Dataset for CDS BOK of Organism Electrophorus electricus

[Download (right click)] [Edit] [Sequences] [Repertoires]

4 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A4W4EE96_BOK-01      atgaa------------------ggggatggaggtgttgcgccgctcgtc
A0A4W4H2R3_BOK-02      -----------------------------------------attctaatg
A0A4W4H2R3_BOK-01      atgaa------------------------------------ctccttcaa
A0A4W4H2R3_BOK-03      atgaatcgggtatttttcagtgaacaaataactgggtcgttttccttgac
                                                                   **    

A0A4W4EE96_BOK-01      ggtgttcgcagcagaagtgatggaggtgtttgatcgctctccgacagaca
A0A4W4H2R3_BOK-02      ctgcaacgc-atgaatgaaatggaattgttcaaccgaactttcacggaca
A0A4W4H2R3_BOK-01      acgcagtaaaataaaacagatggaattgttcaaccgaactttcacggaca
A0A4W4H2R3_BOK-03      gttcgtcgctgtggtggagatggaattgttcaaccgaactttcacggaca
                                          *****  ****  * **  **   ** ****

A0A4W4EE96_BOK-01      aagagctggtctctcaatccaaggtgctgtgtagagactacattcactcg
A0A4W4H2R3_BOK-02      gagatctagtttcccagtccatgatgctttgtaggtacttcatgtgctct
A0A4W4H2R3_BOK-01      gagatctagtttcccagtccatgatgctttgtaggtacttcatgtgctct
A0A4W4H2R3_BOK-03      gagatctagtttcccagtccatgatgctttgtaggtacttcatgtgctct
                        *** ** ** ** ** **** * **** *****  *** ***   *** 

A0A4W4EE96_BOK-01      aggcttagtcgcattggatttggatggtctaagcctgaccatggactgtc
A0A4W4H2R3_BOK-02      cgaatcattcgggaaggactcagttggtcaaaagtggaacctggtctacc
A0A4W4H2R3_BOK-01      cgaatcattcgggaaggactcagttggtcaaaagtggaacctggtctacc
A0A4W4H2R3_BOK-03      cgaatcattcgggaaggactcagttggtcaaaagtggaacctggtctacc
                        *  * * ***    *** *  * ***** **    ** * *** **  *

A0A4W4EE96_BOK-01      --ttccggaggga-cactcggagaagtctcgtctgtccttctctggttag
A0A4W4H2R3_BOK-02      agccccagatggagcgcttggagatgtattaagggtgcttcttaagttag
A0A4W4H2R3_BOK-01      agccccagatggagcgcttggagatgtattaagggtgcttcttaagttag
A0A4W4H2R3_BOK-03      agccccagatggagcgcttggagatgtattaagggtgcttcttaagttag
                           ** ** *** * ** ***** ** *     ** *****   *****

A0A4W4EE96_BOK-01      gtgatgagctagaatacttgcgccccaatttgtatcgcaacgtggctcgc
A0A4W4H2R3_BOK-02      gtgatgaactggattacttgcagccatacttgtatcgaaatgttgcaaag
A0A4W4H2R3_BOK-01      gtgatgaactggattacttgcagccatacttgtatcgaaatgttgcaaag
A0A4W4H2R3_BOK-03      gtgatgaactggattacttgcagccatacttgtatcgaaatgttgcaaag
                       ******* ** ** *******  **  * ******** ** ** **    

A0A4W4EE96_BOK-01      cagctgaatatcaccgttgcttcagagagtgtggtttctgacgcgttcct
A0A4W4H2R3_BOK-02      cagctcagaatatctgtggcaacggagaccatggtgatagatgcatttct
A0A4W4H2R3_BOK-01      cagctcagaatatctgtggcaacggagaccatggtgatagatgcatttct
A0A4W4H2R3_BOK-03      cagctcagaatatctgtggcaacggagaccatggtgatagatgcatttct
                       ***** *  **  * ** **  * ****   ****    ** ** ** **

