Dataset for CDS BCL-2-like of organism Felis catus

[Download (right click)] [Edit] [Sequences] [Repertoires]

13 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


M3X1R9_BCL2-02          atgg----cgcacgctgggagaacagggtatgataaccgggagata----
M3X1R9_BCL2-01          atgg----cgcacgctgggagaacagggtatgataaccgggagata----
Q8I008_BCL2-01          atgg----cgcacgctgggagaacagggtatgataaccgggagata----
Q8SQ42_BCL2L1-01        atgt----------------------ctcagagcaaccgggagctg----
M3XA94_BCL2L1-01        atgt----------------------ctcagagcaaccgggagctg----
M3XA94_BCL2L1-03        atgt----------------------ctcagagcaaccgggagctg----
M3XA94_BCL2L1-02        atgt----------------------ctcagagcaaccgggagctg----
A0A337RYG8_BCL2L10      atgg------------------ctgacgcg--------------------
A0A2I2UAE3_BCL2L2-      atggcgaccccagcctcagccccagacaca-------cgggctcta----
A0A337S3J9_MCL1-01      atg-----tttggcctcaa---gagaaacgctgtaatcggactcaacctc
Q7YRZ9_MCL1-01          atg-----tttggcctcaa---gagaaacgctgtaatcggactcaacctc
A0A337S3J9_MCL1-04      atg-----tttggcctcaa---gagaaacgctgtaatcggactcaacctc
A0A337S3J9_MCL1-03      atg-----tttggcctcaa---gagaaacgctgtaatcggactcaacctc
                        ***                                               

M3X1R9_BCL2-02          ----gtcatgaagt----acatccactataagct-----------gtcgc
M3X1R9_BCL2-01          ----gtcatgaagt----acatccactataagct-----------gtcgc
Q8I008_BCL2-01          ----gtgatgaagt----acatccactatgagct-----------gccgc
Q8SQ42_BCL2L1-01        ----gtggttgact----ttctctcctacaagct-----------ttccc
M3XA94_BCL2L1-01        ----gtggttgact----ttctctcctacaagct-----------ttccc
M3XA94_BCL2L1-03        ----gtggttgact----ttctctcctacaagct-----------ttccc
M3XA94_BCL2L1-02        ----gtggttgact----ttctctcctacaagct-----------ttccc
A0A337RYG8_BCL2L10      ----ttgagggagc------------------------------------
A0A2I2UAE3_BCL2L2-      ----gtggcagact----ttgtaggctataagctgagg-----------c
A0A337S3J9_MCL1-01      tactgtgggggggccgggttggcggccgggagcggcggcgcctcctcttc
Q7YRZ9_MCL1-01          tactgtgggggggccgggttggcggccgggagcggcggcgcctcctcttc
A0A337S3J9_MCL1-04      tactgtgggggggccgggttggcggccgggagcggcggcgcctcctcttc
A0A337S3J9_MCL1-03      tactgtgggggggccgggttggcggccgggagcggcggcgcctcctcttc
                             *                                            

M3X1R9_BCL2-02          agaggggctacgagtgg------------gatgccggggacgcgggcgc-
M3X1R9_BCL2-01          agaggggctacgagtgg------------gatgccggggacgcgggcgc-
Q8I008_BCL2-01          agaggggctacgagtgg------------gatgccggggacgcgggcgc-
Q8SQ42_BCL2L1-01        agaaaggatacagctggagtcggtttagtgatgtggaagagaacagaac-
M3XA94_BCL2L1-01        agaaaggatacagctggagtcagtttagtgatgtggaagagaacagaac-
M3XA94_BCL2L1-03        agaaaggatacagctggagtcagtttagtgatgtggaagagaacagaac-
M3XA94_BCL2L1-02        agaaaggatacagctggagtcagtttagtgatgtggaagagaacagaac-
A0A337RYG8_BCL2L10      --------------------------------------------------
A0A2I2UAE3_BCL2L2-      agaaggg-----------------ttatgtttgtggagca----------
A0A337S3J9_MCL1-01      gggaggg-------------cggcttgtggctgtggggaaggaggccacg
Q7YRZ9_MCL1-01          gggaggg-------------cggcttgtggctgtggggaaggaggccacg
A0A337S3J9_MCL1-04      gggaggg-------------cggcttgt----------------------
A0A337S3J9_MCL1-03      gggaggg-------------cggcttgtggctgtggggaaggaggccacg
                                                                          

