Dataset for CDS BOK of Organism Canis lupus familiaris

[Download (right click)] [Edit] [Sequences] [Repertoires]

8 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A8I3PNV3_BOK-02      atgagcgcagcgagctgcgggccggcgccaggcggcaacgcccggggtcg
A0A8C0PFA3_BOK-02      atgagcgcagcgagctgcgggccggcgccaggcggcaacgcccggggtcg
A0A8I3S7I1_BOK-02      atgagcgcagcgagctgcgggccggcgccaggcggcaacgcccggggtcg
A0A8C0PFA3_BOK-01      atgagcgcagcgagctgcgggccggcgccaggcggcaacgcccggggtcg
A0A8I3PNV3_BOK-01      atgagcgcagcgagctgcgggccggcgccaggcggcaacgcccggggtcg
A0A8I3S7I1_BOK-01      atgagcgcagcgagctgcgggccggcgccaggcggcaacgcccggggtcg
A0A8I3PNV3_BOK-03      atgccccc---------------------------ctgcgcccgcagcc-
A0A8I3S7I1_BOK-03      atgccccc---------------------------ctgcgcccgcggcc-
                       ***  * *                           *  ******  * * 

A0A8I3PNV3_BOK-02      cggggacggcggcggccggtggcctccggagctgcgccgggaactcgctc
A0A8C0PFA3_BOK-02      cggggacggcggcggccggtggcctccggagctgcgccgggaactcgctc
A0A8I3S7I1_BOK-02      cggggacggcggcggccggtggcctccggagctgcgccgggaactcgctc
A0A8C0PFA3_BOK-01      cggggacggcggcggccggtggcctccggagctgcgccgggaactcgctc
A0A8I3PNV3_BOK-01      cggggacggcggcggccggtggcctccggagctgcgccgggaactcgctc
A0A8I3S7I1_BOK-01      cggggacggcggcggccggtggcctccggagctgcgccgggaactcgctc
A0A8I3PNV3_BOK-03      ------------tggccggtctgctccgcatccac------------ccc
A0A8I3S7I1_BOK-03      ------------tggccggtctgctccgcgtccac------------ccc
                                    *******   *****   *  *            * *

A0A8I3PNV3_BOK-02      gggcctccttaagcggggcggggaggcggcgggaagctcggccgcggctc
A0A8C0PFA3_BOK-02      gggcctccttaagcggggcggggaggcggcgggaagctcggccgcggctc
A0A8I3S7I1_BOK-02      gggcctccttaagcggggcggggaggcggcgggaagctcggccgcggctc
A0A8C0PFA3_BOK-01      gggcctccttaagcggggcggggaggcggcgggaagctcggccgcggctc
A0A8I3PNV3_BOK-01      gggcctccttaagcggggcggggaggcggcgggaagctcggccgcggctc
A0A8I3S7I1_BOK-01      gggcctccttaagcggggcggggaggcggcgggaagctcggccgcggctc
A0A8I3PNV3_BOK-03      gggctgcct---gcgtggca----------------------tgcggccc
A0A8I3S7I1_BOK-03      gggctgcct---gcgtggca----------------------tgcggccc
                       ****  ***   *** ***                        ***** *

A0A8I3PNV3_BOK-02      cgccccgggggctgccttttccttagaaggcgaagccccaagcctcgcct
A0A8C0PFA3_BOK-02      cgccccgggggctgccttttccttagaaggcgaagccccaagcctcgcct
A0A8I3S7I1_BOK-02      cgccccgggggctgccttttccttagaaggcgaagccccaagcctcgcct
A0A8C0PFA3_BOK-01      cgccccgggggctgccttttccttagaaggcgaagccccaagcctcgcct
A0A8I3PNV3_BOK-01      cgccccgggggctgccttttccttagaaggcgaagccccaagcctcgcct
A0A8I3S7I1_BOK-01      cgccccgggggctgccttttccttagaaggcgaagccccaagcctcgcct
A0A8I3PNV3_BOK-03      ggcccgtgatggcac---------------agacgccctcatcggccccg
A0A8I3S7I1_BOK-03      ggcccgtgatggcac---------------agacgccctcatcggccccg
                        ****  *  *   *                ** ****  * *  * ** 

