Dataset for CDS MCL-1 of organism Strix occidentalis caurina

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|A0A8D0FVP8_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Strix occidentalis caurina GN=MCL-1 (length=402 residues).
atgtgtgtgcttgcctctaaaccagcatctcttgcaggaatgcttcggaagctggaaatccagaaagaggaagatctgca
atcagtgtgtgaagtggctgcccacgtgttcagtgatggagtaacaaactggggtagagtggtgacgctcatctcgtttg
gtgcctttgttgcgaaacacctgaagagcataaaccaggagaagtgcatcagctcgctggcagggatcatcacggacgca
ctcgtctcatcgaagcgcgagtggctaatgagccaaggaggctgggagggctttgtcgacttctttcgagtcgaggacct
ggaaggcagcatcagaaatgtactgatggcgtttgcaggtgtggctggactgggagcgagcttggcctacatgatccggt
ga
© 1998-2023Legal notice