M3X1R9_BCL2-02          --------------------------------------------------
M3X1R9_BCL2-01          --------------------------------------------------
Q8I008_BCL2-01          --------------------------------------------------
Q8SQ42_BCL2L1-01        --------------------------------------------------
M3XA94_BCL2L1-01        --------------------------------------------------
M3XA94_BCL2L1-03        --------------------------------------------------
M3XA94_BCL2L1-02        --------------------------------------------------
A0A337RYG8_BCL2L10      --------------------------------------------------
A0A2I2UAE3_BCL2L2-      --------------------------------------------------
A0A337S3J9_MCL1-01      gccaggcgagaggtagggggaggggaagccggtgcggtgattggcggaag
Q7YRZ9_MCL1-01          gccaggcgagaggtagggggaggggaagccggtgcggtgattggcggaag
A0A337S3J9_MCL1-04      --------------------------------------------------
A0A337S3J9_MCL1-03      gccaggcgagaggtagggggaggggaagccggtgcggtgattggcggaag
                                                                          

M3X1R9_BCL2-02          --------------------------------------------------
M3X1R9_BCL2-01          --------------------------------------------------
Q8I008_BCL2-01          --------------------------------------------------
Q8SQ42_BCL2L1-01        --------------------------------------------------
M3XA94_BCL2L1-01        --------------------------------------------------
M3XA94_BCL2L1-03        --------------------------------------------------
M3XA94_BCL2L1-02        --------------------------------------------------
A0A337RYG8_BCL2L10      --------------------------------------------------
A0A2I2UAE3_BCL2L2-      --------------------------------------------------
A0A337S3J9_MCL1-01      cgccggcgcgagccccccagccactctcgcgcccgacgcccggagggtcg
Q7YRZ9_MCL1-01          cgccggcgcgagccccccagccactctcgcgcccgacgcccggagggtcg
A0A337S3J9_MCL1-04      --------------------------------------------------
A0A337S3J9_MCL1-03      cgccggcgcgagccccccagccactctcgcgcccgacgcccggagggtcg
                                                                          

M3X1R9_BCL2-02          --------------------------------------------------
M3X1R9_BCL2-01          --------------------------------------------------
Q8I008_BCL2-01          --------------------------------------------------
Q8SQ42_BCL2L1-01        --------------------------------------------------
M3XA94_BCL2L1-01        --------------------------------------------------
M3XA94_BCL2L1-03        --------------------------------------------------
M3XA94_BCL2L1-02        --------------------------------------------------
A0A337RYG8_BCL2L10      --------------------------------------------------
A0A2I2UAE3_BCL2L2-      ---ggccctgg---------------------------------------
A0A337S3J9_MCL1-01      cgcggccctcgcccattggtgccgagggccccgacgtcaccgcgaccccc
Q7YRZ9_MCL1-01          cgcggccctcgcccattggtgccgagggccccgacgtcaccgcgaccccc
A0A337S3J9_MCL1-04      --------------------------------------------------
A0A337S3J9_MCL1-03      cgcggccctcgcccattggtgccgagggccccgacgtcaccgcgaccccc
                                                                          

M3X1R9_BCL2-02          --------------------------------------------------
M3X1R9_BCL2-01          --------------------------------------------------
Q8I008_BCL2-01          --------------------------------------------------
Q8SQ42_BCL2L1-01        --------------------------------------------------
M3XA94_BCL2L1-01        --------------------------------------------------
M3XA94_BCL2L1-03        --------------------------------------------------
M3XA94_BCL2L1-02        --------------------------------------------------
A0A337RYG8_BCL2L10      --------------------------------------------------
A0A2I2UAE3_BCL2L2-      --------------------------------------------------
A0A337S3J9_MCL1-01      ccgaagctgctgttcttcgcggccacccgctgtgcgtcgccgcctgaaaa
Q7YRZ9_MCL1-01          ccgaagctgctgttcttcgcggccacccgctgtgcgtcgccgcctgaaga
A0A337S3J9_MCL1-04      --------------------------------------------------
A0A337S3J9_MCL1-03      ccgaagctgctgttcttcgcggccacccgctgtgcgtcgccgcctgaaaa
                                                                          