A0A8I3PNV3_BOK-02      cccgcccgcggagcccgcgccccgcgccccgcgcccctcgccgccgcccc
A0A8C0PFA3_BOK-02      cccgcccgcggagcccgcgccccgcgccccgcgcccctcgccgccgcccc
A0A8I3S7I1_BOK-02      cccgcccgcggagcccgcgccccgcgccccgcgcccctcgccgccgcccc
A0A8C0PFA3_BOK-01      cccgcccgcggagcccgcgccccgcgccccgcgcccctcgccgccgcccc
A0A8I3PNV3_BOK-01      cccgcccgcggagcccgcgccccgcgccccgcgcccctcgccgccgcccc
A0A8I3S7I1_BOK-01      cccgcccgcggagcccgcgccccgcgccccgcgcccctcgccgccgcccc
A0A8I3PNV3_BOK-03      ccggtccacggcgcttccgtt---tgcttggctgcaccagcggcggcgcc
A0A8I3S7I1_BOK-03      ccggtccacggcgcttccgtt---tgcttggctgcaccagcggcggcgcc
                       ** * ** *** **   **      **   **  * *  ** ** ** **

A0A8I3PNV3_BOK-02      agggcgcacaggccggcgcactccgcggggccccgggcgcacgggctggc
A0A8C0PFA3_BOK-02      agggcgcacaggccggcgcactccgcggggccccgggcgcacgggctggc
A0A8I3S7I1_BOK-02      agggcgcacaggccggcgcactccgcggggccccgggcgcacgggctggc
A0A8C0PFA3_BOK-01      agggcgcacaggccggcgcactccgcggggccccgggcgcacgggctggc
A0A8I3PNV3_BOK-01      agggcgcacaggccggcgcactccgcggggccccgggcgcacgggctggc
A0A8I3S7I1_BOK-01      agggcgcacaggccggcgcactccgcggggccccgggcgcacgggctggc
A0A8I3PNV3_BOK-03      cgggcgcgtgga-------attccttgg-------------cgagtgggc
A0A8I3S7I1_BOK-03      caggcgcgtgga-------attccttgg-------------cgagtgggc
                         *****   *        * ***  **             ** *  ***

A0A8I3PNV3_BOK-02      gacgggcggg---------cgcgtcctcatcgctcgggacggacacccga
A0A8C0PFA3_BOK-02      gacgggcggg---------cgcgtcctcatcgctcgggacggacacccga
A0A8I3S7I1_BOK-02      gacgggcggg---------cgcgtcctcatcgctcgggacggacacccga
A0A8C0PFA3_BOK-01      gacgggcggg---------cgcgtcctcatcgctcgggacggacacccga
A0A8I3PNV3_BOK-01      gacgggcggg---------cgcgtcctcatcgctcgggacggacacccga
A0A8I3S7I1_BOK-01      gacgggcggg---------cgcgtcctcatcgctcgggacggacacccga
A0A8I3PNV3_BOK-03      agcgggcagggccgcgacacacgcccacgcggctcggggag----cccgg
A0A8I3S7I1_BOK-03      agcgggcagggccgtgacacacgcccacgcggctcggggag----cccgg
                         ***** **         * ** ** *   *******  *    **** 

A0A8I3PNV3_BOK-02      ggccagcgcccctcccggccccgcgcccgcgaaatgccgcggcagaggtg
A0A8C0PFA3_BOK-02      ggccagcgcccctcccggccccgcgcccgcgaaatgccgcggcagaggtg
A0A8I3S7I1_BOK-02      ggccagcgcccctcccggccccgcgcccgcgaaatgccgcggcagaggtg
A0A8C0PFA3_BOK-01      ggccagcgcccctcccggccccgcgcccgcgaaatgccgcggcagaggtg
A0A8I3PNV3_BOK-01      ggccagcgcccctcccggccccgcgcccgcgaaatgccgcggcagaggtg
A0A8I3S7I1_BOK-01      ggccagcgcccctcccggccccgcgcccgcgaaatgccgcggcagaggtg
A0A8I3PNV3_BOK-03      gtctgg-------------gcggcgcctggg----gccccgggcgaggc-
A0A8I3S7I1_BOK-03      gtctgg-------------gcggcgcctggg----gccccgggcgaggc-
                       * *  *              * ***** * *    *** ***  ****  

