Dataset for CDS BAX of Organism Cyanoderma ruficeps

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|A0A8C3R8A1_BAX-01 BCL2-associated X gene OS=[Eukaryota] Cyanoderma ruficeps GN=BAX (length=561 residues).
atggcggcggcggcggcttcggcccagcggggcgggggcggcggcggcggcggcgatcccggggccgggcctgggggcgg
ctccggcgagcccgccccacccccggggggcggcggtgagcggaggggctggcgggaccccagccccgacaccaaacgcc
tcagcgagtgcctgcggcgcatcggcgacgagctcgacagcaacatggagctgcagaggatgatcgagcaggtgggctgt
gacgcccccaaaaagctgttcttccgcgtggccaaggagatgttcgccgacggcaccttcaactggggccgcgtggtcgc
cctgttctacttcgcctgcaaactggtgctgaaggctctctgcaccaaggtgcccgagctggtgcagaccatcctgcgct
ggaccatggagtatctccaggagcacgtgctggcctggatccaggcccagggcggatgggaagggctcctgtcccacttt
gggacccccacctggcagaccatcaccatcttcgccgccggcgtcctcacagcctcgctgaccatctggaagatgtcgta
g
© 1998-2023Legal notice