Dataset for CDS BAX-like of Organism Gopherus evgoodei

[Download (right click)] [Edit] [Sequences] [Repertoires]

3 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A8C4WFJ5_BAX-01       atggc-------ggcagctccgggtggggagagcgagagcg--gccgggg
A0A8C4XXZ5_BAK1-01      atggcctctgggaacagcagcgacccaccagaccgtcatcgacgcaggac
A0A8C4XYC9_BOK-01       atgg-----aggtgctacgccgttcc-----tcggtctttgctgcggagg
                        ****          *  *  **            *     *  ** *   

A0A8C4WFJ5_BAX-01       gggcggcggggccacgtcgg----------------atcaaatcctgcag
A0A8C4XXZ5_BAK1-01      cagtgagaggctcaattcgg-------------aagatcaggtggcccag
A0A8C4XYC9_BOK-01       tgatggaggtttttgatcggtctcccaccgacaaggagctggtgtcccag
                            *   *       ****                * *   *    ***

A0A8C4WFJ5_BAX-01       acgggagcggttctgttgcaggg-------gttcatccgggaccgggtcc
A0A8C4XXZ5_BAK1-01      gagaccgaggaggtgttccggag-------ctatgctttctaccgctacc
A0A8C4XYC9_BOK-01       gcta------aggtgctctgcagagactacatacattcccggctgcttcg
                                     ** *     *        *          * *   * 

A0A8C4WFJ5_BAX-01       agcgctgtggggactcccaggctgtggagctgagccgggcagagctgggg
A0A8C4XXZ5_BAK1-01      ag---------------cagg----agag-ggaagagggcggaggggagg
A0A8C4XYC9_BOK-01       gg---------------ctggcattggct-ggagcaaaccagagcacag-
                         *               * **     *    **      * ***    * 

A0A8C4WFJ5_BAX-01       gggcc-ggagccccccctctgcgatgagaacaccaagcggctcagcgagt
A0A8C4XXZ5_BAK1-01      tgccgatggaccccgagattgcagagatccagc--aggagccgggca-gc
A0A8C4XYC9_BOK-01       ------tgcacccatgcctggcggcagactggctgaggtgtccagcgtgc
                               *  ***       **          *  **  *    **  * 

A0A8C4WFJ5_BAX-01       gcctgcggcggatcgg-ggacgag---ctcgatagca---------acgc
A0A8C4XXZ5_BAK1-01      accagtaac---caggtgggcaggcgcctggccatcatcggagatgacat
A0A8C4XYC9_BOK-01       ttctgcgac---tagg-ggacgag---ctagaatacatccgaccaaacat
                          * *   *     ** ** *  *   ** *    **         **  

A0A8C4WFJ5_BAX-01       cgagctgcagagtatgattga---ccg-----agtgggggcccacgc---
A0A8C4XXZ5_BAK1-01      caacatgcggtatgacgcagagttccggaacatgctgaagaccctgcagc
A0A8C4XYC9_BOK-01       ttac---cggaatattgc------ccg---ccagctgaacatctcactgc
                          *    * *  *           ***      *  *     *   *   

A0A8C4WFJ5_BAX-01       -ccccaagg------------aagtcttcttccgcgtggccgccgagatg
A0A8C4XXZ5_BAK1-01      ccacaaaggac--aatgcct-acgagtacttcactaagatagcctccagc
A0A8C4XYC9_BOK-01       actccgagaccgtggtgactgacgccttcttggcagtagcagc--ccaga
                         * *  **             * *  * ***          **    *  

A0A8C4WFJ5_BAX-01       ttctccgacgggaccttcaac-tggggccgggtcgt-------ggcgctt
A0A8C4XXZ5_BAK1-01      ttgtttgacagcggcattaac-tggggcagggtgat-------tgcgctg
A0A8C4XYC9_BOK-01       t--cttcacagcaggaataacttggggcaaggtcgtgtctctctatgctg
                        *      ** *       *** ******  ***  *          *** 

A0A8C4WFJ5_BAX-01       ttctacttcgcctgcaaactggtgctcaaggctctgtgcacca----agg
A0A8C4XXZ5_BAK1-01      ctggggttcggttaccggatggcgattca-----tgtgtaccagcacggg
A0A8C4XYC9_BOK-01       tggctgctgggctagctgtggac-------------tgcgtcagacaggc
                               * *  *       *               **   **     * 

A0A8C4WFJ5_BAX-01       tccccgagc--tggtacggaccatcgtgggctggacgttggagtacct--
A0A8C4XXZ5_BAK1-01      gtgaccggc-ttcctccggagcattgctcgctacgtggcagaattcgtgc
A0A8C4XYC9_BOK-01       ccagccagcaatggtgcataccattgtggactgcctgggagagtttgt--
                            *  **  *  * *  * *** *    **    *   ** *   *  

A0A8C4WFJ5_BAX-01       -------ccgggatcatgtgctggcctggatccaggcccagggaggatgg
A0A8C4XXZ5_BAK1-01      tccgcaaccg----catcgcccag--tggattgctgaccaaggaggatgg
A0A8C4XYC9_BOK-01       -------ccg----caagaccttg--gtgacg--tggctgaagaggagag
                               ***    **    *  *    **     * *    *****  *

A0A8C4WFJ5_BAX-01       gacggcctcctctcctacttcggcacacctacctggcagacc---atcac
A0A8C4XXZ5_BAK1-01      gt--ggcagcactggagttggataatgtttacgtattgtaca-tgat---
A0A8C4XYC9_BOK-01       gc--ggctgggcagacatcacaaaatgt----gtggtgaatactgatccc
                        *   * *    *            *        *     *     **   

A0A8C4WFJ5_BAX-01       catcttcgccgcc---------ggcgtgctcaccgcctccct-------c
A0A8C4XXZ5_BAK1-01      ---------------------gggggtgttggtcgtggtcctgctgggtc
A0A8C4XYC9_BOK-01       agccttcgctcccattggctcgtggctgctatttgtagcttt----ggtc
                                               *  ** *    *      *       *

A0A8C4WFJ5_BAX-01       accatctggaagatgtc-----------------------atag
A0A8C4XXZ5_BAK1-01      atttggtggtacgacgcttcttcagccc------------atga
A0A8C4XYC9_BOK-01       acttcctgaaggccatcttctttgtgctgttaccagagagatga
                        *     **        *                       **  

© 1998-2023Legal notice