A0A8I3PNV3_BOK-02      ccgcgcccctggcccgcgtccccgccatggaggtgctgcggcgctcctcg
A0A8C0PFA3_BOK-02      ccgcgcccctggcccgcgtccccgccatggaggtgctgcggcgctcctcg
A0A8I3S7I1_BOK-02      ccgcgcccctggcccgcgtccccgccatggaggtgctgcggcgctcctcg
A0A8C0PFA3_BOK-01      ccgcgcccctggcccgcgtccccgccatggaggtgctgcggcgctcctcg
A0A8I3PNV3_BOK-01      ccgcgcccctggcccgcgtccccgccatggaggtgctgcggcgctcctcg
A0A8I3S7I1_BOK-01      ccgcgcccctggcccgcgtccccgccatggaggtgctgcggcgctcctcg
A0A8I3PNV3_BOK-03      cttcactcctgggtcgca-------------------gcggtgc------
A0A8I3S7I1_BOK-03      cttcgctcctgggtcgca-------------------gcggtgc------
                       *  * * *****  ***                    **** **      

A0A8I3PNV3_BOK-02      gtcctcgccgcggagatcatggacgcctttgaccgctcgcccagcgacaa
A0A8C0PFA3_BOK-02      gtcctcgccgcggagatcatggacgcctttgaccgctcgcccagcgacaa
A0A8I3S7I1_BOK-02      gtcctcgccgcggagatcatggacgcctttgaccgctcgcccagcgacaa
A0A8C0PFA3_BOK-01      gtcctcgccgcggagatcatggacgcctttgaccgctcgcccagcgacaa
A0A8I3PNV3_BOK-01      gtcctcgccgcggagatcatggacgcctttgaccgctcgcccagcgacaa
A0A8I3S7I1_BOK-01      gtcctcgccgcggagatcatggacgcctttgaccgctcgcccagcgacaa
A0A8I3PNV3_BOK-03      -------ccgcgcccagcaaggacgccccccaaggcagccccacctgcgt
A0A8I3S7I1_BOK-03      -------ccgcacccagcaaggacgccccccaaggcagccccacctgcgt
                              ****    * ** *******    *  **   **** *  *  

A0A8I3PNV3_BOK-02      ggagctggtggcccaggccaaggcgctgggccgggagttcgtgcacgcgc
A0A8C0PFA3_BOK-02      ggagctggtggcccaggccaaggcgctgggccgggagttcgtgcacgcgc
A0A8I3S7I1_BOK-02      ggagctggtggcccaggccaaggcgctgggccgggagttcgtgcacgcgc
A0A8C0PFA3_BOK-01      ggagctggtggcccaggccaaggcgctgggccgggagttcgtgcacgcgc
A0A8I3PNV3_BOK-01      ggagctggtggcccaggccaaggcgctgggccgggagttcgtgcacgcgc
A0A8I3S7I1_BOK-01      ggagctggtggcccaggccaaggcgctgggccgggagttcgtgcacgcgc
A0A8I3PNV3_BOK-03      gg------------------gggcgctggcacg---gcccctgcccgcgt
A0A8I3S7I1_BOK-03      gg------------------gggcgctggcacg---gcccctgcccgcgt
                       **                   ********  **   *  * *** **** 

A0A8I3PNV3_BOK-02      ggctgctgcgcgccggcctggcctggaccgcgcccgagcgcgccgctccc
A0A8C0PFA3_BOK-02      ggctgctgcgcgccggcctggcctggaccgcgcccgagcgcgccgctccc
A0A8I3S7I1_BOK-02      ggctgctgcgcgccggcctggcctggaccgcgcccgagcgcgccgctccc
A0A8C0PFA3_BOK-01      ggctgctgcgcgccggcctggcctggaccgcgcccgagcgcgccgctccc
A0A8I3PNV3_BOK-01      ggctgctgcgcgccggcctggcctggaccgcgcccgagcgcgccgctccc
A0A8I3S7I1_BOK-01      ggctgctgcgcgccggcctggcctggaccgcgcccgagcgcgccgctccc
A0A8I3PNV3_BOK-03      ggc-------------cctggctgctgccccgcccg-----------cct
A0A8I3S7I1_BOK-03      ggc-------------cctggctgctgccccacccg-----------cct
                       ***             ******     ** * ****           ** 