M3X1R9_BCL2-02          ---cgcgcccccggggg---ccgcccccgcgccgggcatcttctc-----
M3X1R9_BCL2-01          ---cgcgcccccggggg---ccgcccccgcgccgggcatcttctc-----
Q8I008_BCL2-01          ---cgcgcccccggggg---ccgcccccgcgccgggcatcttctc-----
Q8SQ42_BCL2L1-01        ---tgaggccccagaagggactgaatcagagatggagacc----------
M3XA94_BCL2L1-01        ---tgaggccccagaagggactgaatcagagatggagacc----------
M3XA94_BCL2L1-03        ---tgaggccccagaagggactgaatcagagatggagacc----------
M3XA94_BCL2L1-02        ---tgaggccccagaagggactgaatcagagatggagacc----------
A0A337RYG8_BCL2L10      ---gcacggcgcagcta---ctga--------------------------
A0A2I2UAE3_BCL2L2-      ---ggagggcccagcag---ctga--------------------------
A0A337S3J9_MCL1-01      gatggaaggcccagccg---ccgacgccatcatgtcgcccgaagaggagc
Q7YRZ9_MCL1-01          gatggaaggcccagccg---ccgacgccatcatgtcgcccgaagaggagc
A0A337S3J9_MCL1-04      --------------------------------------------------
A0A337S3J9_MCL1-03      gatggaaggcccagccg---ccgacgccatcatgtcgcccgaagaggagc
                                                                          

M3X1R9_BCL2-02          --------------------------------------------------
M3X1R9_BCL2-01          --------------------------------------------------
Q8I008_BCL2-01          --------------------------------------------------
Q8SQ42_BCL2L1-01        --------------------------------------------------
M3XA94_BCL2L1-01        --------------------------------------------------
M3XA94_BCL2L1-03        --------------------------------------------------
M3XA94_BCL2L1-02        --------------------------------------------------
A0A337RYG8_BCL2L10      --------------------------------------------------
A0A2I2UAE3_BCL2L2-      --------------------------------------------------
A0A337S3J9_MCL1-01      tagacgggtacgagccagaacctctggggaagcggccggctgtcctgcct
Q7YRZ9_MCL1-01          tagacgggtacgagccagaacctctggggaagcggccggctgtcctgcct
A0A337S3J9_MCL1-04      --------------------------------------------------
A0A337S3J9_MCL1-03      tagacgggtacgagccagaacctctggggaagcggccggctgtcctgcct
                                                                          

M3X1R9_BCL2-02          -----------------------------------------------ctc
M3X1R9_BCL2-01          -----------------------------------------------ctc
Q8I008_BCL2-01          -----------------------------------------------ctc
Q8SQ42_BCL2L1-01        -----------------------------------------------ccc
M3XA94_BCL2L1-01        -----------------------------------------------ccc
M3XA94_BCL2L1-03        -----------------------------------------------ccc
M3XA94_BCL2L1-02        -----------------------------------------------ccc
A0A337RYG8_BCL2L10      -----------------------------------------------ctg
A0A2I2UAE3_BCL2L2-      -----------------------------------------------ccc
A0A337S3J9_MCL1-01      ttgctggagttggtcggggaggccagcagtggccccggcacagacggctc
Q7YRZ9_MCL1-01          ttgctggagttggtcggggaggccagcagtggccccggcacagacggctc
A0A337S3J9_MCL1-04      --------------------------------------------------
A0A337S3J9_MCL1-03      ttgctggagttggtcggggaggccagcagtggccccggcacagacggctc
                                                                          

M3X1R9_BCL2-02          ccagccc--------------------------------gggcgcacccc
M3X1R9_BCL2-01          ccagccc--------------------------------gggcgcacccc
Q8I008_BCL2-01          ccagccc--------------------------------gggcgcacccc
Q8SQ42_BCL2L1-01        agtgccatcaatgg-------------------------caacccatcct
M3XA94_BCL2L1-01        agtgccatcaatgg-------------------------caacccatcct
M3XA94_BCL2L1-03        agtgccatcaatgg-------------------------caacccatcct
M3XA94_BCL2L1-02        agtgccatcaatgg-------------------------caacccatcct
A0A337RYG8_BCL2L10      actacct--------------------------------ggagtactgcg
A0A2I2UAE3_BCL2L2-      actgcac--------------------------------caagccatgcg
A0A337S3J9_MCL1-01      actgccctcgacgccacccccagcagaggaggaggaggacgagttgttcc
Q7YRZ9_MCL1-01          actgccctcgacgccacccccagcagaggaggaggaggacgagttgttcc
A0A337S3J9_MCL1-04      --------------------------------------------------
A0A337S3J9_MCL1-03      actgccctcgacgccacccccagcagaggaggaggaggacgagttgttcc
                                                                          

