Dataset for CDS BCL-2-like of organism Electrophorus electricus

[Download (right click)] [Edit] [Sequences] [Repertoires]

4 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A4W4H9I6_MCL1-01      atgattaatccacaagatatgtgttacagcaaggagagctccggaccagg
A0A4W4F1X6_MCL1-01      atgagtatgacg-acgatgaagcgcacgacagcgatagggctg-------
A0A4W4F7Z4_BCL2-01      at--ggcaaacg-aaaatctcgatcataatcgtaacatagtagaaaagta
A0A4W4GHX3_BCL2L1-      at--gtcgtac-------------tacaacagagaactggtcatgtacta
                        **        *              *        *               

A0A4W4H9I6_MCL1-01      aatgagacccgtgctatctt-taggaatcacctctg-----acaaaaggg
A0A4W4F1X6_MCL1-01      -------------ctgtgtaacggggctcaacacggagtgaaggacagct
A0A4W4F7Z4_BCL2-01      tctcaaccacaaactgtcgaaaaatgggta--catgtgggaattccattc
A0A4W4GHX3_BCL2L1-      tatcaggtacaaactctcccagaggaactatccctgtagccacatcgggc
                                     ** *            *     *     *        

A0A4W4H9I6_MCL1-01      tcattggcgaaggctcgttaccaaattcccccgagtcagactgcgaggag
A0A4W4F1X6_MCL1-01      tcgtcctcgggg---------tgcgtcccacaatggcggcggaggacgag
A0A4W4F7Z4_BCL2-01      gcgt----gaga---------cggacc---ctgaccctgcctctaatggc
A0A4W4GHX3_BCL2L1-      tcacagaagata---------tgggccagactgaggggggtccggaggga
                         *      *                     *       *      * *  

A0A4W4H9I6_MCL1-01      ttgagcgta-gttcg-----------------------------cttcac
A0A4W4F1X6_MCL1-01      ctggacggatgcgcggaggacacggatgggtggcccctcaaacccgccag
A0A4W4F7Z4_BCL2-01      tttgacg---ctccgga----gcgg-------------cga---tgtcaa
A0A4W4GHX3_BCL2L1-      gaggatg---gtgcggaggccgcgg-------------caa---cgccga
                              *      **                                *  

A0A4W4H9I6_MCL1-01      ggagggcagaactctggagaacgacacgcg--------------------
A0A4W4F1X6_MCL1-01      gcacggtagaggcttgacactcgacacccggttccctcagtcttcaaacg
A0A4W4F7Z4_BCL2-01      gc-aagcacagacgaggaa-------------------------------
A0A4W4GHX3_BCL2L1-      ---cggcagtggc----ca-------------------------------
                             * *                                          

A0A4W4H9I6_MCL1-01      ---agaaatcattaacgattcgcttctcgagcttac----aggccgttct
A0A4W4F1X6_MCL1-01      cagacggctctctgccca----cttcccccgactcccaggagactctccc
A0A4W4F7Z4_BCL2-01      ---gagaccgttcaccga---gccccacgcg-----c---gccccttccc
A0A4W4GHX3_BCL2L1-      ---atggctctacggcaa---gccccacccggttgcc---ggcctcgcct
                                       * *    *  * *  *            *    * 

A0A4W4H9I6_MCL1-01      aattactacagtcgtcataggaaggtcg-----taggaacaatgaagcgc
A0A4W4F1X6_MCL1-01      gg--acttcaggtctgatctggacgcggagactcgggagcttctcggata
A0A4W4F7Z4_BCL2-01      ga--cccgtatgct------------------------gctctccacagg
A0A4W4GHX3_BCL2L1-      gg--gccaagggcggcgaacggaggcgggggactggaagccgtgaaggag
                             *                                 *          

A0A4W4H9I6_MCL1-01      gttgtaaacagcct------------------------------------
A0A4W4F1X6_MCL1-01      cttttatcggacttacacaggacttccgcacaggagaactaaactcagcg
A0A4W4F7Z4_BCL2-01      gttttgcgcgaggc------------------------------------
A0A4W4GHX3_BCL2L1-      gccctgcgggactc------------------------------------

A0A4W4H9I6_MCL1-01      -----------------------ggtggagaagc-----------atgaa
A0A4W4F1X6_MCL1-01      ctctgcccacgcttacgagggtcgtgggcgatgtgatctgtaagcaccgg
A0A4W4F7Z4_BCL2-01      ---------cggcgacga-----gctggaaagattat--------atcag
A0A4W4GHX3_BCL2L1-      ---------ggccaacga-----gtttgagctgcgct--------actcg
                                               *   *                 *    