A0A8I3PNV3_BOK-02      gcccccgggggccgcctggccgaggtgtgcgcggtgctgctgcgcctggg
A0A8C0PFA3_BOK-02      gcccccgggggccgcctggccgaggtgtgcgcggtgctgctgcgcctggg
A0A8I3S7I1_BOK-02      gcccccgggggccgcctggccgaggtgtgcgcggtgctgctgcgcctggg
A0A8C0PFA3_BOK-01      gcccccgggggccgcctggccgaggtgtgcgcggtgctgctgcgcctggg
A0A8I3PNV3_BOK-01      gcccccgggggccgcctggccgaggtgtgcgcggtgctgctgcgcctggg
A0A8I3S7I1_BOK-01      gcccccgggggccgcctggccgaggtgtgcgcggtgctgctgcgcctggg
A0A8I3PNV3_BOK-03      gcccc---------------------gagcgctcagcggct--------g
A0A8I3S7I1_BOK-03      gcccc---------------------gagcgctcagcggct--------g
                       *****                     * ****   ** ***        *

A0A8I3PNV3_BOK-02      ggatgagctggagctgatccggcccagcgtctaccgcaacgtggcgcgcc
A0A8C0PFA3_BOK-02      ggatgagctggagctgatccggcccagcgtctaccgcaacgtggcgcgcc
A0A8I3S7I1_BOK-02      ggatgagctggagctgatccggcccagcgtctaccgcaacgtggcgcgcc
A0A8C0PFA3_BOK-01      ggatgagctggagctgatccggcccagcgtctaccgcaacgtggcgcgcc
A0A8I3PNV3_BOK-01      ggatgagctggagctgatccggcccagcgtctaccgcaacgtggcgcgcc
A0A8I3S7I1_BOK-01      ggatgagctggagctgatccggcccagcgtctaccgcaacgtggcgcgcc
A0A8I3PNV3_BOK-03      ggatgagctggagctgatccggcccagcgtctaccgcaacgtggcgcgcc
A0A8I3S7I1_BOK-03      ggatgagctggagctgatccggcccagcgtctaccgcaacgtggcgcgcc
                       **************************************************

A0A8I3PNV3_BOK-02      agctgaacatctccctgcagtccgagagcgtggtgactgacgccttcctg
A0A8C0PFA3_BOK-02      agctgaacatctccctgcagtccgagagcgtggtgactgacgccttcctg
A0A8I3S7I1_BOK-02      agctgaacatctccctgcagtccgagagcgtggtgactgacgccttcctg
A0A8C0PFA3_BOK-01      agctgaacatctccctgcagtccgagagcgtggtgactgacgccttcctg
A0A8I3PNV3_BOK-01      agctgaacatctccctgcagtccgagagcgtggtgactgacgccttcctg
A0A8I3S7I1_BOK-01      agctgaacatctccctgcagtccgagagcgtggtgactgacgccttcctg
A0A8I3PNV3_BOK-03      agctgaacatctccctgcagtccgagagcgtggtgactgacgccttcctg
A0A8I3S7I1_BOK-03      agctgaacatctccctgcagtccgagagcgtggtgactgacgccttcctg
                       **************************************************

A0A8I3PNV3_BOK-02      gcggtggcatctcagatcttctctggaggcatcacatggggcaaggtggt
A0A8C0PFA3_BOK-02      gcggtggcatctcagatcttctctggaggcatcacatggggcaaggtggt
A0A8I3S7I1_BOK-02      gcggtggcatctcagatcttctctggaggcatcacatggggcaaggtggt
A0A8C0PFA3_BOK-01      gcggtggcatctcagatcttctctggaggcatcacatggggcaaggtggt
A0A8I3PNV3_BOK-01      gcggtggcatctcagatcttctctggaggcatcacatggggcaaggtggt
A0A8I3S7I1_BOK-01      gcggtggcatctcagatcttctctggaggcatcacatggggcaaggtggt
A0A8I3PNV3_BOK-03      gcggtggcatctcagatcttctctggaggcatcacatggggcaaggtggt
A0A8I3S7I1_BOK-03      gcggtggcatctcagatcttctctggaggcatcacatggggcaaggtggt
                       **************************************************