M3X1R9_BCL2-02          tgcgcccgccaggacctccccgccgccgcccccggtcgcccccgccgccg
M3X1R9_BCL2-01          tgcgcccgccaggacctccccgccgccgcccccggtcgcccccgccgccg
Q8I008_BCL2-01          tgcgcccgccaggacctccccgccgccgcccccggtcgccc------ccg
Q8SQ42_BCL2L1-01        ggcacttggcagacag------------ccctgcggtgaatggagc-cac
M3XA94_BCL2L1-01        ggcacttggcggacag------------ccctgcggtgaatggagc-cac
M3XA94_BCL2L1-03        ggcacttggcggacag------------ccctgcggtgaatggagc-cac
M3XA94_BCL2L1-02        ggcacttggcggacag------------ccctgcggtgaatggagc-cac
A0A337RYG8_BCL2L10      cccgggagcccggcag-------------ccccgcgcggacgccgt-cca
A0A2I2UAE3_BCL2L2-      tgcag---ctggagat-------------------gagtttgagac-ccg
A0A337S3J9_MCL1-01      ggcagtcgctggagattatctctcggtaccttcgggagcaggcgac-cgg
Q7YRZ9_MCL1-01          ggcagtcgctggagattatctctcggtaccttcgggagcaggcgac-cgg
A0A337S3J9_MCL1-04      ----------------------------------------ggcgac-cgg
A0A337S3J9_MCL1-03      ggcagtcgctggagattatctctcggtaccttcgggagcaggcgac-cgg
                                                                       *  

M3X1R9_BCL2-02          ccgccgccgccgc-------cgccgcgggccctg--cgctcagccccgtg
M3X1R9_BCL2-01          ccgccgccgccgc-------cgccgcgggccctg--cgctcagccccgtg
Q8I008_BCL2-01          ccgccgccgccgc-------tgccgcgggccctg--cgctcagccccgtg
Q8SQ42_BCL2L1-01        tggccacagcagcag-----cttggatgcccggg--aggtgatccccatg
M3XA94_BCL2L1-01        tggccacagcagcag-----cttggatgcccggg--aggtgatccccatg
M3XA94_BCL2L1-03        tggccacagcagcag-----cttggatgcccggg--aggtgatccccatg
M3XA94_BCL2L1-02        tggccacagcagcag-----cttggatgcccggg--aggtgatccccatg
A0A337RYG8_BCL2L10      cgcccgaggccgcggtg---ctgcgct-acctgg------ccgcccagat
A0A2I2UAE3_BCL2L2-      cttccggcg-cac-------cttctctgatttgg------cagcccagtt
A0A337S3J9_MCL1-01      cgccaagga-cgcgaaaccactgggcgggtctggggcggccagccgaaag
Q7YRZ9_MCL1-01          cgccaagga-cgcgaaaccactgggcgggtctggggcggccagccgaaag
A0A337S3J9_MCL1-04      cgccaagga-cgcgaaaccactgggcgggtctggggcggccagccgaaag
A0A337S3J9_MCL1-03      cgccaagga-cgcgaaaccactgggcgggtctggggcggccagccgaaag
                           *        *                    *         **     

M3X1R9_BCL2-02          ccacctgtggtccacctgaccctgcgccaggccggcgatgacttctcccg
M3X1R9_BCL2-01          ccacctgtggtccacctgaccctgcgccaggccggcgatgacttctcccg
Q8I008_BCL2-01          ccacctgtggtccacctgaccctgcgccaggccggcgatgacttctcccg
Q8SQ42_BCL2L1-01        gcagcggtcaaacaagcg---ctgagggaggctggggatgagtttgaact
M3XA94_BCL2L1-01        gcagcggtgaagcaggcg---ctgagggaggccggggatgagtttgaact
M3XA94_BCL2L1-03        gcagcggtgaagcaggcg---ctgagggaggccggggatgagtttgaact
M3XA94_BCL2L1-02        gcagcggtgaagcaggcg---ctgagggaggccggggatgagtttgaact
A0A337RYG8_BCL2L10      acggcagcg--ccac-ca---gcgtttcttgtcgg---------------
A0A2I2UAE3_BCL2L2-      gcat--gtgacccc--------tg-----ggtcag---------------
A0A337S3J9_MCL1-01      gcgttagagaccctc-cg---acg-----ggtcggggacggcgtgcagc-
Q7YRZ9_MCL1-01          gcgttagagaccctc-cg---acg-----ggtcggggacggcgtgcagc-
A0A337S3J9_MCL1-04      gcgttagagaccctc-cg---acg-----ggtcggggacggcgtgcagc-
A0A337S3J9_MCL1-03      gcgttagagaccctc-cg---acg-----ggtcggggacggcgtgcagc-
                         *    *     *          *      *   *               

