Dataset for CDS BCL-2-like of organism Felis catus

[Download (right click)] [Edit] [Sequences] [Repertoires]

15 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A5F5Y6Y3_BCL2-02      atggcgcacgctgggagaacagggtatgataaccgggagatagtcatgaa
A0A5F5Y6Y3_BCL2-01      atggcgcacgctgggagaacagggtatgataaccgggagatagtcatgaa
Q8I008_BCL2-01          atggcgcacgctgggagaacagggtatgataaccgggagatagtgatgaa
M3WHW2_BCL2A1-01        atggcc--------------------------------------------
Q8SQ42_BCL2L1-01        atgtctc------------------agagcaaccgggagctggtggttga
A0A5F5XYW0_BCL2L1-      atgtctc------------------agagcaaccgggagctggtggttga
A0A5F5XYW0_BCL2L1-      atgtctc------------------agagcaaccgggagctggtggttga
A0A5F5XYW0_BCL2L1-      atgtctc------------------agagcaaccgggagctggtggttga
A0A337RYG8_BCL2L10      atgg----------------------------------------------
A0A2I2UAE3_BCL2L2-      atggc-------------------------------------------ga
A0A337S3J9_MCL1-02      atg-----------------------------------------------
A0A337S3J9_MCL1-01      atg-----------------------------------------------
Q7YRZ9_MCL1-01          atg-----------------------------------------------
A0A337S3J9_MCL1-03      atg-----------------------------------------------
A0A337S3J9_MCL1-04      atg-----------------------------------------------
                        ***                                               

A0A5F5Y6Y3_BCL2-02      gtacatccactataagctgtcgcagaggggctacgagtggg---------
A0A5F5Y6Y3_BCL2-01      gtacatccactataagctgtcgcagaggggctacgagtggg---------
Q8I008_BCL2-01          gtacatccactatgagctgccgcagaggggctacgagtggg---------
M3WHW2_BCL2A1-01        --------------------------gacggcgagtttgggtacgttctc
Q8SQ42_BCL2L1-01        ctttctctcctacaagctttcccagaaaggatacagctggagtcggttta
A0A5F5XYW0_BCL2L1-      ctttctctcctacaagctttcccagaaaggatacagctggagtcagttta
A0A5F5XYW0_BCL2L1-      ctttctctcctacaagctttcccagaaaggatacagctggagtcagttta
A0A5F5XYW0_BCL2L1-      ctttctctcctacaagctttcccagaaaggatacagctggagtcagttta
A0A337RYG8_BCL2L10      ----------------------ctgacgcgttgagggagcgcac------
A0A2I2UAE3_BCL2L2-      ccccagcctcagc-------cccagacaca-------cgggctcta----
A0A337S3J9_MCL1-02      -tttggcctcaa----------gagaaacgctgtaatcggactcaacctc
A0A337S3J9_MCL1-01      -tttggcctcaa----------gagaaacgctgtaatcggactcaacctc
Q7YRZ9_MCL1-01          -tttggcctcaa----------gagaaacgctgtaatcggactcaacctc
A0A337S3J9_MCL1-03      -tttggcctcaa----------gagaaacgctgtaatcggactcaacctc
A0A337S3J9_MCL1-04      -tttggcctcaa----------gagaaacgctgtaatcggactcaacctc
                                                              *           

A0A5F5Y6Y3_BCL2-02      ----atgccggggacg---cgggcgccgcgcccccgggggccgcccccgc
A0A5F5Y6Y3_BCL2-01      ----atgccggggacg---cgggcgccgcgcccccgggggccgcccccgc
Q8I008_BCL2-01          ----atgccggggacg---cgggcgccgcgcccccgggggccgcccccgc
M3WHW2_BCL2A1-01        ----acgctggcccgggactatacggagcacgttctgc------------
Q8SQ42_BCL2L1-01        ----gtgatg---------tggaagagaacagaactgaggccc-------
A0A5F5XYW0_BCL2L1-      ----gtgatg---------tggaagagaacagaactgaggccc-------
A0A5F5XYW0_BCL2L1-      ----gtgatg---------tggaagagaacagaactgaggccc-------
A0A5F5XYW0_BCL2L1-      ----gtgatg---------tggaagagaacagaactgaggccc-------
A0A337RYG8_BCL2L10      ----ggcgcagctactgactgactacctggagtactgcgcc---------
A0A2I2UAE3_BCL2L2-      ----gtggcagact----ttgtaggctataag--ctgagg----------
A0A337S3J9_MCL1-02      tactgtgggggggccgggttggcggccgggag--cggcggcgcctcctct
A0A337S3J9_MCL1-01      tactgtgggggggccgggttggcggccgggag--cggcggcgcctcctct
Q7YRZ9_MCL1-01          tactgtgggggggccgggttggcggccgggag--cggcggcgcctcctct
A0A337S3J9_MCL1-03      tactgtgggggggccgggttggcggccgggag--cggcggcgcctcctct
A0A337S3J9_MCL1-04      tactgtgggggggccgggttggcggccgggag--cggcggcgcctcctct
                                                          * *             