A0A8I3PNV3_BOK-02      gtcgctgtactccgtggccgcagggctggcggtggactgtgtgcggcagg
A0A8C0PFA3_BOK-02      gtcactgtactccgtggccgcagggctggcggtggactgtgtgcggcagg
A0A8I3S7I1_BOK-02      gtcactgtactccgtggccgcagggctggcggtggactgtgtgcggcagg
A0A8C0PFA3_BOK-01      gtcactgtactccgtggccgcagggctggcggtggactgtgtgcggcagg
A0A8I3PNV3_BOK-01      gtcgctgtactccgtggccgcagggctggcggtggactgtgtgcggcagg
A0A8I3S7I1_BOK-01      gtcactgtactccgtggccgcagggctggcggtggactgtgtgcggcagg
A0A8I3PNV3_BOK-03      gtcgctgtactccgtggccgcagggctggcggtggactgtgtgcggcagg
A0A8I3S7I1_BOK-03      gtcactgtactccgtggccgcagggctggcggtggactgtgtgcggcagg
                       *** **********************************************

A0A8I3PNV3_BOK-02      cccagcccgccctggtccacgcgctcgtcgactgcctcggggagttcgtg
A0A8C0PFA3_BOK-02      cccagcccgccctggtccacgcgctcgtcgactgcctcggggagttcgtg
A0A8I3S7I1_BOK-02      cccagcccgccctggtccacgcgctcgtcgactgcctcggggagttcgtg
A0A8C0PFA3_BOK-01      cccagcccgccctggtccacgcgctcgtcgactgcctcggggagttcgtg
A0A8I3PNV3_BOK-01      cccagcccgccctggtccacgcgctcgtcgactgcctcggggagttcgtg
A0A8I3S7I1_BOK-01      cccagcccgccctggtccacgcgctcgtcgactgcctcggggagttcgtg
A0A8I3PNV3_BOK-03      cccagcccgccctggtccacgcgctcgtcgactgcctcggggagttcgtg
A0A8I3S7I1_BOK-03      cccagcccgccctggtccacgcgctcgtcgactgcctcggggagttcgtg
                       **************************************************

A0A8I3PNV3_BOK-02      cgcaagaccc-tggcgccctggctgcggaggcgcggaggatgggtgaggg
A0A8C0PFA3_BOK-02      cgcaagacccttggcgccctggctgcggaggcgcggaggatgggtgaggg
A0A8I3S7I1_BOK-02      cgcaagaccc-tggcgccctggctgcggaggcgcggaggatgggtgaggg
A0A8C0PFA3_BOK-01      cgcaagacccttggcgccctggctgcggaggcgcggaggatgg-------
A0A8I3PNV3_BOK-01      cgcaagaccc-tggcgccctggctgcggaggcgcggaggatgg-------
A0A8I3S7I1_BOK-01      cgcaagaccc-tggcgccctggctgcggaggcgcggaggatgg-------
A0A8I3PNV3_BOK-03      cgcaagaccc-tggcgccctggctgcggaggcgcggaggatgggtgaggg
A0A8I3S7I1_BOK-03      cgcaagaccc-tggcgccctggctgcggaggcgcggaggatgggtgaggg
                       ********** ********************************       

A0A8I3PNV3_BOK-02      gtgccggggggtgcgctgctgcgggggggtgctggggctcggctgctcgc
A0A8C0PFA3_BOK-02      gtgcgggggggtgcgctgctgcgggggggtgctggggctcggctgctcgc
A0A8I3S7I1_BOK-02      gtgcgggggggtgcgctgctgcgggggggtgctggggctcggctgctcgc
A0A8C0PFA3_BOK-01      --------------------------------------------------
A0A8I3PNV3_BOK-01      --------------------------------------------------
A0A8I3S7I1_BOK-01      --------------------------------------------------
A0A8I3PNV3_BOK-03      gtgccggggggtgcgctgctgcgggggggtgctggggctcggctgctcgc
A0A8I3S7I1_BOK-03      gtgcgggggggtgcgctgctgcgggggggtgctggggctcggctgctcgc
                                                                         

A0A8I3PNV3_BOK-02      actgcccggctccctgccgacctgccctccgctcccccgagcccaggccc
A0A8C0PFA3_BOK-02      actgcccggctccctgccgacctgccctctgctcccccgagcccaggccc
A0A8I3S7I1_BOK-02      actgcccggctccctgccgacctgccctctgctcccccgagcccaggccc
A0A8C0PFA3_BOK-01      ---------------accgacgt-----------cctcaag---------
A0A8I3PNV3_BOK-01      ---------------accgacgt-----------cctcaag---------
A0A8I3S7I1_BOK-01      ---------------accgacgt-----------cctcaag---------
A0A8I3PNV3_BOK-03      actgcccggctccctgccgacctgccctccgctcccccgagcccaggccc
A0A8I3S7I1_BOK-03      actgcccggctccctgccgacctgccctctgctcccccgagcccaggccc
                                       ***** *           ** * **         