M3X1R9_BCL2-02          tcgctaccgccgcgacttcgcggagatgtccagccagctgcacctg----
M3X1R9_BCL2-01          tcgctaccgccgcgacttcgcggagatgtccagccagctgcacctg----
Q8I008_BCL2-01          tcgctaccgccgcgacttcgcggagatgtccagccagctgcacctg----
Q8SQ42_BCL2L1-01        gaggtaccggcgggcattcagtgacctgacatcccagcttcacatc----
M3XA94_BCL2L1-01        gaggtaccggcgggcattcagcgacctgacatcccagcttcacatc----
M3XA94_BCL2L1-03        gaggtaccggcgggcattcagcgacctgacatcccagcttcacatc----
M3XA94_BCL2L1-02        gaggtaccggcgggcattcagcgacctgacatcccagcttcacatc----
A0A337RYG8_BCL2L10      --------------------------------cttaccgcggctac----
A0A2I2UAE3_BCL2L2-      --------------------------------cccagcaacgcttc----
A0A337S3J9_MCL1-01      -------------gcaaccacgagaccgccttccaaggcatgcttcggaa
Q7YRZ9_MCL1-01          -------------gcaaccacgagaccgccttccaaggcatgcttcggaa
A0A337S3J9_MCL1-04      -------------gcaaccacgagaccgccttccaaggcatgcttcggaa
A0A337S3J9_MCL1-03      -------------gcaaccacgagaccgccttccaaggcatgcttcggaa
                                                           *      *       

M3X1R9_BCL2-02          -----------acaccctttaccgcaaggggac---gctttgccacggtg
M3X1R9_BCL2-01          -----------acaccctttaccgcaaggggac---gctttgccacggtg
Q8I008_BCL2-01          -----------acaccctttaccgcaaggggac---gctttgccacggtg
Q8SQ42_BCL2L1-01        -----------accccagggacagcat---atcagagctttgagcaggta
M3XA94_BCL2L1-01        -----------accccagggacagcat---atcagagctttgagcaggta
M3XA94_BCL2L1-03        -----------accccagggacagcat---atcagagctttgagcaggta
M3XA94_BCL2L1-02        -----------accccagggacagcat---atcagagctttgagcaggta
A0A337RYG8_BCL2L10      -------------cgcggaaaccgcgtggaactggtggcgcggtt-ggag
A0A2I2UAE3_BCL2L2-      ------------------------------acccaggtctctgat-ga--
A0A337S3J9_MCL1-01      actggacatcaaaaacgaaaacgatgtcaaatctttgtctcgagt-gatg
Q7YRZ9_MCL1-01          actggacatcaaaaacgaaaacgatgtcaaatctttgtctcgagt-gatg
A0A337S3J9_MCL1-04      actggacatcaaaaacgaaaacgatgtcaaatctttgtctcgagt-gatg
A0A337S3J9_MCL1-03      actggacatcaaaaacgaaaacgatgtcaaatctttgtctcgagt-gatg
                                                            *         *   

