Dataset for CDS BCL-2-like of organism Anas platyrhynchos

[Download (right click)] [Edit] [Sequences] [Repertoires]

3 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A8B9SWV2_MCL1-01      atgtt---------------------------------------------
A0A8B9SFH3_BCL2-01      atggctcatcccgggagaagaggctacgataaccgggagatagtgctgaa
A0A8B9SM69_BCL2L1-      atgtc------------------cagcggcaaccgggagctggtgatcga
                        ***                                               

A0A8B9SWV2_MCL1-01      ------------cgccctgccgcgcaacgccctca---------------
A0A8B9SFH3_BCL2-01      gtacatccactataaactctcgcagaggggatacgactgg-----gctgc
A0A8B9SM69_BCL2L1-      ctttgtctcctacaagctgtcgcagaaaggctacagctggagccagctgg
                                        **  ***  *  *    *                

A0A8B9SWV2_MCL1-01      --------------------------------tcggcttcaacctctact
A0A8B9SFH3_BCL2-01      cgg-------cgaggacagggcgcccgcgcctacggctctcgctcctgct
A0A8B9SM69_BCL2L1-      aggaagaggatgagaacagg------------actgagttggcttccgag
                                                         * *      *  *    

A0A8B9SWV2_MCL1-01      gcggcggcgg-------caccggg-----------------cccggaggg
A0A8B9SFH3_BCL2-01      gctgctgcggttgctgctgctgggactccctcccgccaccgccccgccgg
A0A8B9SM69_BCL2L1-      gccgccgcgg-tgct--caacgggagcccctcctggcaccccccagccgg
                        ** ** ****           ***                 *** *  **

A0A8B9SWV2_MCL1-01      ggcggcg-----gaggcggagggggcccggcctcaccg--------gggg
A0A8B9SFH3_BCL2-01      gctgctgtccccgcaccccgagccccccggctcggctgctgctagcgagg
A0A8B9SM69_BCL2L1-      ccaggta-----gtgaacggcgccgccgtgcaccggagcagc---ctgga
                           *        *        *   **  **      *          * 

A0A8B9SWV2_MCL1-01      ggaccccgaaagcg---------------------------ctggaaacg
A0A8B9SFH3_BCL2-01      cgcccccgggcgaggggctgcgccccgcgccccccgtggtccacctcgcc
A0A8B9SM69_BCL2L1-      ggtccacgagctcg----ttcaatcgg------ccgccgtccggcaggct
                         * ** **     *                           *      * 

A0A8B9SWV2_MCL1-01      ttgaggagggtgggggacggagtcctggagaaacacgagctggccttcca
A0A8B9SFH3_BCL2-01      ctgcgccaggccggggatgaattctcccgtcgctaccagcgggacttcgc
A0A8B9SM69_BCL2L1-      ctgcgcgaagccggggacgaattcgagctgaggtaccgccgggctttcag
                         ** *    *  ***** * * **          **   * **  ***  

A0A8B9SWV2_MCL1-01      aggaatgcttcggaagctggaaatcaagaaggaggaggacctgcagg---
A0A8B9SFH3_BCL2-01      ccagatgtccggccagctgcacctgacgcccttcacgg----ccagaggc
A0A8B9SM69_BCL2L1-      cgacctcacctcccagctccacatcacccccggcacggcttaccaga---
                             *        ****  *  * *          **     ***    

A0A8B9SWV2_MCL1-01      -ccgtgggtgaggtggcggcccacctcttcagcgacggggtgaccaactg
A0A8B9SFH3_BCL2-01      cgcttcgtggccgtggtggaggagctcttccgagacggggtg---aactg
A0A8B9SM69_BCL2L1-      -gcttcgagcaggtggtgaacgaacttttccgcgatggggtg---aactg
                          * * *     **** *    * ** *** * ** ******   *****

A0A8B9SWV2_MCL1-01      ggggcgcgtcgtcaccctcatctccttcggcgccttcgtcgcccggcacc
A0A8B9SFH3_BCL2-01      gggccggatcgtggccttcttcgagttcgg------cggcgtcatgtgcg
A0A8B9SM69_BCL2L1-      ggggcgcatcgtggccttcttctccttcgg------aggggcgctgtgcg
                        *** **  ****  ** ** **   *****       *  *    *  * 

A0A8B9SWV2_MCL1-01      tgaaaagcgtaaagcaggaga---------------aaagcatcggctcc
A0A8B9SFH3_BCL2-01      tggagagtgtcaaccgggagatgtctcccctggtggacagcatcg-----
A0A8B9SM69_BCL2L1-      tggagagcgtggacaaggagatgagggtcctggtggggcgcatcg-----
                        ** * ** **  *   *****                  ******     

A0A8B9SWV2_MCL1-01      ctggccaggatcatcaccgac----gccctcgtctcgtccaaacgcgagt
A0A8B9SFH3_BCL2-01      -ccgcctggatgaccgagtacctgaaccggcacctg-------cacaact
A0A8B9SM69_BCL2L1-      -tggcctggatgaccacctacctgagcgaccacctc-------gacccct
                           *** **** * *    **     *   *  **          *   *

A0A8B9SWV2_MCL1-01      ggctcgtgagccagggaggctgggagggtttcgtcgactttttccga---
A0A8B9SFH3_BCL2-01      ggatccaggacaacggaggctgggatgccttcgtggagttgtatggcaac
A0A8B9SM69_BCL2L1-      ggatccaggagaacggcggatgggagcggtttgtggacctctacgggaac
                        ** **  *    * ** ** *****    ** ** **  * *   *    

A0A8B9SWV2_MCL1-01      -----------------gtggaagacctggaaggc-----------agca
A0A8B9SFH3_BCL2-01      agt------------atgagg-------------cctttgttcgatttct
A0A8B9SM69_BCL2L1-      gatgctgctgcggagatgaggaagggccaggaaaccttcaacaaatggct
                                         * **             *             * 

A0A8B9SWV2_MCL1-01      tcaggaacgtgctgatggc--gttcgcaggag--tggctggactgggagc
A0A8B9SFH3_BCL2-01      cctggatctctctgaagac----tatcctgagtttggttctggtgggagc
A0A8B9SM69_BCL2L1-      cctga------ccggggccacggtggccggag--tgctcctgctgggatc
                         * *       * *  * *    *  *  ***  **       ***** *

A0A8B9SWV2_MCL1-01      gag-------cttg--gcctacatgatccg---gtga
A0A8B9SFH3_BCL2-01      ttgcatcactcttggcgcttatctcggacataagtag
A0A8B9SM69_BCL2L1-      ----------cctg--------ctgagccgcaagtga
                                  * **         *    *    **  

© 1998-2023Legal notice