A0A8I3PNV3_BOK-02      cgcggggcaggagctgcccgggagggatcgcccgtcactgcccaggcccc
A0A8C0PFA3_BOK-02      cgcggggcaggagctgcccgggagggatcgcccgtcactgcccaggcccc
A0A8I3S7I1_BOK-02      cgcggggcaggagctgcccgggagggatcgcccgtcactgcccaggcccc
A0A8C0PFA3_BOK-01      tgtgtgg-------------------------------------------
A0A8I3PNV3_BOK-01      tgtgtgg-------------------------------------------
A0A8I3S7I1_BOK-01      tgtgtgg-------------------------------------------
A0A8I3PNV3_BOK-03      cgcggggcaggagctgcccgggagggatcgcccgtcactgcccaggcccc
A0A8I3S7I1_BOK-03      cgcggggcaggagctgcccgggagggatcgcccgtcactgcccaggcccc
                        * * **                                           

A0A8I3PNV3_BOK-02      gcgccgggcgcccccaccacggcctccgagcccgcagtcgcccgcccacc
A0A8C0PFA3_BOK-02      gcgccgggcgcccccaccacggcctccgagcccgcagccgcccgcccacc
A0A8I3S7I1_BOK-02      gcgccgggcgcccccaccacggcctccgagcccgcagccgcctgcccacc
A0A8C0PFA3_BOK-01      --------------------------tgagcacggagcc-----------
A0A8I3PNV3_BOK-01      --------------------------tgagcacggagcc-----------
A0A8I3S7I1_BOK-01      --------------------------tgagcacggagcc-----------
A0A8I3PNV3_BOK-03      gcgccgggcgcccccaccacggcctccgagcccgcagtcgcccgcccacc
A0A8I3S7I1_BOK-03      gcgccgggcgcccccaccacggcctccgagcccgcagccgcctgcccacc
                                                  **** ** ** *           

A0A8I3PNV3_BOK-02      ccggccgggcctcgggcgcagcccccacaggagagctcacccctatgggt
A0A8C0PFA3_BOK-02      ccggccgggcctcgggcgcagcccccacaggagagctcacccgtatgggt
A0A8I3S7I1_BOK-02      ccggccgggcctcgggcgcagcccccacaggagagctcacccgtatgggt
A0A8C0PFA3_BOK-01      ------------------cggcttcc--------gctcgcac---tggct
A0A8I3PNV3_BOK-01      ------------------cggcttcc--------gctcgcac---tggct
A0A8I3S7I1_BOK-01      ------------------cggcttcc--------gctcgcac---tggct
A0A8I3PNV3_BOK-03      ccggccgggcctcgggcgcagcccccacaggagagctcacccctatgggt
A0A8I3S7I1_BOK-03      ccggccgggcctcgggcgcagcccccacaggagagctcacccgtatgggt
                                         * **  **        **** * *   *** *

A0A8I3PNV3_BOK-02      ggcggccgagggcgctggagctcgggccggggctgcccccgggacccggg
A0A8C0PFA3_BOK-02      ggcggccgagggcgctggagctcgggccggggctgcccccgggacccggg
A0A8I3S7I1_BOK-02      ggcggccgagggcgctggagctcgggccggggctgcccccgggacccggg
A0A8C0PFA3_BOK-01      ggtggccgc--gctctgcagcttcggcc----------------------
A0A8I3PNV3_BOK-01      ggtggccgc--gctctgcagcttcggcc----------------------
A0A8I3S7I1_BOK-01      ggtggccgc--gctctgcagcttcggcc----------------------
A0A8I3PNV3_BOK-03      ggcggccgagggcgctggagctcgggccggggctgcccccgggacccggg
A0A8I3S7I1_BOK-03      ggcggccgagggcgctggagctcgggccggggctgcccccgggacccggg
                       ** *****   ** *** ****  ****                      

