Dataset for CDS BCL-2-like of organism Electrophorus electricus

[Download (right click)] [Alignment] [Repertoires]

4 sequence(s)

>gnl|bcl2dbcds|A0A4W4F1X6_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Electrophorus electricus GN=MCL-1 (length=795 residues).
atgagtatgacgacgatgaagcgcacgacagcgatagggctgctgtgtaacggggctcaacacggagtgaaggacagctt
cgtcctcggggtgcgtcccacaatggcggcggaggacgagctggacggatgcgcggaggacacggatgggtggcccctca
aacccgccaggcacggtagaggcttgacactcgacacccggttccctcagtcttcaaacgcagacggctctctgcccact
tcccccgactcccaggagactctcccggacttcaggtctgatctggacgcggagactcgggagcttctcggatactttta
tcggacttacacaggacttccgcacaggagaactaaactcagcgctctgcccacgcttacgagggtcgtgggcgatgtga
tctgtaagcaccggattgcatataatggtatggtacagaagctgcagatggaggagcagagtgacgacctggaggttgtg
agcactgtggccaagagcatgttcagtgacggcatgactaactggggccgtgtggccagcctggtggcatttggcgcggt
gctgtgtgagagcctgaaggagagtgggagagatcactgtgtcgacaccgtagcccatcgcatctcatcctacctcacca
cctaccagcatgaatggctcctcaacaacaagtcctgggatggctttaaagaatttttccaagtggaggatccagagtct
gtggttcggaatgctttgatggcagtggcaggatttgctggtcttggggcagggctagctctcctgatgaggtga
>gnl|bcl2dbcds|A0A4W4F7Z4_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Electrophorus electricus GN=BCL-2 (length=672 residues).
atggcaaacgaaaatctcgatcataatcgtaacatagtagaaaagtatctcaaccacaaactgtcgaaaaatgggtacat
gtgggaattccattcgcgtgagacggaccctgaccctgcctctaatggctttgacgctccggagcggcgatgtcaagcaa
gcacagacgaggaagagaccgttcaccgagccccacgcgcgccccttcccgacccgtatgctgctctccacagggttttg
cgcgaggccggcgacgagctggaaagattatatcagccggactttgccgagatgtcaaagcagttacacctaacatctat
cacggcgcagagaaggttcacagctgtcatagacgaactgtttagggacggggtcaattggggtcggattattgcgtttt
tcgagttcggagcgtcggtgtgtgtagaatgtgtaaataaagagatgagtgcgcaggtggataacattgcgggctggatg
acggagtatttgaatggaccactgcacagctggatccaggagaacggtggatgggatgccttcatggagctgtatggcag
gcaaaaggactccgttttcagtagttcttggccttccatagtgacagtcttcagcttggcagcactgggagcagtcggct
tcaccataggagcctacttagctcagaaatga
>gnl|bcl2dbcds|A0A4W4GHX3_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Electrophorus electricus GN=BCL2L1 (length=702 residues).
atgtcgtactacaacagagaactggtcatgtactatatcaggtacaaactctcccagaggaactatccctgtagccacat
cgggctcacagaagatatgggccagactgaggggggtccggagggagaggatggtgcggaggccgcggcaacgccgacgg
cagtggccaatggctctacggcaagccccacccggttgccggcctcgcctgggccaagggcggcgaacggaggcggggga
ctggaagccgtgaaggaggccctgcgggactcggccaacgagtttgagctgcgctactcgcgcgcattcagcgacctgtc
ctcacagctgcacatcacgccagccacggcgtaccagagtttcgagagcgtcatggacgaggtgttccgcagtggcgtca
attggggccgaatcgtgggcctgtttgccttcggtggggccctttgcgtggagtgtgtggagaaggagatgagtccactg
gtggggcgcattgccgagtggatgaccgtctacttagacaaccacatccagccgtggatccaggagcaaggaggatggga
gcactttgcggagatcttcgggaaggacgcagcagcagagaacagaaggtcgcaggaaagcttcaagaaatggctgttgg
ctggaatgaccctgttcacaggggtcgtggtaggctccctctttgctcagaagcgcctgtaa
>gnl|bcl2dbcds|A0A4W4H9I6_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Electrophorus electricus GN=MCL-1 (length=693 residues).
atgattaatccacaagatatgtgttacagcaaggagagctccggaccaggaatgagacccgtgctatctttaggaatcac
ctctgacaaaagggtcattggcgaaggctcgttaccaaattcccccgagtcagactgcgaggagttgagcgtagttcgct
tcacggagggcagaactctggagaacgacacgcgagaaatcattaacgattcgcttctcgagcttacaggccgttctaat
tactacagtcgtcataggaaggtcgtaggaacaatgaagcgcgttgtaaacagcctggtggagaagcatgaacttgctta
taaaggtatgattgtgaaactgaatttggaggagagaggcgaagatatgcgtgtgattacgacagtagctaaggagatgt
tcagtgatggcaaaaccaactggggccgcattgccagtttgctggcctttgggtccatggtgtgcaaatatcataatgag
aagggccaaggccaccgtgtgcgtctggtgggagaagaaatctcctcttatctcctttctgacaaaagggactggctatt
gaaaaataaagcatgggatggttttgtggatttttttcatgtttcggatcctgagtcgaaactgaggaatgcgttaatga
ccattgctactgtggcagggattggggctggaattgccttttttagaagataa
© 1998-2020Legal notice