BCL2L2-      cagaccggggttttccacgagcccgctaccgcgcccggaccaccaactac
A0A2K6ME72_BCL2L2-      cagaccggggttttccacgagcccgctaccgcgcccggaccaccaactac
A0A2K6RW35_BCL2L2-      cagaccggggttttccacgagcccgctaccgcgcccggaccaccaactac
A0A2R8M4C0_BCL2L2-      cagaccggggttttccacgagcccgctaccgcgcacggaccaccaactac
A0A2K5RUN8_BCL2L2-      cagaccggggttttccacgagcccgctaccgggcacggaccaccaactac
A0A2K6TM77_BCL2L2-      cagaccggggttttccacgagcccgctaccgcgcacggaccaccaactac
                                                                          

Q5XGJ4_BCL2L2-01        -----------------------------gtttgccagcaag--------
H3AAS7_BCL2L2-02        -----------------------------ttttgccagcaga--------
H3AAS7_BCL2L2-01        -----------------------------ttttgccagcaga--------
F7G6M3_BCL2L2-01        -----------------------------cttcgcgagcaaa--------
G3WPT1_BCL2L2-01        -----------------------------ctttgccagcaag--------
G3WPT1_BCL2L2-02        -----------------------------ctttgccagcaag--------
G1Q051_BCL2L2-01        -----------------------------ttttgctagcatg--------
G1TV33_BCL2L2-01        -----------------------------ttttgctagcaaa--------
G1P3J2_BCL2L2-01        -----------------------------ttttgctagcaag--------
A0A482LX62_BCL2L2-      -----------------------------------tggatgg--------
A0A1U7RC37_BCL2L2-      aacagctcccgatctcgattctacagcggttttaacagcaggccccgggg
A0A250YBR2_BCL2L2-      -----------------------------ttttgctagcaag--------
A0A250YBR2_BCL2L2-      -----------------------------ttttgctagcaag--------
W5QDH4_BCL2L2-01        aacagttcccgctctcgattctacagtggttttaacagcaggccccgggg
A0A287ATE4_BCL2L2-      -----------------------------ttttgctagcaag--------
A0A3Q9B4M8_BCL2L2-      -----------------------------ttttgctagcaag--------
A0A1U7RC37_BCL2L2-      -----------------------------ttttgctagcaag--------
A0A2I2UAE3_BCL2L2-      -----------------------------ttttgctagcaag--------
M3Y5X5_BCL2L2-01        -----------------------------ttttgctagcaag--------
G1LMC3_BCL2L2-01        -----------------------------ttttgctagcaag--------
A0A452SHI1_BCL2L2-      -----------------------------ttttgctagcaag--------
A0A286XQQ9_BCL2L2-      -----------------------------ttttgctagcaag--------
L8HP19_BCL2L2-02        -----------------------------ttttgctagcaag--------
L8HP19_BCL2L2-01        -----------------------------ttttgctagcaag--------
Q1RMX3_BCL2L2-01        -----------------------------ttttgctagcaag--------
Q05KI8_BCL2L2-01        -----------------------------ttttgctagcaag--------
A0A452ECF0_BCL2L2-      -----------------------------tttcgctagcaag--------
W5QDH4_BCL2L2-02        -----------------------------ttttgc-agaaag--------
H0XR82_BCL2L2-01        -----------------------------ttttgctagcaag--------
A0A2K6GWM6_BCL2L2-      -----------------------------tttcgctagcaag--------
A0A287D9B3_BCL2L2-      --------------------------------------------------
A0A1U7UJF2_BCL2L2-      -----------------------------ttttgctagcaag--------
A0A1S3FYD8_BCL2L2-      -----------------------------ttttgctagcaag--------
