Dataset for CDS BCL2L2 of organism Pan troglodytes

[Download (right click)] [Edit] [Sequences] [Repertoires]

4 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


H2Q805_BCL2L2-03      atggcggcggcggcggcggcggcagcagcagcgggggctgcgggcggtc-
H2Q805_BCL2L2-04      atggcggcggcggcggcggcggcagcagcagcgggggctgcgggcggtc-
H2Q805_BCL2L2-01      atggcgaccccagcctcagccccagacaca-cgggctctggtggcagact
H2Q805_BCL2L2-02      atggcgaccccagcctcagccccagacaca-cgggctctggtggcagact
                      ****** *  * **  * **  ***   ** ****  ***  *** * * 

H2Q805_BCL2L2-03      ---ggggctccgggccggggcggcggcgccatcttgtgcccggggccggt
H2Q805_BCL2L2-04      ---ggggctccgggccggggcggcggcgccatcttgtgcccggggccggt
H2Q805_BCL2L2-01      ttgtaggttataagctgaggcagaagggtta---tgtctgtggagctggc
H2Q805_BCL2L2-02      ttgtaggttataagctgaggcagaagggtta---tgtctgtggagctggc
                           ** *    ** * *** *  * *  *   ***    ** ** ** 

H2Q805_BCL2L2-03      ----ggggaggccggggagggggccccggggggcgcaggggactacggga
H2Q805_BCL2L2-04      ----ggggaggccggggagggggccccggggggcgcaggggactacggga
H2Q805_BCL2L2-01      cccggggagggcccagcagctgaccc-----gctgcaccaagccatgcgg
H2Q805_BCL2L2-02      cccggggagggcccagcagctgaccc-----gctgcaccaagccatgcgg
                          ***  ****  * **  * ***     *  ***     * * * * 

H2Q805_BCL2L2-03      acggcctg----gagtctgag------------------------gaact
H2Q805_BCL2L2-04      acggcctg----gagtctgag------------------------gaact
H2Q805_BCL2L2-01      gcagctggagatgagttcgagacccgcttccggcgcaccttctctgatct
H2Q805_BCL2L2-02      gcagctggagatgagttcgagacccgcttccggcgcaccttctctgatct
                       * **  *    ****  ***                        ** **

H2Q805_BCL2L2-03      ggagcctgaggagctgctgctggagcccgagccggagcccgagcccgaag
H2Q805_BCL2L2-04      ggagcctgagga--------------------------------------
H2Q805_BCL2L2-01      ggcggctcagctgcatgtg-----------accccaggctcagcccaaca
H2Q805_BCL2L2-02      ggcggctcagctgcatgtg-----------accccaggctcagcccaaca
                      ** * ** **                                        

H2Q805_BCL2L2-03      aggagccgccccggcccc------------------gcgcccccccggga
H2Q805_BCL2L2-04      --------------------------------------------------
H2Q805_BCL2L2-01      acgcttcacccaggtctccgatgaactttttcaagggggccccaactggg
H2Q805_BCL2L2-02      acgcttcacccaggtctccgatgaactttttcaagggggccccaactggg
                                                                        

H2Q805_BCL2L2-03      gctcc----gggccctgggcctggttcgggagcccccggcagccaagag-
H2Q805_BCL2L2-04      ------------------------------------------ccaagag-
H2Q805_BCL2L2-01      gccgccttgtagccttctttgtctttggggctgcactgtgtgctgagagt
H2Q805_BCL2L2-02      gccgccttgtagccttctttgtctttggggctgcactgtgtgctgagagt
                                                                *  **** 

H2Q805_BCL2L2-03      ------gaggaggaggagcc------gggac--------tggtcgagggt
H2Q805_BCL2L2-04      ------gaggaggaggagcc------gggac--------tggtcgagggt
H2Q805_BCL2L2-01      gtcaacaaggagatggaaccactggtgggacaagtgcaggagtggatggt
H2Q805_BCL2L2-02      gtcaacaaggagatggaaccactggtgggacaagtgcaggagtggatggt
                             *****  *** **      *****          ** ** ***

H2Q805_BCL2L2-03      gac---ccgggggacggcgc-------------------cattgaggacc
H2Q805_BCL2L2-04      gac---ccgggggacggcgc-------------------cattgaggacc
H2Q805_BCL2L2-01      ggcctacctggagacgcggctggctgactggatccacagcagtgggggct
H2Q805_BCL2L2-02      ggcctacctggagacgcggctggctgactggatccacagcagtgggggct
                      * *   ** ** ****  **                   ** ** ** * 

H2Q805_BCL2L2-03      cggagctggaagctatcaaagctcgagtcagggagatgga---ggaagaa
H2Q805_BCL2L2-04      cggagctggaagctatcaaagctcgagtcagggagatgga---ggaagaa
H2Q805_BCL2L2-01      gggcg------gagttcacagctctatacggggacggggccctggaggag
H2Q805_BCL2L2-02      gggagctggaagctatcaaagctcgagtcagggagatgga---ggaagaa
                       ** *      *   *** ***** *  * ****   **    *** ** 

