Dataset for CDS BAX-like of Organism Chrysolophus pictus

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A8C3LPV9_BOK-01       atggaagtg----------------ctgcgtcgctcctccgtctttgctg
A0A8C3LWT0_BAK1-01      atggaagggaatgagggggacccacccagggcccacggacgccggggcag
                        ******* *                *   * * * *   ** *   ** *

A0A8C3LPV9_BOK-01       cagaggtgatggaggtgttcgacaggtctcccactgacaaggagcttgtg
A0A8C3LWT0_BAK1-01      caatg--ggcgcaggccgtc-acaagagaccgattca-gaggaccaggtg
                        **  *  *  * ***   ** *** *   ** * * *  **** *  ***

A0A8C3LPV9_BOK-01       tcc---caagccaaggccctctgcagggactacatcaactcgaggctgat
A0A8C3LWT0_BAK1-01      gcccagcagaccgaggaggtgttccggagctacaccttct----accgct
                         **   **  ** ***   * * * **  ***** *  **     * * *

A0A8C3LPV9_BOK-01       ccgtgcaggcgtcagctggagcaaa------------cctgagcaca---
A0A8C3LWT0_BAK1-01      accagcaggagagagaggagggaggggaggaggtgcccatggacccagag
                         *  ***** *  **  *  * *              * **  * **   

A0A8C3LPV9_BOK-01       -------ataccc-------------cagtgcctggcggcaaactggctg
A0A8C3LWT0_BAK1-01      atcttggagatccagcaggagctgggcagcaccgggagccaggtgggc--
                               * * **             ***  ** ** * **    ***  

A0A8C3LPV9_BOK-01       aggtgtct-gccatcctgctgcgcctgggggatgagctggaatacattcg
A0A8C3LWT0_BAK1-01      aggcgcctggccat---------cattggggacga---------------
                        *** * ** *****         * * ***** **               

A0A8C3LPV9_BOK-01       ccccaatgtgtatcgcaacatcg---cccgccagctgaacatctcgctgc
A0A8C3LWT0_BAK1-01      catcaacaagcggtacgacgcggagttccgccatatgctcaagtcattgc
                        *  ***   *     * **   *    ******  **  **  **  ***

A0A8C3LPV9_BOK-01       actc------ggagacggtggtgacggatgctttcctggccgtggctgcg
A0A8C3LWT0_BAK1-01      agcccaccaaggaga--atgcctacgagtacttcacc-accatagcctcc
                        *  *      *****   **   ***  * ***  *   ** * **  * 

A0A8C3LPV9_BOK-01       cagatcttcactgcaggcataacatggggcaaggtggtgtctctctacgc
A0A8C3LWT0_BAK1-01      agcttgttcgatagcggcattaactggggccgggtgatcgcact------
                            * ***  *   ***** *  ******  **** *  * **      

A0A8C3LPV9_BOK-01       cgtggcagcggggctggcagtggactgtgtgcgtcatgcacagccagcca
A0A8C3LWT0_BAK1-01      -------gctgggct-----tcggttac--------tgcatggccatcca
                               ** *****     * *  *          ****  **** ***

A0A8C3LPV9_BOK-01       tggtc-----cacaccatcgtggactgcctgggggagtttgtccgcaa--
A0A8C3LWT0_BAK1-01      cgtctaccagcacggcatcacgggtttcctgcgccgcatcgcccgctatg
                         *        ***  ****  **  * **** *     * * **** *  

A0A8C3LPV9_BOK-01       -----gacct-----------------tggtgacgtggctgaagaggcga
A0A8C3LWT0_BAK1-01      tcaccgacttcatgctgcgcaaccgcatcgcgcggtggatcgcccagcag
                             *** *                 * * *  **** *      **  

A0A8C3LPV9_BOK-01       ggaggctgggcagacat---------------------caccaagtgcgt
A0A8C3LWT0_BAK1-01      ggaggatgggtggctgcactcgatctggacaatgtttacatgaagtacat
                        ***** ****  *                         **  **** * *

A0A8C3LPV9_BOK-01       ggtg--agcaccgaccccagtctccgctcacactggctcgtggccgccgt
A0A8C3LWT0_BAK1-01      gctggcggtgctggccctggt--------------gatggtgg--gccat
                        * **   *  * * ***  **              * * ****  *** *

A0A8C3LPV9_BOK-01       ctgcagctttgggcacttcctcaaggccatcttcttcgtattgctgcctg
A0A8C3LWT0_BAK1-01      ttagtggtac-gacgcttcttcaggccc----------------------
                         *   * *   * * **** *** * **                      

A0A8C3LPV9_BOK-01       agagatga
A0A8C3LWT0_BAK1-01      -----tga
                             ***

© 1998-2023Legal notice