M3X1R9_BCL2-02          gtggaggagctcttcagggatggag---tgaactgggggaggattgtggc
M3X1R9_BCL2-01          gtggaggagctcttcagggatggag---tgaactgggggaggattgtggc
Q8I008_BCL2-01          gtggaggagctcttcagggatggcg---tgaactgggggaggattgtggc
Q8SQ42_BCL2L1-01        gtgaatgaactcttccgggatgggg---tgaactggggtcgcattgtggc
M3XA94_BCL2L1-01        gtgaacgaactcttccgggatgggg---tgaactggggtcgcattgtggc
M3XA94_BCL2L1-03        gtgaacgaactcttccgggatgggg---tgaactggggtcgcattgtggc
M3XA94_BCL2L1-02        gtgaacgaactcttccgggatgggg---tgaactggggtcgcattgtggc
A0A337RYG8_BCL2L10      caggatttactctccaacccccaaaccctcagttggggccatgtggtagc
A0A2I2UAE3_BCL2L2-      ----act---cttccaa----gggggccccaactggggccgccttgtggc
A0A337S3J9_MCL1-01      gtccatg---ttttcagtgacggagtaacaaactggggcaggattgtgac
Q7YRZ9_MCL1-01          gtccatg---ttttcagtgacggagtaacaaactggggcaggattgtgac
A0A337S3J9_MCL1-04      gtccatg---ttttcagtgacggagtaacaaactggggcaggattgtgac
A0A337S3J9_MCL1-03      gtccatg---ttttcagtgacggagtaacaaactggggcaggattgtgac
                            *       * *               *  *****     * **  *

M3X1R9_BCL2-02          cttctttgagttcggtggggtcatgtgtg----------tggagagcgtc
M3X1R9_BCL2-01          cttctttgagttcggtggggtcatgtgtg----------tggagagcgtc
Q8I008_BCL2-01          cttctttgagttcggtggggtcatgtgtg----------tggagggcgtc
Q8SQ42_BCL2L1-01        ctttttctccttcggtggggcactgtgcg----------tggagagcgta
M3XA94_BCL2L1-01        ctttttctccttcggtggggcactgtgcg----------tggaaagcgta
M3XA94_BCL2L1-03        ctttttctccttcggtggggcactgtgcg----------tggaaagcgta
M3XA94_BCL2L1-02        ctttttctccttcggtggggcactgtgcg----------tggaaagcgta
A0A337RYG8_BCL2L10      gctcttgaccttcgcggggacgctgc-------------tggagag-acc
A0A2I2UAE3_BCL2L2-      cttctttgtctttggagccgcactgtgtg----------ctgagagtgtc
A0A337S3J9_MCL1-01      tcttatttcttttggtgc----ctttgtggccaaacacttgaagagtata
Q7YRZ9_MCL1-01          tcttatttcttttggtgc----ctttgtggccaaacacttgaagagtata
A0A337S3J9_MCL1-04      tcttatttcttttggtgc----ctttgtggccaaacacttgaagagtata
A0A337S3J9_MCL1-03      tcttatttcttttggtgc----ctttgtggccaaacacttgaagagtata
                          *  *    ** *  *      *                  *  *    

M3X1R9_BCL2-02          aaccgagag------atgtcgcccctggtggacaacatcgccctgtggat
M3X1R9_BCL2-01          aaccgagag------atgtcgcccctggtggacaacatcgccctgtggat
Q8I008_BCL2-01          aaccgagag------atgtcgcccctggtggacaacatcgccctgtggat
Q8SQ42_BCL2L1-01        gacaaggag------atgcaggtattggtgagtcggatcgcagcttggat
M3XA94_BCL2L1-01        gacaaggag------atgcaggtattggtgagtcggatcgcaacttggat
M3XA94_BCL2L1-03        gacaaggag------atgcaggtattggtgagtcggatcgcaacttggat
M3XA94_BCL2L1-02        gacaaggag------atgcaggtattggtgagtcggatcgcaacttggat
A0A337RYG8_BCL2L10      gccgccggggacctacttgaacctgacgccggaccagca--acaggagct
A0A2I2UAE3_BCL2L2-      aacaaggag------atggagccacttgtgggacaagtgcaagagtggat
A0A337S3J9_MCL1-01      aaccaagaaagctgcatcgaaccattagcaga--aagcatcacagatgtt
Q7YRZ9_MCL1-01          aaccaagaaagctgcatcgaaccattagcaga--aagcatcacagatgtt
A0A337S3J9_MCL1-04      aaccaagaaagctgcatcgaaccattagcaga--aagcatcacagatgtt
A0A337S3J9_MCL1-03      aaccaagaaagctgcatcgaaccattagcaga--aagcatcacagatgtt
                          *   *         *          *                   * *