A0A4W4EE96_BOK-01      tgccgtagctgcggaaatattctccaca----------------------
A0A4W4H2R3_BOK-02      atctgtagcaacagagatcctctccttgggtaatagagaccttctgcctc
A0A4W4H2R3_BOK-01      atctgtagcaacagagatcctctccttg----------------------
A0A4W4H2R3_BOK-03      atctgtagcaacagagatcctctccttg----------------------
                         * *****  * ** **  *****                         

A0A4W4EE96_BOK-01      -----------ggggtcacatggggtaagattgtgtctctctatgcggtg
A0A4W4H2R3_BOK-02      tgcctcccttaggaatcacatggggtaaggtggtggccatctttgcagtc
A0A4W4H2R3_BOK-01      -----------ggaatcacatggggtaaggtggtggccatctttgcagtc
A0A4W4H2R3_BOK-03      -----------ggaatcacatggggtaaggtggtggccatctttgcagtc
                                  **  ************** * *** *  *** *** ** 

A0A4W4EE96_BOK-01      gctggagctttggcggtggactgcgttcgctatggcaacccagccatggt
A0A4W4H2R3_BOK-02      gcaggaggccttgcagtggactgtgtgagacagggccatccagccatgct
A0A4W4H2R3_BOK-01      gcaggaggccttgcagtggactgtgtgagacagggccatccagccatgct
A0A4W4H2R3_BOK-03      gcaggaggccttgcagtggactgtgtgagacagggccatccagccatgct
                       ** ****   * ** ******** **  *  * *** * ********* *

A0A4W4EE96_BOK-01      tcatgccattgtggattgcatgggagaattcgtccgcaagagcctagtgt
A0A4W4H2R3_BOK-02      gcacaccatagtggagagtcttggggagctagttgggaagagcctggcat
A0A4W4H2R3_BOK-01      gcacaccatagtggagagtcttggggagctagttgggaagagcctggcat
A0A4W4H2R3_BOK-03      gcacaccatagtggagagtcttggggagctagttgggaagagcctggcat
                        **  **** *****  *  * ** **  * **  * ******** *  *

A0A4W4EE96_BOK-01      cctggttaaagaagagaggaggatggactgacatcacaaagtgcgtagtc
A0A4W4H2R3_BOK-02      cctggcttaagaagagaggaggatggggggacatttcaaagtgtgtgaca
A0A4W4H2R3_BOK-01      cctggcttaagaagagaggaggatggggggacatttcaaagtgtgtgaca
A0A4W4H2R3_BOK-03      cctggcttaagaagagaggaggatggggggacatttcaaagtgtgtgaca
                       ***** * ******************   *****  ******* **    

A0A4W4EE96_BOK-01      aacacagaccccagcttccgttcccattggttgatggtgacagcctgcac
A0A4W4H2R3_BOK-02      agcttggacaatactgcacaataccattggttatcagcagttgtgtcaac
A0A4W4H2R3_BOK-01      agcttggacaatactgcacaataccattggttatcagcagttgtgtcaac
A0A4W4H2R3_BOK-03      agcttggacaatactgcacaataccattggttatcagcagttgtgtcaac
                       * *   ***   *     *  * *********    *     *  *  **

A0A4W4EE96_BOK-01      gtgcgtacactacctgaaggccgtggtcttctatctgctgagggagaaat
A0A4W4H2R3_BOK-02      ctggagacaccttgtgaagactatgtatgtctacctaatgaagtag----
A0A4W4H2R3_BOK-01      ctggagacaccttgtgaagactatgtatgtctacctaatgaagtag----
A0A4W4H2R3_BOK-03      ctggagacaccttgtgaagactatgtatgtctacctaatgaagtag----
                        **   ****    ***** *  **    **** **  *** * **    

A0A4W4EE96_BOK-01      ga
A0A4W4H2R3_BOK-02      --
A0A4W4H2R3_BOK-01      --
A0A4W4H2R3_BOK-03      --
                         

© 1998-2023Legal notice