A0A5F5Y6Y3_BCL2-02      gccgggcatcttctcctcccagcccgggcgcacccctgcgcccgc-----
A0A5F5Y6Y3_BCL2-01      gccgggcatcttctcctcccagcccgggcgcacccctgcgcccgc-----
Q8I008_BCL2-01          gccgggcatcttctcctcccagcccgggcgcacccctgcgcccgc-----
M3WHW2_BCL2A1-01        -----aggg-----------------------------------------
Q8SQ42_BCL2L1-01        -cagaaggg---actgaatcagagatggagacccccagtgccatc-----
A0A5F5XYW0_BCL2L1-      -cagaaggg---actgaatcagagatggagacccccagtgccatc-----
A0A5F5XYW0_BCL2L1-      -cagaaggg---actgaatcagagatggagacccccagtgccatc-----
A0A5F5XYW0_BCL2L1-      -cagaaggg---actgaatcagagatggagacccccagtgccatc-----
A0A337RYG8_BCL2L10      -cgggagcccggc-------------------------------------
A0A2I2UAE3_BCL2L2-      -cagaaggg----ttatgtttgtggagcag--------------------
A0A337S3J9_MCL1-02      tcgggagggcggcttgtggctgtggggaaggaggccacggccaggcgaga
A0A337S3J9_MCL1-01      tcgggagggcggcttgtggctgtggggaaggaggccacggccaggcgaga
Q7YRZ9_MCL1-01          tcgggagggcggcttgtggctgtggggaaggaggccacggccaggcgaga
A0A337S3J9_MCL1-03      tcgggagggcggcttgtggctgtggggaaggaggccacggccaggcgaga
A0A337S3J9_MCL1-04      tcgggagggcggcttgt---------------------------------
                                                                          

A0A5F5Y6Y3_BCL2-02      ----------caggacctccccgccgccgcccccggtcgcccccgccgcc
A0A5F5Y6Y3_BCL2-01      ----------caggacctccccgccgccgcccccggtcgcccccgccgcc
Q8I008_BCL2-01          ----------caggacctccccgccgccgcccccggtcgccc------cc
M3WHW2_BCL2A1-01        --------------------------------------gccccagcc---
Q8SQ42_BCL2L1-01        --------aatggcaacccatcctggcacttggcagacagccctgcggtg
A0A5F5XYW0_BCL2L1-      --------aatggcaacccatcctggcacttggcggacagccctgcggtg
A0A5F5XYW0_BCL2L1-      --------aatggcaacccatcctggcacttggcggacagccctgcggtg
A0A5F5XYW0_BCL2L1-      --------aatggcaacccatcctggcacttggcggacagccctgcggtg
A0A337RYG8_BCL2L10      --------------------------------------agccccgcg---
A0A2I2UAE3_BCL2L2-      --------------------------------------gccctgggg---
A0A337S3J9_MCL1-02      ggtagggggaggggaagccggtgcggtgattggcggaagcgccggcg---
A0A337S3J9_MCL1-01      ggtagggggaggggaagccggtgcggtgattggcggaagcgccggcg---
Q7YRZ9_MCL1-01          ggtagggggaggggaagccggtgcggtgattggcggaagcgccggcg---
A0A337S3J9_MCL1-03      ggtagggggaggggaagccggtgcggtgattggcggaagcgccggcg---
A0A337S3J9_MCL1-04      --------------------------------------------------
                                                                          

A0A5F5Y6Y3_BCL2-02      gccgccg----ccgccgccgc--------cgcgggccctgcgctcagccc
A0A5F5Y6Y3_BCL2-01      gccgccg----ccgccgccgc--------cgcgggccctgcgctcagccc
Q8I008_BCL2-01          gccgccg----ccgccgctgc--------cgcgggccctgcgctcagccc
M3WHW2_BCL2A1-01        -----------cgggtcccacccaagcagagtatcccaagtgctacaaga
Q8SQ42_BCL2L1-01        aatggagccactggccacagc--------agcagcttggatgcc-cggga
A0A5F5XYW0_BCL2L1-      aatggagccactggccacagc--------agcagcttggatgcc-cggga
A0A5F5XYW0_BCL2L1-      aatggagccactggccacagc--------agcagcttggatgcc-cggga
A0A5F5XYW0_BCL2L1-      aatggagccactggccacagc--------agcagcttggatgcc-cggga
A0A337RYG8_BCL2L10      -----------cggacgccg----------------tccacgcc-cgagg
A0A2I2UAE3_BCL2L2-      -----------agggcccagc--------agctgacccactgca-ccaag
A0A337S3J9_MCL1-02      -----------cgagcccccc--------agccactctcgcgcc-cgacg
A0A337S3J9_MCL1-01      -----------cgagcccccc--------agccactctcgcgcc-cgacg
Q7YRZ9_MCL1-01          -----------cgagcccccc--------agccactctcgcgcc-cgacg
A0A337S3J9_MCL1-03      -----------cgagcccccc--------agccactctcgcgcc-cgacg
A0A337S3J9_MCL1-04      --------------------------------------------------
                                                                          