A0A8I3PNV3_BOK-02      ctgcggccagtcctcagcacagacccgacgccgctgcctcctgcctgccg
A0A8C0PFA3_BOK-02      ctgtggccagtcctcagcacagacccgacgccgctgcctcctgcctgctg
A0A8I3S7I1_BOK-02      ctgtggccagtcctcagcacagacccgacgccgctgcctcctgcctgctg
A0A8C0PFA3_BOK-01      -----------------------------------gcttcctg-------
A0A8I3PNV3_BOK-01      -----------------------------------gcttcctg-------
A0A8I3S7I1_BOK-01      -----------------------------------gcttcctg-------
A0A8I3PNV3_BOK-03      ctgcggccagtcctcagcacagacccgacgccgctgcctcctgcctgccg
A0A8I3S7I1_BOK-03      ctgtggccagtcctcagcacagacccgacgccgctgcctcctgcctgctg
                                                          ** *****       

A0A8I3PNV3_BOK-02      cgcggcctctgctatggacgccagtgggctccgcggtcgaggtccagagc
A0A8C0PFA3_BOK-02      cgcggcctctgctatggacgccagtgggctccacggtcgaggtccagagc
A0A8I3S7I1_BOK-02      cgcggcctctgctatggacgccagtgggctccacggtcgaggtccagagc
A0A8C0PFA3_BOK-01      --------------------------------------------------
A0A8I3PNV3_BOK-01      --------------------------------------------------
A0A8I3S7I1_BOK-01      --------------------------------------------------
A0A8I3PNV3_BOK-03      cgcggcctctgctatggacgccagtgggctccgcggtcgaggtccagagc
A0A8I3S7I1_BOK-03      cgcggcctctgctatggacgccagtgggctccacggtcgaggtccagagc
                                                                         

A0A8I3PNV3_BOK-02      gcagggcagatttcattcccagcaggagaaagaactgggcctgctgctcg
A0A8C0PFA3_BOK-02      acagggcagatttcattcccagcaggagaaagaactgggcctgctgctcg
A0A8I3S7I1_BOK-02      acagggcagatttcattcccagcaggagaaagaactgggcctgctgctcg
A0A8C0PFA3_BOK-01      --aaggccgccttc--------------------------------ctcg
A0A8I3PNV3_BOK-01      --aaggccgccttc--------------------------------ctcg
A0A8I3S7I1_BOK-01      --aaggccgccttc--------------------------------ctcg
A0A8I3PNV3_BOK-03      gcagggcagatttcattcccagcaggagaaagaactgggcctgctgctcg
A0A8I3S7I1_BOK-03      acagggcagatttcattcccagcaggagaaagaactgggcctgctgctcg
                         * *** *  ***                                ****

A0A8I3PNV3_BOK-02      ggcttgtggggagccggtcccacccgttctggggggcagtgcgccatggt
A0A8C0PFA3_BOK-02      ggcttgtggggagccggtcccacccgttctggggggcagtgcgccatggt
A0A8I3S7I1_BOK-02      ggcttgtggggagccggtcccacccgttctggggggcagtgcgccatggt
A0A8C0PFA3_BOK-01      tgct----------------------------------------------
A0A8I3PNV3_BOK-01      tgct----------------------------------------------
A0A8I3S7I1_BOK-01      tgct----------------------------------------------
A0A8I3PNV3_BOK-03      ggcttgtggggagccggtcccacccgttctggggggcagtgcgccatggt
A0A8I3S7I1_BOK-03      ggcttgtggggagccggtcccacccgttctggggggcagtgcgccatggt
                        ***                                              

A0A8I3PNV3_BOK-02      gctccccaggcgggggctgcgggggcgtctgcagccccgggggcaggagc
A0A8C0PFA3_BOK-02      gctccccaggcgggggctgcgggggcgtctgcagccccgggggcaggagc
A0A8I3S7I1_BOK-02      gctccccaggcgggggctgcgggggcgtctgcagccccgggggcaggagc
A0A8C0PFA3_BOK-01      ---------------gctgccagag-------------------------
A0A8I3PNV3_BOK-01      ---------------gctgccggag-------------------------
A0A8I3S7I1_BOK-01      ---------------gctgccggag-------------------------
A0A8I3PNV3_BOK-03      gctccccaggcgggggctgcgggggcgtctgcagccccgggggcaggagc
A0A8I3S7I1_BOK-03      gctccccaggcgggggctgcgggggcgtctgcagccccgggggcaggagc
                                      *****  * *                         