A0A2K6TM77_BCL2L2-      -----------------------------ttttgctagcaag--------
A0A2K5CWY6_BCL2L2-      -----------------------------ttttgctagcaag--------
A0A2K5CWY6_BCL2L2-      -----------------------------ttttgctagcaag--------
A0A2K5RUN8_BCL2L2-      -----------------------------ttttgctagcaag--------
A0A2R9A2Q3_BCL2L2-      -----------------------------ttttgctagcaag--------
H2Q805_BCL2L2-01        -----------------------------ttttgctagcaag--------
A0A2I2YPX6_BCL2L2-      -----------------------------ttttgctagcaag--------
A0A2I3GEA7_BCL2L2-      -----------------------------ttttgctagcaag--------
A0A2K5MZX9_BCL2L2-      -----------------------------ttttgctagcaag--------
A0A2K6EA59_BCL2L2-      -----------------------------ttttgctagcaag--------
A0A2K5V0Q3_BCL2L2-      -----------------------------ttttgctagcaag--------
F7G4L5_BCL2L2-01        -----------------------------ttttgctagcaag--------
A0A2K6AI25_BCL2L2-      -----------------------------ttttgctagcaag--------
A0A096NX09_BCL2L2-      -----------------------------ttttgctagcaag--------
A0A2K6RW35_BCL2L2-      -----------------------------ttttgctagcaag--------
A0A2K6RW35_BCL2L2-      -----------------------------ttttgctagcaag--------
A0A2K6ME72_BCL2L2-      -----------------------------ttttgctagcaag--------
A0A0D9RU30_BCL2L2-      -----------------------------ttttgctagcaag--------
A0A2K5HEJ9_BCL2L2-      -----------------------------ttttgctagcaag--------
G3TMU7_BCL2L2-01        -----------------------------ttttgctagcaag--------
O88996_BCL2L2-01        -----------------------------ttttgctagcaag--------
Q7TS60_BCL2L2-01        -----------------------------ttttgctagcaag--------
A0A287D9B3_BCL2L2-      -----------------------------ttttgctagcaag--------
P70345_BCL2L2-02        -----------------------------ttttgctagcaag--------
P70345_BCL2L2-01        -----------------------------ttttgctagcaag--------
A0A452UF16_BCL2L2-      aacagttcccgctctcgattctacagtggttttaacagcaggccccgggg
A0A452UF16_BCL2L2-      aacagttcccgctctcgattctacagtggttttaacagcaggccccgggg
A0A4D6NWN1_BCL2L2-      aacagttcccgctctcgattctacagtggttttaacagcaggccccgggg
A0A287ATE4_BCL2L2-      aacagttcccgctctcgattctacagtggttttaacagcaggccccgggg
A0A287ATE4_BCL2L2-      aacagttcccgctctcgattctacagtggttttaacagcaggccccgggg
A0A1U7UJF2_BCL2L2-      aacagttcccgctctcgattctacagtggttttaacagcaggcctcgggg
A0A2K6GWM6_BCL2L2-      aacagttcccgctctcgattctacagtggttttaacagcaggccccgggg
A0A2R9A2Q3_BCL2L2-      aacagttcccgctctcgattctacagtggttttaacagcaggccccgggg
H2Q805_BCL2L2-02        aacagttcccgctctcgattctacagtggttttaacagcaggccccgggg
A0A2I2YPX6_BCL2L2-      aacagttcccgctctcgattctacagtggttttaacagcaggccccgggg
A0A2I3GEA7_BCL2L2-      aacagttcccgctctcgattctacagtggttttaacagcaggccccgggg
A0A096NX09_BCL2L2-      aacagttcccgctctcgattctacagtggttttaacagcaggccccgggg
A0A2K5V0Q3_BCL2L2-      aacagttcccgctctcgattctacagtggttttaacagcaggccccgggg
F7G4L5_BCL2L2-02        aacagttcccgctctcgattctacagtggttttaacagcaggccccgggg
A0A2K6AI25_BCL2L2-      aacagttcccgctctcgattctacagtggttttaacagcaggccccgggg