A0A5F5Y6Y3_BCL2-02      cgtgccacctgtg------gtccacctgaccctgcgccaggccggcgatg
A0A5F5Y6Y3_BCL2-01      cgtgccacctgtg------gtccacctgaccctgcgccaggccggcgatg
Q8I008_BCL2-01          cgtgccacctgtg------gtccacctgaccctgcgccaggccggcgatg
M3WHW2_BCL2A1-01        cgtggccttctcg------gtccag---------ggggaggtcgagaaga
Q8SQ42_BCL2L1-01        ggtgatccccatggcagcggtcaaacaagcgctgagggaggctggggatg
A0A5F5XYW0_BCL2L1-      ggtgatccccatggcagcggtgaagcaggcgctgagggaggccggggatg
A0A5F5XYW0_BCL2L1-      ggtgatccccatggcagcggtgaagcaggcgctgagggaggccggggatg
A0A5F5XYW0_BCL2L1-      ggtgatccccatggcagcggtgaagcaggcgctgagggaggccggggatg
A0A337RYG8_BCL2L10      --------ccgcg------gtgctgcgctacct---------ggccgccc
A0A2I2UAE3_BCL2L2-      --------ccatg-----cgtgcagc----------------tggagatg
A0A337S3J9_MCL1-02      --------cccggagggtcgcgcggccctcgccca------ttggtgccg
A0A337S3J9_MCL1-01      --------cccggagggtcgcgcggccctcgccca------ttggtgccg
Q7YRZ9_MCL1-01          --------cccggagggtcgcgcggccctcgccca------ttggtgccg
A0A337S3J9_MCL1-03      --------cccggagggtcgcgcggccctcgccca------ttggtgccg
A0A337S3J9_MCL1-04      --------------------------------------------------
                                                                          

A0A5F5Y6Y3_BCL2-02      acttctcccgtcgctaccgccgcgacttcgcgga-------------gat
A0A5F5Y6Y3_BCL2-01      acttctcccgtcgctaccgccgcgacttcgcgga-------------gat
Q8I008_BCL2-01          acttctcccgtcgctaccgccgcgacttcgcgga-------------gat
M3WHW2_BCL2A1-01        agttgaagccgtgc------------------------------ctggac
Q8SQ42_BCL2L1-01        agtttgaactgaggtaccggcgggcattcagtga----------cctgac
A0A5F5XYW0_BCL2L1-      agtttgaactgaggtaccggcgggcattcagcga----------cctgac
A0A5F5XYW0_BCL2L1-      agtttgaactgaggtaccggcgggcattcagcga----------cctgac
A0A5F5XYW0_BCL2L1-      agtttgaactgaggtaccggcgggcattcagcga----------cctgac
A0A337RYG8_BCL2L10      agatacggcagcgccaccagcgtttcttgtcggc---------ttaccgc
A0A2I2UAE3_BCL2L2-      agtttgagacccgcttccggcgcaccttctctga----------tttggc
A0A337S3J9_MCL1-02      a----gggccccgacgtcaccgcgacccccccgaagctgctgttcttcgc
A0A337S3J9_MCL1-01      a----gggccccgacgtcaccgcgacccccccgaagctgctgttcttcgc
Q7YRZ9_MCL1-01          a----gggccccgacgtcaccgcgacccccccgaagctgctgttcttcgc
A0A337S3J9_MCL1-03      a----gggccccgacgtcaccgcgacccccccgaagctgctgttcttcgc
A0A337S3J9_MCL1-04      --------------------------------------------------
                                                                          

A0A5F5Y6Y3_BCL2-02      gtccagcc----agctgcacctgacaccc-------------tttaccgc
A0A5F5Y6Y3_BCL2-01      gtccagcc----agctgcacctgacaccc-------------tttaccgc
Q8I008_BCL2-01          gtccagcc----agctgcacctgacaccc-------------tttaccgc
M3WHW2_BCL2A1-01        a-----------agttccatgtggtgtcg----------gtagacacggc
Q8SQ42_BCL2L1-01        atc--cc-----agcttcacatcacccca-------------gggacagc
A0A5F5XYW0_BCL2L1-      atc--cc-----agcttcacatcacccca-------------gggacagc
A0A5F5XYW0_BCL2L1-      atc--cc-----agcttcacatcacccca-------------gggacagc
A0A5F5XYW0_BCL2L1-      atc--cc-----agcttcacatcacccca-------------gggacagc
A0A337RYG8_BCL2L10      ggctaccgcggaaaccgcgtggaactggt-------------ggcgcggt
A0A2I2UAE3_BCL2L2-      agc--cc-----agttgcatgtgacccct-------------gggtcagc
A0A337S3J9_MCL1-02      ggccacc-----cgctgtgcgtcgccgcctgaaaagatggaaggcccagc
A0A337S3J9_MCL1-01      ggccacc-----cgctgtgcgtcgccgcctgaaaagatggaaggcccagc
Q7YRZ9_MCL1-01          ggccacc-----cgctgtgcgtcgccgcctgaagagatggaaggcccagc
A0A337S3J9_MCL1-03      ggccacc-----cgctgtgcgtcgccgcctgaaaagatggaaggcccagc
A0A337S3J9_MCL1-04      --------------------------------------------------
                                                                          