A0A8I3PNV3_BOK-02      aggtggctgcggggacacgggcacagcgggcttctctcctgccgggcccg
A0A8C0PFA3_BOK-02      aggtggctgcggggacacgggcacagcgggcttctctcctgccgggcccg
A0A8I3S7I1_BOK-02      aggtggctgcggggacacgggcacagcgggcttctctcctgccgggcccg
A0A8C0PFA3_BOK-01      agatgagcggccggagcgcgctcgggctgaagccaggccccccgagcccg
A0A8I3PNV3_BOK-01      agatga--------------------------------------------
A0A8I3S7I1_BOK-01      agatga--------------------------------------------
A0A8I3PNV3_BOK-03      aggtggctgcggggacacgggcacagcgggcttctctcctgccgggcccg
A0A8I3S7I1_BOK-03      aggtggctgcggggacacgggcacagcgggcttctctcctgccgggcccg
                       ** **                                             

A0A8I3PNV3_BOK-02      cggccgcctcgggctccccgtcctccccgtcctcccgggttgggctgccc
A0A8C0PFA3_BOK-02      cggccgcctcgggctccccgtcctccctgtcctcccgggttgggctgccc
A0A8I3S7I1_BOK-02      cggccgcctcgggctccccgtcctccctgtcctcccgggttgggctgccc
A0A8C0PFA3_BOK-01      gggccccgcgcacggcctcggcctcctcgcccggcctgggagtgcgccgg
A0A8I3PNV3_BOK-01      --------------------------------------------------
A0A8I3S7I1_BOK-01      --------------------------------------------------
A0A8I3PNV3_BOK-03      cggccgcctcgggctccccgtcctccccgtcctcccgggttgggctgccc
A0A8I3S7I1_BOK-03      cggccgcctcgggctccccgtcctccctgtcctcccgggttgggctgccc
                                                                         

A0A8I3PNV3_BOK-02      cacggggacctcccctaa--------------------------------
A0A8C0PFA3_BOK-02      cacggggacctcccctaaggcctcggcggcccccactcgtctctaaccca
A0A8I3S7I1_BOK-02      cacggggacctcccctaa--------------------------------
A0A8C0PFA3_BOK-01      ccgtcggggccccacctcggggctggaggccctgccctga----------
A0A8I3PNV3_BOK-01      --------------------------------------------------
A0A8I3S7I1_BOK-01      --------------------------------------------------
A0A8I3PNV3_BOK-03      cacggggacctcccctaa--------------------------------
A0A8I3S7I1_BOK-03      cacggggacctcccctaa--------------------------------
                                                                         

A0A8I3PNV3_BOK-02      --------------------------------------------------
A0A8C0PFA3_BOK-02      ccctctcccctccagaccgacgtcctcaagtgtgtggtgagcacggagcc
A0A8I3S7I1_BOK-02      --------------------------------------------------
A0A8C0PFA3_BOK-01      --------------------------------------------------
A0A8I3PNV3_BOK-01      --------------------------------------------------
A0A8I3S7I1_BOK-01      --------------------------------------------------
A0A8I3PNV3_BOK-03      --------------------------------------------------
A0A8I3S7I1_BOK-03      --------------------------------------------------
                                                                         

A0A8I3PNV3_BOK-02      --------------------------------------------------
A0A8C0PFA3_BOK-02      cggcttccgctcgcactggctggtggccgcgctctgcagcttcggccgct
A0A8I3S7I1_BOK-02      --------------------------------------------------
A0A8C0PFA3_BOK-01      --------------------------------------------------
A0A8I3PNV3_BOK-01      --------------------------------------------------
A0A8I3S7I1_BOK-01      --------------------------------------------------
A0A8I3PNV3_BOK-03      --------------------------------------------------
A0A8I3S7I1_BOK-03      --------------------------------------------------
                                                                         

A0A8I3PNV3_BOK-02      -----------------------------------------
A0A8C0PFA3_BOK-02      tcctgaaggccgccttcctcgtgctgctgccagagagatga
A0A8I3S7I1_BOK-02      -----------------------------------------
A0A8C0PFA3_BOK-01      -----------------------------------------
A0A8I3PNV3_BOK-01      -----------------------------------------
A0A8I3S7I1_BOK-01      -----------------------------------------
A0A8I3PNV3_BOK-03      -----------------------------------------
A0A8I3S7I1_BOK-03      -----------------------------------------
                                                                

© 1998-2023Legal notice