A0A4W4H9I6_MCL1-01      cttgcttataaaggtatgattgtgaaactgaatttggaggagagaggcga
A0A4W4F1X6_MCL1-01      attgcatataatggtatggtacagaagctgcagatggaggagcagagtga
A0A4W4F7Z4_BCL2-01      ccggactttgccgagatgtcaaagcagttacacct-aacatctatcacgg
A0A4W4GHX3_BCL2L1-      cgcgcattcagcgacctgtcctcacagctgcacat-cacgccagccacgg
                           *  *     *   **       *  *  *  *  *          * 

A0A4W4H9I6_MCL1-01      agatatgcgtgtg-attacgacagtagctaaggagatgttcagtgatggc
A0A4W4F1X6_MCL1-01      cgacctggaggtt-gtgagcactgtggccaagagcatgttcagtgacggc
A0A4W4F7Z4_BCL2-01      cgcagagaaggttcacagctgtcatagacgaa---ctgtttagggacggg
A0A4W4GHX3_BCL2L1-      cgtaccagagtttcgagagcgtcatggacgag---gtgttccgcagtggc
                         *         *            * *   *     ****  *    ** 

A0A4W4H9I6_MCL1-01      aaaaccaactggggccgcattgccagtttgctggcctttgggtccatggt
A0A4W4F1X6_MCL1-01      atgactaactggggccgtgtggccagcctggtggcatttggcgcggtgct
A0A4W4F7Z4_BCL2-01      gt---caattggggtcggattattgcgtttttcgagttcggagcgtcggt
A0A4W4GHX3_BCL2L1-      gt---caattggggccgaatcgtgggcctgtttgccttcggtggggccct
                              ** ***** **  *        *  * *  ** **        *

A0A4W4H9I6_MCL1-01      gtgcaaatatcataatgagaagg-gccaaggccaccgtgtgcgtctggtg
A0A4W4F1X6_MCL1-01      gtgtg-agagcctgaaggagagtgggagagatcactgtgtcgacaccgta
A0A4W4F7Z4_BCL2-01      gtgtgtagaatgtgtaaataaagagatgagtgcgcag-gtggataacatt
A0A4W4GHX3_BCL2L1-      ttgcgtggagtgtgtggagaaggagatgagtccactg-gtggggcgcatt
                         **     *   *       *   *   **  * * * **        * 

A0A4W4H9I6_MCL1-01      ggagaagaaatctcctcttatc----tcctttctgacaaaagggactggc
A0A4W4F1X6_MCL1-01      gcccatcgcatctcatcctacc----tcaccacctaccagcatgaatggc
A0A4W4F7Z4_BCL2-01      gcgggctggatgacggagtatttgaatggaccactgca--cagc--tgga
A0A4W4GHX3_BCL2L1-      gccgagtggatgaccgtctact----tagacaaccacatccagccgtgga
                        *        **  *    **      *         *         *** 

A0A4W4H9I6_MCL1-01      tattgaaaaataaagcatgggatggttttgtggatttttttcatgtt---
A0A4W4F1X6_MCL1-01      tcctcaacaacaagtcctgggatggctttaaagaatttttccaagtg---
A0A4W4F7Z4_BCL2-01      tccaggagaacggtggatgggatgccttcatggagctgtatggcagg---
A0A4W4GHX3_BCL2L1-      tccaggagcaaggaggatgggagcactttgcggagatcttcgggaaggac
                        *     *  *       *****    **    **  * *           

A0A4W4H9I6_MCL1-01      -----------------tcggatcctg---agtcgaaactga--------
A0A4W4F1X6_MCL1-01      -----------------gaggatccag---agtct------gtggttc--
A0A4W4F7Z4_BCL2-01      --------------caaaaggactccg----ttttc----agtagttctt
A0A4W4GHX3_BCL2L1-      gcagcagcagagaacagaaggtcgcaggaaagcttcaagaaatggctgtt
                                           **   * *                       

A0A4W4H9I6_MCL1-01      ggaatgcgttaatgaccattgctactgtggcagggattggggctg-----
A0A4W4F1X6_MCL1-01      ggaatgctttgatggcagtggcaggatttgctggtcttggggcag--ggc
A0A4W4F7Z4_BCL2-01      ggccttccatagtgacagtcttcagcttggcagcactgggagcagtcggc
A0A4W4GHX3_BCL2L1-      gg----ctggaatgaccctgttca---------caggggtcgtggtaggc
                        **    *     ** *  *                   *  *  *     

A0A4W4H9I6_MCL1-01      ----------gaattgccttttttagaagata------a
A0A4W4F1X6_MCL1-01      t----------agctctcctgat---gaggtg------a
A0A4W4F7Z4_BCL2-01      ttcaccataggagcctacttagctcagaaatg------a
A0A4W4GHX3_BCL2L1-      t------------ccctctttgctcagaagcgcctgtaa
                                         * *       *          *

© 1998-2022Legal notice