A0A5F5Y6Y3_BCL2-02      a-----aggggacgctttgccacg--------------------------
A0A5F5Y6Y3_BCL2-01      a-----aggggacgctttgccacg--------------------------
Q8I008_BCL2-01          a-----aggggacgctttgccacg--------------------------
M3WHW2_BCL2A1-01        c-----aggacgatattccaccaa--------------------------
Q8SQ42_BCL2L1-01        a-----tatcagagctttgagcag--------------------------
A0A5F5XYW0_BCL2L1-      a-----tatcagagctttgagcag--------------------------
A0A5F5XYW0_BCL2L1-      a-----tatcagagctttgagcag--------------------------
A0A5F5XYW0_BCL2L1-      a-----tatcagagctttgagcag--------------------------
A0A337RYG8_BCL2L10      tggag-caggatttactctccaa---------------------------
A0A2I2UAE3_BCL2L2-      c-----cagcaacgcttcacccag--------------------------
A0A337S3J9_MCL1-02      cgccgacgccatcatgtcgcccgaagaggagctagacgggtacgagccag
A0A337S3J9_MCL1-01      cgccgacgccatcatgtcgcccgaagaggagctagacgggtacgagccag
Q7YRZ9_MCL1-01          cgccgacgccatcatgtcgcccgaagaggagctagacgggtacgagccag
A0A337S3J9_MCL1-03      cgccgacgccatcatgtcgcccgaagaggagctagacgggtacgagccag
A0A337S3J9_MCL1-04      --------------------------------------------------
                                                                          

A0A5F5Y6Y3_BCL2-02      ----------------------------gtggtggaggagctcttcaggg
A0A5F5Y6Y3_BCL2-01      ----------------------------gtggtggaggagctcttcaggg
Q8I008_BCL2-01          ----------------------------gtggtggaggagctcttcaggg
M3WHW2_BCL2A1-01        ----------------------------gtgatggaaaaggaatttgaag
Q8SQ42_BCL2L1-01        ----------------------------gtagtgaatgaactcttccggg
A0A5F5XYW0_BCL2L1-      ----------------------------gtagtgaacgaactcttccggg
A0A5F5XYW0_BCL2L1-      ----------------------------gtagtgaacgaactcttccggg
A0A5F5XYW0_BCL2L1-      ----------------------------gtagtgaacgaactcttccggg
A0A337RYG8_BCL2L10      ---------------------------------------------ccccc
A0A2I2UAE3_BCL2L2-      ----------------------------gtctctgatgaactcttccaag
A0A337S3J9_MCL1-02      aacctctggggaagcggccggctgtcctgcctttgctggagttggtcggg
A0A337S3J9_MCL1-01      aacctctggggaagcggccggctgtcctgcctttgctggagttggtcggg
Q7YRZ9_MCL1-01          aacctctggggaagcggccggctgtcctgcctttgctggagttggtcggg
A0A337S3J9_MCL1-03      aacctctggggaagcggccggctgtcctgcctttgctggagttggtcggg
A0A337S3J9_MCL1-04      --------------------------------------------------
                                                                          

A0A5F5Y6Y3_BCL2-02      atggagtg---aactgggggaggattgtggccttctttgagttcggtggg
A0A5F5Y6Y3_BCL2-01      atggagtg---aactgggggaggattgtggccttctttgagttcggtggg
Q8I008_BCL2-01          atggcgtg---aactgggggaggattgtggccttctttgagttcggtggg
M3WHW2_BCL2A1-01        acggcatcattaactggggcaggattgtgactatatttgcgtttgagggc
Q8SQ42_BCL2L1-01        atggggtg---aactggggtcgcattgtggcctttttctccttcggtggg
A0A5F5XYW0_BCL2L1-      atggggtg---aactggggtcgcattgtggcctttttctccttcggtggg
A0A5F5XYW0_BCL2L1-      atggggtg---aactggggtcgcattgtggcctttttctccttcggtggg
A0A5F5XYW0_BCL2L1-      atggggtg---aactggggtcgcattgtggcctttttctccttcggtggg
A0A337RYG8_BCL2L10      aaaccctc---agttggggccatgtggtagcgctcttgaccttcgcgggg
A0A2I2UAE3_BCL2L2-      ggggcccc---aactggggccgccttgtggccttctttgtctttggagcc
A0A337S3J9_MCL1-02      gaggccag---cagtggccccggcacagacggctcactgccctcgacgcc
A0A337S3J9_MCL1-01      gaggccag---cagtggccccggcacagacggctcactgccctcgacgcc
Q7YRZ9_MCL1-01          gaggccag---cagtggccccggcacagacggctcactgccctcgacgcc
A0A337S3J9_MCL1-03      gaggccag---cagtggccccggcacagacggctcactgccctcgacgcc
A0A337S3J9_MCL1-04      --------------------------------------------------
                                                                          