M3X1R9_BCL2-02          gactgagtacctgaaccggcacctgcacacctggatccaagacaacggag
M3X1R9_BCL2-01          gactgagtacctgaaccggcacctgcacacctggatccaagacaacggag
Q8I008_BCL2-01          gactgagtacctgaaccggcacctgcacacctggatccaggataacggag
Q8SQ42_BCL2L1-01        ggccacttacctgaatgaccacctagagccttggatccaggagaacggcg
M3XA94_BCL2L1-01        ggccacttacctgaacgaccacctagagccttggatccaggagaacggcg
M3XA94_BCL2L1-03        ggccacttacctgaacgaccacctagagccttggatccaggagaacggcg
M3XA94_BCL2L1-02        ggccacttacctgaacgaccacctagagccttggatccaggagaacggcg
A0A337RYG8_BCL2L10      ggag--------tgggagaccaacgttggccaggactgccagcacctggt
A0A2I2UAE3_BCL2L2-      ggtggcctacctggagacacggctggccgactggattcacagcagtgggg
A0A337S3J9_MCL1-01      cttg-------taaggacaaaacga---gactggctagtcaaacaaagag
Q7YRZ9_MCL1-01          cttg-------taaggacaaaacga---gactggctagtcaaacaaagag
A0A337S3J9_MCL1-04      cttg-------taaggacaaaacga---gactggctagtcaaacaaagag
A0A337S3J9_MCL1-03      cttg-------taaggacaaaacga---gactggctagtcaaacaaagag
                                                        **             *  

M3X1R9_BCL2-02          g--------ctgg------------------------ctaa---------
M3X1R9_BCL2-01          g--------ctgggatgcctttgtggaactgtacggcccca---------
Q8I008_BCL2-01          g--------ctgggatgcctttgtggaactgtacggcccca---------
Q8SQ42_BCL2L1-01        g--------ctgggatacttttgtggaactctacgggaacaatgcagcag
M3XA94_BCL2L1-01        g--------ctgggttgttattgagcaccaacggtgtgcca-------gg
M3XA94_BCL2L1-03        g--------ctggg------------------------------------
M3XA94_BCL2L1-02        g--------ctgggacacttttgtggaactctacgggaacaatgcagcgg
A0A337RYG8_BCL2L10      ggctttgctctgcaatcggctcaccggacggcatcgcgcct---------
A0A2I2UAE3_BCL2L2-      g--------ctgggcggagttcacagctctatacggggacg---------
A0A337S3J9_MCL1-01      g--------ctgggatgggtttgtggagttcttccatgtag---------
Q7YRZ9_MCL1-01          g--------ctgggatgggtttgtggagttcttccatgtag---------
A0A337S3J9_MCL1-04      g--------ctgggatgggtttgtggagttcttccatgtag---------
A0A337S3J9_MCL1-03      g--------ctgggatgggtttgtggagttcttccatgtag---------
                        *        ***                                      

M3X1R9_BCL2-02          --------------------------------------------------
M3X1R9_BCL2-01          --------------------------------------------------
Q8I008_BCL2-01          --------------------------------------------------
Q8SQ42_BCL2L1-01        ccgagagccggaagggccaggagcgctccaac------------------
M3XA94_BCL2L1-01        ctctgtgctccacagggt------gcacacagcccagaacaaagcagccc
M3XA94_BCL2L1-03        ------tctggactggct--------------------------------
M3XA94_BCL2L1-02        ccgagagccggaagggccaggtcagaacaaacgccgaaacagagctgcca
A0A337RYG8_BCL2L10      --gg---ctggagg------------------------------------
A0A2I2UAE3_BCL2L2-      --gggccctggaggaggc--------------------------------
A0A337S3J9_MCL1-01      --aggacctagaag------------------------------------
Q7YRZ9_MCL1-01          --aggacctagaag------------------------------------
A0A337S3J9_MCL1-04      --aggacctagaag------------------------------------
A0A337S3J9_MCL1-03      --aggacctagaag------------------------------------
                                                                          