H2Q805_BCL2L2-03      gctgagaagctaaaggagctacagaacgaggtagagaagcagatgaatat
H2Q805_BCL2L2-04      gctgagaagctaaaggagctacagaacgaggtagagaagcagatgaatat
H2Q805_BCL2L2-01      gcgcggcgtctgcgggag---------------gggaactgggcatcagt
H2Q805_BCL2L2-02      gctgagaagctaaaggagctacagaacgaggtagagaagcagatgaatat
                      **   *   **   ****               * ***   *       *

H2Q805_BCL2L2-03      gagtccaccaccaggcaatgctggcccagtgatcatgtccattgaggaga
H2Q805_BCL2L2-04      gagtccaccaccaggcaatgctggcccagtgatcatgtccattgaggaga
H2Q805_BCL2L2-01      gag----------gacagtgctgac-------------------------
H2Q805_BCL2L2-02      gagtccaccaccaggcaatgctggcccagtgatcatgtccattgaggaga
                      ***          * ** ***** *                         

H2Q805_BCL2L2-03      agatggaggctgatgcccgttccatctatgttggcaatgtggactatggt
H2Q805_BCL2L2-04      agatggaggctgatgcccgttccatctatgttggcaatgtggactatggt
H2Q805_BCL2L2-01      ----gggggccg-------------------tggcactgggggccctggt
H2Q805_BCL2L2-02      agatggaggctgatgcccgttccatctatgttggcaatgtggactatggt
                          ** *** *                   ***** ** ** *  ****

H2Q805_BCL2L2-03      gcaacagcagaagagctggaagctcactttcatggctgtggttcagtcaa
H2Q805_BCL2L2-04      gcaacagcagaagagctggaagctcactttcatggctgtggttcagtcaa
H2Q805_BCL2L2-01      --------------------------------------------------
H2Q805_BCL2L2-02      gcaacagcagaagagctggaagctcactttcatggctgtggttcagtcaa
                                                                        

H2Q805_BCL2L2-03      ccgtgttaccatactctgtgacaaatttagtggccatcccaaagggtttg
H2Q805_BCL2L2-04      ccgtgttaccatactctgtgacaaatttagtggccatcccaaagggtttg
H2Q805_BCL2L2-01      ----------------------aactgtaggggcctt-------------
H2Q805_BCL2L2-02      ccgtgttaccatactctgtgacaaatttagtggccatcccaaagggtttg
                                            ** * *** **** *             

H2Q805_BCL2L2-03      cgtatatagagttctcagacaaagagtcagtgaggacttccttggcctta
H2Q805_BCL2L2-04      cgtatatagagttctcagacaaagagtcagtgaggacttccttggcctta
H2Q805_BCL2L2-01      --------------------------------------------------
H2Q805_BCL2L2-02      cgtatatagagttctcagacaaagagtcagtgaggacttccttggcctta
                                                                        

H2Q805_BCL2L2-03      gatgagtccctatttagaggaaggcaaatcaaggtgatcccaaaacgaac
H2Q805_BCL2L2-04      gatgagtccctatttagaggaaggcaaatcaaggtgatcccaaaacgaac
H2Q805_BCL2L2-01      --------------------------------------------------
H2Q805_BCL2L2-02      gatgagtccctatttagaggaaggcaaatcaaggtgatcccaaaacgaac
                                                                        

H2Q805_BCL2L2-03      caacagaccaggcatcagcacaacagaccggggttttccacgagcccgct
H2Q805_BCL2L2-04      caacagaccaggcatcagcacaacagaccggggttttccacgagcccgct
H2Q805_BCL2L2-01      --------------------------------------------------
H2Q805_BCL2L2-02      caacagaccaggcatcagcacaacagaccggggttttccacgagcccgct
                                                                        

H2Q805_BCL2L2-03      accgcgcccggaccaccaactacaacagttcccgctctcgattctacagt
H2Q805_BCL2L2-04      accgcgcccggaccaccaactacaacagttcccgctctcgattctacagt
H2Q805_BCL2L2-01      --------------------------------------------------
H2Q805_BCL2L2-02      accgcgcccggaccaccaactacaacagttcccgctctcgattctacagt
                                                                        

H2Q805_BCL2L2-03      ggttttaacagcaggccccggggtcgcgtctacaggggccgggctagagc
H2Q805_BCL2L2-04      ggttttaacagcaggccccggggtcgcgtctacaggggccgggctagagc
H2Q805_BCL2L2-01      --ttttgctagcaag-----------------------------------
H2Q805_BCL2L2-02      ggttttaacagcaggccccggggtcgcgtctacaggggccgggctagagc
                        ****   **** *                                   

H2Q805_BCL2L2-03      gacatcatggtattccccttactaa
H2Q805_BCL2L2-04      gacatcatggtattccccttactaa
H2Q805_BCL2L2-01      ----------------------tga
H2Q805_BCL2L2-02      gacatcatggtattccccttactaa
                                            * *

© 1998-2021Legal notice