A0A2K5MZX9_BCL2L2-      aacagttcccgctctcgattctacagtggttttaacagcaggccccgggg
A0A2K6EA59_BCL2L2-      aacagttcccgctctcgattctacagtggttttaacagcaggccccgggg
A0A2K5HEJ9_BCL2L2-      aacagttcccgctctcgattctacagtggttttaacagcaggccccgggg
A0A2K6ME72_BCL2L2-      aacagttcccgctctcgcttctacagtggttttaacagcaggccccgggg
A0A2K6RW35_BCL2L2-      aacagttcccgctctcgcttctacagtggttttaacagcaggccccgggg
A0A2R8M4C0_BCL2L2-      aacagttcccgctctcgattctacagtggttttaacagcaggccccgggg
A0A2K5RUN8_BCL2L2-      aacagttcccgctctcgattctacagtggttttaacagcaggccccgggg
A0A2K6TM77_BCL2L2-      aacagttcccgctctcgattctacagtggttttaacagcaggccccgggg
                                                                          

Q5XGJ4_BCL2L2-01        -------------------------------------------------t
H3AAS7_BCL2L2-02        -------------------------------------------------t
H3AAS7_BCL2L2-01        -------------------------------------------------t
F7G6M3_BCL2L2-01        -------------------------------------------------t
G3WPT1_BCL2L2-01        -------------------------------------------------t
G3WPT1_BCL2L2-02        -------------------------------------------------t
G1Q051_BCL2L2-01        -------------------------------------------------t
G1TV33_BCL2L2-01        -------------------------------------------------t
G1P3J2_BCL2L2-01        -------------------------------------------------t
A0A482LX62_BCL2L2-      -------------------------------------------------t
A0A1U7RC37_BCL2L2-      tcgagtctacaggggccgggctagagcgacatcatggtattccccttact
A0A250YBR2_BCL2L2-      -------------------------------------------------t
A0A250YBR2_BCL2L2-      -------------------------------------------------t
W5QDH4_BCL2L2-01        tcgcgtctacaggggccgggctagagcgacatcatggtattccccttact
A0A287ATE4_BCL2L2-      -------------------------------------------------t
A0A3Q9B4M8_BCL2L2-      -------------------------------------------------t
A0A1U7RC37_BCL2L2-      -------------------------------------------------t
A0A2I2UAE3_BCL2L2-      -------------------------------------------------t
M3Y5X5_BCL2L2-01        -------------------------------------------------t
G1LMC3_BCL2L2-01        -------------------------------------------------t
A0A452SHI1_BCL2L2-      -------------------------------------------------t
A0A286XQQ9_BCL2L2-      -------------------------------------------------t
L8HP19_BCL2L2-02        -------------------------------------------------t
L8HP19_BCL2L2-01        -------------------------------------------------t
Q1RMX3_BCL2L2-01        -------------------------------------------------t
Q05KI8_BCL2L2-01        -------------------------------------------------t
A0A452ECF0_BCL2L2-      -------------------------------------------------t
W5QDH4_BCL2L2-02        -------------------------------------------------t
H0XR82_BCL2L2-01        -------------------------------------------------t
A0A2K6GWM6_BCL2L2-      -------------------------------------------------t
A0A287D9B3_BCL2L2-      --------------------------------------------------
A0A1U7UJF2_BCL2L2-      -------------------------------------------------t