A0A5F5Y6Y3_BCL2-02      gtcat-----------------------gtgtgtggagagc---------
A0A5F5Y6Y3_BCL2-01      gtcat-----------------------gtgtgtggagagc---------
Q8I008_BCL2-01          gtcat-----------------------gtgtgtggagggc---------
M3WHW2_BCL2A1-01        atcctcatcaagaag-------------cttctccaggagcgg-------
Q8SQ42_BCL2L1-01        gcact-----------------------gtgcgtggagagc---------
A0A5F5XYW0_BCL2L1-      gcact-----------------------gtgcgtggaaagc---------
A0A5F5XYW0_BCL2L1-      gcact-----------------------gtgcgtggaaagc---------
A0A5F5XYW0_BCL2L1-      gcact-----------------------gtgcgtggaaagc---------
A0A337RYG8_BCL2L10      acgct---------------------------gctgg-------------
A0A2I2UAE3_BCL2L2-      gcact-----------------------gtgtgctgagagt---------
A0A337S3J9_MCL1-02      acccccagcagaggaggaggaggacgagttgttccggcagtcgctggaga
A0A337S3J9_MCL1-01      acccccagcagaggaggaggaggacgagttgttccggcagtcgctggaga
Q7YRZ9_MCL1-01          acccccagcagaggaggaggaggacgagttgttccggcagtcgctggaga
A0A337S3J9_MCL1-03      acccccagcagaggaggaggaggacgagttgttccggcagtcgctggaga
A0A337S3J9_MCL1-04      --------------------------------------------------
                                                                          

A0A5F5Y6Y3_BCL2-02      --------------------------------gtcaaccgagagatgtcg
A0A5F5Y6Y3_BCL2-01      --------------------------------gtcaaccgagagatgtcg
Q8I008_BCL2-01          --------------------------------gtcaaccgagagatgtcg
M3WHW2_BCL2A1-01        --------------------------------atcgtcccagacgcggat
Q8SQ42_BCL2L1-01        --------------------------------gtagacaaggagatgcag
A0A5F5XYW0_BCL2L1-      --------------------------------gtagacaaggagatgcag
A0A5F5XYW0_BCL2L1-      --------------------------------gtagacaaggagatgcag
A0A5F5XYW0_BCL2L1-      --------------------------------gtagacaaggagatgcag
A0A337RYG8_BCL2L10      -------------------------agagaccgccgccggggac------
A0A2I2UAE3_BCL2L2-      --------------------------------gtcaacaaggagatggag
A0A337S3J9_MCL1-02      ttatctctcggtaccttcgggagcaggcgaccggcgccaaggacgcgaaa
A0A337S3J9_MCL1-01      ttatctctcggtaccttcgggagcaggcgaccggcgccaaggacgcgaaa
Q7YRZ9_MCL1-01          ttatctctcggtaccttcgggagcaggcgaccggcgccaaggacgcgaaa
A0A337S3J9_MCL1-03      ttatctctcggtaccttcgggagcaggcgaccggcgccaaggacgcgaaa
A0A337S3J9_MCL1-04      -------------------------ggcgaccggcgccaaggacgcgaaa
                                                             *   **       

A0A5F5Y6Y3_BCL2-02      cccctgg-------tgg-acaacatcgccctg------------------
A0A5F5Y6Y3_BCL2-01      cccctgg-------tgg-acaacatcgccctg------------------
Q8I008_BCL2-01          cccctgg-------tgg-acaacatcgccctg------------------
M3WHW2_BCL2A1-01        gcgttta-------aggtttcctac-------------------------
Q8SQ42_BCL2L1-01        gtattgg-------tga-gtcggatcgcagct------------------
A0A5F5XYW0_BCL2L1-      gtattgg-------tga-gtcggatcgcaact------------------
A0A5F5XYW0_BCL2L1-      gtattgg-------tga-gtcggatcgcaact------------------
A0A5F5XYW0_BCL2L1-      gtattgg-------tga-gtcggatcgcaact------------------
A0A337RYG8_BCL2L10      ctacttg---aacctgacgccggaccagcaacaggagctggag-------
A0A2I2UAE3_BCL2L2-      ccacttg-------tgg-gac-----------aagtgcaagag-------
A0A337S3J9_MCL1-02      ccactgggcgggtctgg-ggcggccagccgaaaggcgttagagaccctcc
A0A337S3J9_MCL1-01      ccactgggcgggtctgg-ggcggccagccgaaaggcgttagagaccctcc
Q7YRZ9_MCL1-01          ccactgggcgggtctgg-ggcggccagccgaaaggcgttagagaccctcc
A0A337S3J9_MCL1-03      ccactgggcgggtctgg-ggcggccagccgaaaggcgttagagaccctcc
A0A337S3J9_MCL1-04      ccactgggcgggtctgg-ggcggccagccgaaaggcgttagagaccctcc
                            *          *                                  