M3X1R9_BCL2-02          -----------------------------------tcttgctgcctcgta
M3X1R9_BCL2-01          -----------------------------------gcatgcagcctc---
Q8I008_BCL2-01          -----------------------------------gcatgcagcctc---
Q8SQ42_BCL2L1-01        ----------------------------cgctggttcctga-----cagg
M3XA94_BCL2L1-01        atggag----------------------cacctcttctagagaaaggaga
M3XA94_BCL2L1-03        ----------------------------tattttaccctgagttc-ctgg
M3XA94_BCL2L1-02        cagagagtttgtccggtcctggggacgacgccttgcctggatttcgctgg
A0A337RYG8_BCL2L10      ------------------------------------ctcacgacggctgg
A0A2I2UAE3_BCL2L2-      ------------------------------gcggcgtctgcgggagggga
A0A337S3J9_MCL1-01      ---------------------------------------gtgg-------
Q7YRZ9_MCL1-01          ---------------------------------------gtggcatcaga
A0A337S3J9_MCL1-04      ---------------------------------------gtggcatcaga
A0A337S3J9_MCL1-03      ---------------------------------------gtggcatcaga
                                                                          

M3X1R9_BCL2-02          cctcg---------tatgaattaaaaagctcccgggctctccgtgaagac
M3X1R9_BCL2-01          ---tg---------tttgattt-------ctcctggctgtccctgaaggc
Q8I008_BCL2-01          ---tg---------tttgattt-------ctcctggctgtccctgaaggc
Q8SQ42_BCL2L1-01        catga-------------------------------------ctgtggct
M3XA94_BCL2L1-01        cacga-----------cggacaaggaaacaaacaagattgttccggggat
M3XA94_BCL2L1-03        cacag------------ggcctg--aggttgggtaa-------------g
M3XA94_BCL2L1-02        gacgggaagggactgttggcctggaaggtggaggaaacctcctttgggcg
A0A337RYG8_BCL2L10      gatggcttttgtctcttcttctcacccatgctgccatcttcttggagaag
A0A2I2UAE3_BCL2L2-      actgg-------------------------------gcctcagtgaggac
A0A337S3J9_MCL1-01      --------------------------------------------------
Q7YRZ9_MCL1-01          aatgt-------------------------------gctgctg-------
A0A337S3J9_MCL1-04      aatgt-------------------------------gctgctg-------
A0A337S3J9_MCL1-03      aatgt-------------------------------gctgctg-------
                                                                          

M3X1R9_BCL2-02          -------------------gta----agaatt----tcaccct-----ct
M3X1R9_BCL2-01          cctgctcagtctggccctggtg----ggggcttgcatcaccctgggtgcc
Q8I008_BCL2-01          cctgctcagtctggccctggtg----ggggcttgcatcaccctgggtgcc
Q8SQ42_BCL2L1-01        ggcgtgg----------ttctgct--gggctcactcttcagtcggaaa--
M3XA94_BCL2L1-01        aaattg-----------ttctgcaaccaactacccc--------aaaact
M3XA94_BCL2L1-03        ggcttggccag-----catctgct--caatgaacat---------gaggt
M3XA94_BCL2L1-02        ggtctgacca-------ctctgca--cagctcccgtcccagggcagaagt
A0A337RYG8_BCL2L10      actgctggtccaggctcttctgtca-tgctttacagtaatgatcttaatc
A0A2I2UAE3_BCL2L2-      agtgctgacaggggccgtggcactg-ggggccctggtaactgtaggggcc
A0A337S3J9_MCL1-01      ---------ag-----ataaggctt-ga----------------------
Q7YRZ9_MCL1-01          -gcttttgcag-----gtgttgctg-gag----taggagctggtttggca
A0A337S3J9_MCL1-04      -gcttttgcag-----gtgttgctg-gag----taggagctggtttggca
A0A337S3J9_MCL1-03      -gcttttgcag-----gtgttgctg-gag----taggagctggtttggca
                                                                          

M3X1R9_BCL2-02          tttctttttaaaga------ctag
M3X1R9_BCL2-01          tatctgggccacaa------gtga
Q8I008_BCL2-01          tatctgggccacaa------gtga
Q8SQ42_BCL2L1-01        ---------------------tga
M3XA94_BCL2L1-01        taa----------------gctaa
M3XA94_BCL2L1-03        tattattagatgcag----gttag
M3XA94_BCL2L1-02        tcccggaggagggggcggtgctga
A0A337RYG8_BCL2L10      tacttctggagaagattattgtga
A0A2I2UAE3_BCL2L2-      ttttttgctagcaa------gtga
A0A337S3J9_MCL1-01      ------------------------
Q7YRZ9_MCL1-01          tatctaataagata------g---
A0A337S3J9_MCL1-04      tatctaataagata------g---
A0A337S3J9_MCL1-03      tatctaataagata------g---
                                                

© 1998-2020Legal notice