A0A1S3FYD8_BCL2L2-      -------------------------------------------------t
A0A2K6TM77_BCL2L2-      -------------------------------------------------t
A0A2K5CWY6_BCL2L2-      -------------------------------------------------t
A0A2K5CWY6_BCL2L2-      -------------------------------------------------t
A0A2K5RUN8_BCL2L2-      -------------------------------------------------t
A0A2R9A2Q3_BCL2L2-      -------------------------------------------------t
H2Q805_BCL2L2-01        -------------------------------------------------t
A0A2I2YPX6_BCL2L2-      -------------------------------------------------t
A0A2I3GEA7_BCL2L2-      -------------------------------------------------t
A0A2K5MZX9_BCL2L2-      -------------------------------------------------t
A0A2K6EA59_BCL2L2-      -------------------------------------------------t
A0A2K5V0Q3_BCL2L2-      -------------------------------------------------t
F7G4L5_BCL2L2-01        -------------------------------------------------t
A0A2K6AI25_BCL2L2-      -------------------------------------------------t
A0A096NX09_BCL2L2-      -------------------------------------------------t
A0A2K6RW35_BCL2L2-      -------------------------------------------------t
A0A2K6RW35_BCL2L2-      -------------------------------------------------t
A0A2K6ME72_BCL2L2-      -------------------------------------------------t
A0A0D9RU30_BCL2L2-      -------------------------------------------------t
A0A2K5HEJ9_BCL2L2-      -------------------------------------------------t
G3TMU7_BCL2L2-01        -------------------------------------------------t
O88996_BCL2L2-01        -------------------------------------------------t
Q7TS60_BCL2L2-01        -------------------------------------------------t
A0A287D9B3_BCL2L2-      -------------------------------------------------t
P70345_BCL2L2-02        -------------------------------------------------t
P70345_BCL2L2-01        -------------------------------------------------t
A0A452UF16_BCL2L2-      tcgcgtctacaggggccgggctagagcgacatcatggtattccccttact
A0A452UF16_BCL2L2-      tcgcgtctacaggggccgggctagagcgacatcatggt------ttctgt
A0A4D6NWN1_BCL2L2-      tcgtgtctacaggggccgggctagagcgacatcatggtattccccttact
A0A287ATE4_BCL2L2-      tcgtgtctaca--ggtcaggatag--------------------------
A0A287ATE4_BCL2L2-      tcgtgtctacaggggccgggctagagcgacatcatggtattccccttact
A0A1U7UJF2_BCL2L2-      tcgcgtctacaggggccgggctagagcgacatcatggtattccccttact
A0A2K6GWM6_BCL2L2-      tcgcgtctacaggggccgggctagagcgacatcatggtattccccttact
A0A2R9A2Q3_BCL2L2-      tcgcgtctacaggggccgggctagagcgacatcatggtattccccttact
H2Q805_BCL2L2-02        tcgcgtctacaggggccgggctagagcgacatcatggtattccccttact
A0A2I2YPX6_BCL2L2-      tcgcgtctacaggggccgggctagagcgacatcatggtattccccttact
A0A2I3GEA7_BCL2L2-      tcgcgtctacaggggccgggctagagcgacatcatggtattccccttact
A0A096NX09_BCL2L2-      tcgtgtctacaggggccgggctagagcgacatcatggtattccccttact
A0A2K5V0Q3_BCL2L2-      tcgtgtctacaggggccgggctagagcgacatcatggtattccccttact
F7G4L5_BCL2L2-02        tcgtgtctacaggggccgggctagagcgacatcatggtattccccttact