A0A5F5Y6Y3_BCL2-02      ------tggatgactgagtacctgaaccggcacctgca------------
A0A5F5Y6Y3_BCL2-01      ------tggatgactgagtacctgaaccggcacctgca------------
Q8I008_BCL2-01          ------tggatgactgagtacctgaaccggcacctgca------------
M3WHW2_BCL2A1-01        ------tttgtcgccgagttcatcacgaaacacacggg------------
Q8SQ42_BCL2L1-01        ------tggatggccacttacctgaatgaccacctaga------------
A0A5F5XYW0_BCL2L1-      ------tggatggccacttacctgaacgaccacctaga------------
A0A5F5XYW0_BCL2L1-      ------tggatggccacttacctgaacgaccacctaga------------
A0A5F5XYW0_BCL2L1-      ------tggatggccacttacctgaacgaccacctaga------------
A0A337RYG8_BCL2L10      ------tgggagaccaacgttggccaggactgccagcacctggtggcttt
A0A2I2UAE3_BCL2L2-      --tggatggtggcctacctggagacacggctggccg-----actggattc
A0A337S3J9_MCL1-02      gacgggtcggggacggcgtgcag-cgcaaccacgag-----accgccttc
A0A337S3J9_MCL1-01      gacgggtcggggacggcgtgcag-cgcaaccacgag-----accgccttc
Q7YRZ9_MCL1-01          gacgggtcggggacggcgtgcag-cgcaaccacgag-----accgccttc
A0A337S3J9_MCL1-03      gacgggtcggggacggcgtgcag-cgcaaccacgag-----accgccttc
A0A337S3J9_MCL1-04      gacgggtcggggacggcgtgcag-cgcaaccacgag-----accgccttc
                              *      *                                    

A0A5F5Y6Y3_BCL2-02      --------cacctggatccaagacaac-----------------------
A0A5F5Y6Y3_BCL2-01      --------cacctggatccaagacaac-----------------------
Q8I008_BCL2-01          --------cacctggatccaggataac-----------------------
M3WHW2_BCL2A1-01        --------agaatggatccggcaaaac-----------------------
Q8SQ42_BCL2L1-01        --------gccttggatccaggagaac-----------------------
A0A5F5XYW0_BCL2L1-      --------gccttggatccaggagaac-----------------------
A0A5F5XYW0_BCL2L1-      --------gccttggatccaggagaac-----------------------
A0A5F5XYW0_BCL2L1-      --------gccttggatccaggagaac-----------------------
A0A337RYG8_BCL2L10      --------gctctgcaatcggctcacc--------ggacggcatcgcgcc
A0A2I2UAE3_BCL2L2-      aca-----gcagtgggggctgggcg--------------gagttcacagc
A0A337S3J9_MCL1-02      caaggcatgcttcggaaactggacatcaaaaacgaaaacgatgtcaaatc
A0A337S3J9_MCL1-01      caaggcatgcttcggaaactggacatcaaaaacgaaaacgatgtcaaatc
Q7YRZ9_MCL1-01          caaggcatgcttcggaaactggacatcaaaaacgaaaacgatgtcaaatc
A0A337S3J9_MCL1-03      caaggcatgcttcggaaactggacatcaaaaacgaaaacgatgtcaaatc
A0A337S3J9_MCL1-04      caaggcatgcttcggaaactggacatcaaaaacgaaaacgatgtcaaatc
                                     *    *                               

A0A5F5Y6Y3_BCL2-02      -------------------------------ggagg---------ctgg-
A0A5F5Y6Y3_BCL2-01      -------------------------------ggagg---------ctggg
Q8I008_BCL2-01          -------------------------------ggagg---------ctggg
M3WHW2_BCL2A1-01        -------------------------------ggagg---------ctggg
Q8SQ42_BCL2L1-01        -------------------------------ggcgg---------ctggg
A0A5F5XYW0_BCL2L1-      -------------------------------ggcgg---------ctggg
A0A5F5XYW0_BCL2L1-      -------------------------------ggcgg---------ctggg
A0A5F5XYW0_BCL2L1-      -------------------------------ggcgg---------ctggg
A0A337RYG8_BCL2L10      t-------ggctggaggctcac---------gacgg---------ctggg
A0A2I2UAE3_BCL2L2-      tctata---------------------cggggacggggc-----cctgga
A0A337S3J9_MCL1-02      tttgtctcgagtgatggtccatgttttcagtgacggagtaacaaactggg
A0A337S3J9_MCL1-01      tttgtctcgagtgatggtccatgttttcagtgacggagtaacaaactggg
Q7YRZ9_MCL1-01          tttgtctcgagtgatggtccatgttttcagtgacggagtaacaaactggg
A0A337S3J9_MCL1-03      tttgtctcgagtgatggtccatgttttcagtgacggagtaacaaactggg
A0A337S3J9_MCL1-04      tttgtctcgagtgatggtccatgttttcagtgacggagtaacaaactggg
                                                       *  **         **** 

A0A5F5Y6Y3_BCL2-02      --------------------------------------------------
A0A5F5Y6Y3_BCL2-01      at---------------------------gcctttgtgg-----------
Q8I008_BCL2-01          at---------------------------gcctttgtgg-----------
M3WHW2_BCL2A1-01        aaaac------------------------ggctttgtaa----------g
Q8SQ42_BCL2L1-01        at---------------------------acttttgtggaactctacggg
A0A5F5XYW0_BCL2L1-      tt---------------------------gttattgagcaccaacggtgt
A0A5F5XYW0_BCL2L1-      ac---------------------------acttttgtggaactctacggg
A0A5F5XYW0_BCL2L1-      --------------------------------------------------
A0A337RYG8_BCL2L10      at-ggcttttgtctcttcttctc------acccatgctgccatcttcttg
A0A2I2UAE3_BCL2L2-      ggaggcgcg--------------------gcgtctgcgg-----------
A0A337S3J9_MCL1-02      gcaggattgtgactcttatttcttttggtgcctttgtggccaaacacttg
A0A337S3J9_MCL1-01      gcaggattgtgactcttatttcttttggtgcctttgtggccaaacacttg
Q7YRZ9_MCL1-01          gcaggattgtgactcttatttcttttggtgcctttgtggccaaacacttg
A0A337S3J9_MCL1-03      gcaggattgtgactcttatttcttttggtgcctttgtggccaaacacttg
A0A337S3J9_MCL1-04      gcaggattgtgactcttatttcttttggtgcctttgtggccaaacacttg
                                                                          

A0A5F5Y6Y3_BCL2-02      -----------ctaatcttgctgcctcgtac-------------------
A0A5F5Y6Y3_BCL2-01      aactgtacggccccagcatgcagcctc-----------------------
Q8I008_BCL2-01          aactgtacggccccagcatgcagcctc-----------------------
M3WHW2_BCL2A1-01        gaagttcgaacccaagtctggctggctgacc-------------------
Q8SQ42_BCL2L1-01        aacaatgcagcagccgagagccggaagggccaggagcgctccaac-----
A0A5F5XYW0_BCL2L1-      gcca-------ggctctgtgctccacagggt------gcacacagcccag
A0A5F5XYW0_BCL2L1-      aacaatgcagcggccgagagccggaagggccaggtcagaacaaacgccga
A0A5F5XYW0_BCL2L1-      -------------------tctggactggct-------------------
A0A337RYG8_BCL2L10      ga----------gaagactgctg-gtccagg-------------------
A0A2I2UAE3_BCL2L2-      ------------gaggggaactg---------------------------
A0A337S3J9_MCL1-02      aagagtataaaccaagaaagctgcatcgaac-------------------
A0A337S3J9_MCL1-01      aagagtataaaccaagaaagctgcatcgaac-------------------
Q7YRZ9_MCL1-01          aagagtataaaccaagaaagctgcatcgaac-------------------
A0A337S3J9_MCL1-03      aagagtataaaccaagaaagctgcatcgaac-------------------
A0A337S3J9_MCL1-04      aagagtataaaccaagaaagctgcatcgaac-------------------
                                                                          

A0A5F5Y6Y3_BCL2-02      ---------------------------------------------ctcgt
A0A5F5Y6Y3_BCL2-01      -----------------------------------------------tgt
Q8I008_BCL2-01          -----------------------------------------------tgt
M3WHW2_BCL2A1-01        ----------------------------------------------tttc
Q8SQ42_BCL2L1-01        -----------------------------------------cgctggttc
A0A5F5XYW0_BCL2L1-      aacaaagcagcccatggag----------------------cacctcttc
A0A5F5XYW0_BCL2L1-      aacagagctgccacagagagtttgtccggtcctggggacgacgccttgcc
A0A5F5XYW0_BCL2L1-      -----------------------------------------tattttacc
A0A337RYG8_BCL2L10      -----------------------------------------ctcttctgt
A0A2I2UAE3_BCL2L2-      --------------------------------------------------
A0A337S3J9_MCL1-02      -----------------------------------------cattagcag
A0A337S3J9_MCL1-01      -----------------------------------------cattagcag
Q7YRZ9_MCL1-01          -----------------------------------------cattagcag
A0A337S3J9_MCL1-03      -----------------------------------------cattagcag
A0A337S3J9_MCL1-04      -----------------------------------------cattagcag
                                                                          

A0A5F5Y6Y3_BCL2-02      atgaattaaaaagctcccgggctctccgtgaagac---------------
A0A5F5Y6Y3_BCL2-01      ttgattt-------ctcctggctgtccctgaaggccctgctcagtctggc
Q8I008_BCL2-01          ttgattt-------ctcctggctgtccctgaaggccctgctcagtctggc
M3WHW2_BCL2A1-01        tggaagt-------taca---------ggaaaga----------------
Q8SQ42_BCL2L1-01        ctga------------ca---------ggcatga----------------
A0A5F5XYW0_BCL2L1-      tagagaa-------agga---------gacacga-----------cggac
A0A5F5XYW0_BCL2L1-      tggattt-------cgct---------gggacgggaagggactgttggcc
A0A5F5XYW0_BCL2L1-      ctgagtt-------c-ct---------ggcacag------------ggcc
A0A337RYG8_BCL2L10      catgctt-------taca---------gtaatga----------------
A0A2I2UAE3_BCL2L2-      --ggcct-------ca-----------gtgaggacagtgctgacaggggc
A0A337S3J9_MCL1-02      aaagcat-------cacagatgttcttgtaaggacaaaacgagactggct
A0A337S3J9_MCL1-01      aaagcat-------cacagatgttcttgtaaggacaaaacgagactggct
Q7YRZ9_MCL1-01          aaagcat-------cacagatgttcttgtaaggacaaaacgagactggct
A0A337S3J9_MCL1-03      aaagcat-------cacagatgttcttgtaaggacaaaacgagactggct
A0A337S3J9_MCL1-04      aaagcat-------cacagatgttcttgtaaggacaaaacgagactggct
                                                      *                   