A0A2K6AI25_BCL2L2-      tcgtgtctacaggggccgggctagagcgacatcatggtattccccttact
A0A2K5MZX9_BCL2L2-      tcgtgtctacaggggccgggctagagcgacatcatggtattccccttact
A0A2K6EA59_BCL2L2-      tcgtgtctacaggggccgggctagagcgacatcatggtattccccttact
A0A2K5HEJ9_BCL2L2-      tcgcgtctacaggggccgggctagagcgacatcatggtattccccttact
A0A2K6ME72_BCL2L2-      tcgcgtctaca--ggtcaggatag--------------------------
A0A2K6RW35_BCL2L2-      tcgcgtctaca--ggtcaggatag--------------------------
A0A2R8M4C0_BCL2L2-      tcgcgtctacaggggccgggctagagcgacatcatggtattccccttact
A0A2K5RUN8_BCL2L2-      tcgcgtctacaggggccgggctagagcgacatcatggtattccccttact
A0A2K6TM77_BCL2L2-      tcgcgtctacaggggccgggctagagcgacatcatggtattccccttact
                                                                          

Q5XGJ4_BCL2L2-01        ga
H3AAS7_BCL2L2-02        aa
H3AAS7_BCL2L2-01        aa
F7G6M3_BCL2L2-01        ga
G3WPT1_BCL2L2-01        ga
G3WPT1_BCL2L2-02        ga
G1Q051_BCL2L2-01        ga
G1TV33_BCL2L2-01        ga
G1P3J2_BCL2L2-01        ga
A0A482LX62_BCL2L2-      ga
A0A1U7RC37_BCL2L2-      aa
A0A250YBR2_BCL2L2-      ga
A0A250YBR2_BCL2L2-      ga
W5QDH4_BCL2L2-01        aa
A0A287ATE4_BCL2L2-      ga
A0A3Q9B4M8_BCL2L2-      ga
A0A1U7RC37_BCL2L2-      ga
A0A2I2UAE3_BCL2L2-      ga
M3Y5X5_BCL2L2-01        ga
G1LMC3_BCL2L2-01        ga
A0A452SHI1_BCL2L2-      ga
A0A286XQQ9_BCL2L2-      ga
L8HP19_BCL2L2-02        ga
L8HP19_BCL2L2-01        ga
Q1RMX3_BCL2L2-01        ga
Q05KI8_BCL2L2-01        ga
A0A452ECF0_BCL2L2-      ga
W5QDH4_BCL2L2-02        --
H0XR82_BCL2L2-01        ga
A0A2K6GWM6_BCL2L2-      ga
A0A287D9B3_BCL2L2-      --
A0A1U7UJF2_BCL2L2-      ga
A0A1S3FYD8_BCL2L2-      ga
A0A2K6TM77_BCL2L2-      ga
A0A2K5CWY6_BCL2L2-      ga
A0A2K5CWY6_BCL2L2-      ga
A0A2K5RUN8_BCL2L2-      ga
A0A2R9A2Q3_BCL2L2-      ga
H2Q805_BCL2L2-01        ga
A0A2I2YPX6_BCL2L2-      ga
A0A2I3GEA7_BCL2L2-      ga
A0A2K5MZX9_BCL2L2-      ga
A0A2K6EA59_BCL2L2-      ga
A0A2K5V0Q3_BCL2L2-      ga
F7G4L5_BCL2L2-01        ga
A0A2K6AI25_BCL2L2-      ga
A0A096NX09_BCL2L2-      ga
A0A2K6RW35_BCL2L2-      ga
A0A2K6RW35_BCL2L2-      ga
A0A2K6ME72_BCL2L2-      ga
A0A0D9RU30_BCL2L2-      ga
A0A2K5HEJ9_BCL2L2-      ga
G3TMU7_BCL2L2-01        ga
O88996_BCL2L2-01        ga
Q7TS60_BCL2L2-01        ga
A0A287D9B3_BCL2L2-      ga
P70345_BCL2L2-02        ga
P70345_BCL2L2-01        ga
A0A452UF16_BCL2L2-      aa
A0A452UF16_BCL2L2-      ag
A0A4D6NWN1_BCL2L2-      aa
A0A287ATE4_BCL2L2-      --
A0A287ATE4_BCL2L2-      aa
A0A1U7UJF2_BCL2L2-      aa
A0A2K6GWM6_BCL2L2-      aa
A0A2R9A2Q3_BCL2L2-      aa
H2Q805_BCL2L2-02        aa
A0A2I2YPX6_BCL2L2-      aa
A0A2I3GEA7_BCL2L2-      aa
A0A096NX09_BCL2L2-      aa
A0A2K5V0Q3_BCL2L2-      aa
F7G4L5_BCL2L2-02        aa
A0A2K6AI25_BCL2L2-      aa
A0A2K5MZX9_BCL2L2-      aa
A0A2K6EA59_BCL2L2-      aa
A0A2K5HEJ9_BCL2L2-      aa
A0A2K6ME72_BCL2L2-      --
A0A2K6RW35_BCL2L2-      --
A0A2R8M4C0_BCL2L2-      aa
A0A2K5RUN8_BCL2L2-      aa
A0A2K6TM77_BCL2L2-      aa
                          

© 1998-2020Legal notice