A0A5F5Y6Y3_BCL2-02      ------------------------gtaagaatt------------tcacc
A0A5F5Y6Y3_BCL2-01      c--------------------ctggtgggggcttg--------catcacc
Q8I008_BCL2-01          c--------------------ctggtgggggcttg--------catcacc
M3WHW2_BCL2A1-01        ---------------------tctgtaaggtattg---------------
Q8SQ42_BCL2L1-01        ---------------------ctgtggctggcgtgg-----ttctgct--
A0A5F5XYW0_BCL2L1-      aaggaaacaaacaagattgttccggggataaattg------ttctgcaac
A0A5F5XYW0_BCL2L1-      tggaaggtggaggaaacctcctttgggcgggtctgacca--ctctgca--
A0A5F5XYW0_BCL2L1-      tg--aggttgggtaa-------------gggcttggccagcatctgct--
A0A337RYG8_BCL2L10      ---------------------tcttaatctacttc---------------
A0A2I2UAE3_BCL2L2-      cgtggcactgggggc------cctgg---taactg---------------
A0A337S3J9_MCL1-02      agtcaaacaaagagg------ctggggc----------------------
A0A337S3J9_MCL1-01      agtcaaacaaagagg------ctgggatgggtttg---------------
Q7YRZ9_MCL1-01          agtcaaacaaagagg------ctgggatgggtttg---------------
A0A337S3J9_MCL1-03      agtcaaacaaagagg------ctgggatgggtttg---------------
A0A337S3J9_MCL1-04      agtcaaacaaagagg------ctgggatgggtttg---------------
                                                                          

A0A5F5Y6Y3_BCL2-02      ct-----cttttctttttaaag---------------------actag--
A0A5F5Y6Y3_BCL2-01      ctgggtgcctatctgggccaca---------------------agtga--
Q8I008_BCL2-01          ctgggtgcctatctgggccaca---------------------agtga--
M3WHW2_BCL2A1-01        ------tctctcctgaagaactact------------------actga--
Q8SQ42_BCL2L1-01        gggctcactcttcagtcggaaa-----------------------tga--
A0A5F5XYW0_BCL2L1-      caactacccc--------aaaacttaa----------------gctaa--
A0A5F5XYW0_BCL2L1-      cagctcccgtcccagggcagaagttcccggaggagggggcggtgctga--
A0A5F5XYW0_BCL2L1-      caatgaacat---------gaggttattattagatgcag----gttag--
A0A337RYG8_BCL2L10      tggagaagattattg------------------------------tga--
A0A2I2UAE3_BCL2L2-      taggggccttttttg--------ctagca--------------agtga--
A0A337S3J9_MCL1-02      ---------------------------aa--------------ggaggcc
A0A337S3J9_MCL1-01      tggagttcttccatgtagaggacctagaa--------------ggtgg--
Q7YRZ9_MCL1-01          tggagttcttccatgtagaggacctagaa--------------ggtggca
A0A337S3J9_MCL1-03      tggagttcttccatgtagaggacctagaa--------------ggtggca
A0A337S3J9_MCL1-04      tggagttcttccatgtagaggacctagaa--------------ggtggca
                                                                          

A0A5F5Y6Y3_BCL2-02      --------------------------------------------------
A0A5F5Y6Y3_BCL2-01      --------------------------------------------------
Q8I008_BCL2-01          --------------------------------------------------
M3WHW2_BCL2A1-01        --------------------------------------------------
Q8SQ42_BCL2L1-01        --------------------------------------------------
A0A5F5XYW0_BCL2L1-      --------------------------------------------------
A0A5F5XYW0_BCL2L1-      --------------------------------------------------
A0A5F5XYW0_BCL2L1-      --------------------------------------------------
A0A337RYG8_BCL2L10      --------------------------------------------------
A0A2I2UAE3_BCL2L2-      --------------------------------------------------
A0A337S3J9_MCL1-02      ccaacttctctctgcttggcccatttgctgtgttcagagcaggtg-----
A0A337S3J9_MCL1-01      -------------------------agataaggcttga------------
Q7YRZ9_MCL1-01          tcagaaatgtgctgctggcttttgcaggtgttgctggagtaggagctggt
A0A337S3J9_MCL1-03      tcagaaatgtgctgctggcttttgcaggtgttgctggagtaggagctggt
A0A337S3J9_MCL1-04      tcagaaatgtgctgctggcttttgcaggtgttgctggagtaggagctggt
                                                                          

A0A5F5Y6Y3_BCL2-02      ---------------------
A0A5F5Y6Y3_BCL2-01      ---------------------
Q8I008_BCL2-01          ---------------------
M3WHW2_BCL2A1-01        ---------------------
Q8SQ42_BCL2L1-01        ---------------------
A0A5F5XYW0_BCL2L1-      ---------------------
A0A5F5XYW0_BCL2L1-      ---------------------
A0A5F5XYW0_BCL2L1-      ---------------------
A0A337RYG8_BCL2L10      ---------------------
A0A2I2UAE3_BCL2L2-      ---------------------
A0A337S3J9_MCL1-02      ------------------tag
A0A337S3J9_MCL1-01      ---------------------
Q7YRZ9_MCL1-01          ttggcatatctaataagatag
A0A337S3J9_MCL1-03      ttggcatatctaataagatag
A0A337S3J9_MCL1-04      ttggcatatctaataagatag
                                             

© 1998-2022Legal notice