Dataset for CDS BCL-2-like of organism Theropithecus gelada

[Download (right click)] [Alignment] [Repertoires]

9 sequence(s)

>gnl|bcl2dbcds|A0A8D2E7F6_BCL2A1-01 BCL2-related protein A1 gene OS=[Eukaryota] Theropithecus gelada GN=BCL2A1 (length=528 residues).
atgacagactgtgaatttggatatatttacaggctagcacaggactatttgcagtacgttctgcagataccacaacctgg
attgggtccaagcaaaacgtccagagtgctacaaaaggttgcattctcagtccaaaaagaagtggaaaagaatctgaagc
catgcttggacaatgttaatgttgcatccatagacactgccagaacactattcaatcaagtgatggaaaaggagtttgaa
gatggcatcattaactggggaagaattgtaaccatatttgcatttgaaggtattctcatcaagaaacttctacgacagcg
aattgccccggatgtggatacttataaggagatttcatattttgttgctgagttcataatgaataacacaggagaatgga
taaggcaaaacggaggctgggaaaatggctttgtaaagaagtttgaacctaaatctggctggatgacttttctagaagtt
acaggaaagatctgtgaaatgctatctctcctgaagcaatactgttga
>gnl|bcl2dbcds|A0A8D2EFR4_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Theropithecus gelada GN=BCL-2 (length=720 residues).
atggcgcaagctgggagaacagggtacgataaccgggagatagtgatgaagtacatccactataagctgtcgcagagggg
ctacgagtgggatgcgggggatgtgggcgcggcgacccctggggccgcccccgcaccgggcatcttctcctcccagcccg
ggcacacgccccatcccgccgcgtcccgggacccggtcgccaggacctcgccgctgccgaccccggctgcccccgccgcc
gccgcggggcctgcgctcagcccggtgccacctgtggtccacctgaccctccgccaggccggtgacgacttctcccgccg
ctaccgccgcgacttcgccgagatgtccagccagctgcacctgacgcccttcaccgcgcggggacgctttgccacggtgg
tggaggagctcttcagggacggggtgaactgggggaggatcgtggccttctttgagttcggtggggtcatgtgtgtggag
agcgtcaaccgggagatgtcgcccctggtggacaacatcgccctgtggatgactgagtacctgaaccggcacctgcacac
ctggatccaggataacggaggctgggacgcctttgtggaactgtacggccccagcatgcggcctctgtttgatttctcct
ggctgtctctgaagactctgctcagtttggccctggtgggagcttgcatcaccctgggtgcctatctgggccacaagtga
>gnl|bcl2dbcds|A0A8D2ERY7_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Theropithecus gelada GN=BCL2L1 (length=702 residues).
atgtctcagagcaaccgggagctggtggttgactttctctcctacaagctttcccagaaaggatacagctggagtcaatt
tagtgatgtggaagagaacaggactgaggccccagaagggactgaatcggagatggagacccccagtgccatcaatggca
acccatcctggcacctggtggacagccccgcggtgaatggagccactggccacagcagcagtttggatgcccgggaggtg
atccccatggcagcagtaaagcaagcgctgagggaggcaggcgacgagtttgaactgcggtaccggcgggcgttcagtga
cctgacatcccagctccacatcaccccagggacagcatatcagagctttgaacaggtagtgaatgaactcttccgggatg
gggtaaactggggtcgcattgtggcctttttctccttcggcggggcactgtgcgtggaaagcgtagacaaggagatgcag
gtattggtgagtcggatcgcagcttggatggccacttacctgaatgaccacctagagccttggatccaggagaacggcgg
ctgggacacttttgtggaactctatgggaacaatgcagcagccgagagccgaaagggccaggagcgcttcaaccgctggt
tcctgacgggcatgactgtggccggcgtggttctgctaggctcactcttcagtcggaaatga
>gnl|bcl2dbcds|A0A8D2F160_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Theropithecus gelada GN=MCL-1 (length=1053 residues).
atgtttggcttcaaaagaaacgcggtaatcggactcaacctctactgtgggggggccggcttgggggccggcagcggcgg
cgccacccctccgggagggcggcttttggctacggagaaggaggcctcggcccggcgagagatagggggaggggaggccg
gcacggtgattggcggaaccgccggcgcaagccccccggccgccctcacgccagacgcccggagggtcgcgcggccgccg
cccattggcgcggaggtccccgacgtcaccgcgacccccgcgaggctgcttttctttgcgcccacccgccgcgcggcgcc
gcttgaggagatggaagccccggccgccgacgccatcatgtcgcccgaagaggagctggacgggtacgagccggagcctc
tcgggaagcggccggctgtcctgcccttgctggagttggtcggggaatctggtaatagccccagtacggatgggtcacta
ccctcgacgccgccgccagcagaggaggaggaggacgagttgtaccggcagtcgctggagattatctctcggtaccttcg
ggagcaggccaccggcgccaaggacacaaagccaatgggcaggtctggggccaccagcaggaaggctctggagaccttac
gacgggttggggatggcgtgcagcgcaaccacgagacggccttccaaggcatgcttcggaaactggacatcaaaaacgaa
gacgatgtcaaatctttgtctcgagtgatggtccatgttttcagcgacggcgtaacaaactggggcaggattgtgactct
catttcttttggtgcctttgtggctaaacacttgaagaccataaaccaagaaagctgcatcgaaccattagcagaaagta
tcacagacgttctcgtaaggacaaaacgggactggctagttaaacaaagaggctgggatgggtttgtggagttcttccat
gtagaggacctagaaggtggcatcagaaatgtgctgctggcttttgcaggtgttgctggagtaggagctggtttggcata
tctaataagatag
>gnl|bcl2dbcds|A0A8D2F160_MCL1-02 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Theropithecus gelada GN=MCL-1 (length=594 residues).
atgtttggcttcaaaagaaacgcggtaatcggactcaacctctactgtgggggggccggcttgggggccggcagcggcgg
cgccacccctccgggagggcggcttttggccaccggcgccaaggacacaaagccaatgggcaggtctggggccaccagca
ggaaggctctggagaccttacgacgggttggggatggcgtgcagcgcaaccacgagacggccttccaaggcatgcttcgg
aaactggacatcaaaaacgaagacgatgtcaaatctttgtctcgagtgatggtccatgttttcagcgacggcgtaacaaa
ctggggcaggattgtgactctcatttcttttggtgcctttgtggctaaacacttgaagaccataaaccaagaaagctgca
tcgaaccattagcagaaagtatcacagacgttctcgtaaggacaaaacgggactggctagttaaacaaagaggctgggat
gggtttgtggagttcttccatgtagaggacctagaaggtggcatcagaaatgtgctgctggcttttgcaggtgttgctgg
agtaggagctggtttggcatatctaataagatag
>gnl|bcl2dbcds|A0A8D2FBM7_BCL2L10-01 BCL2-like 10 gene OS=[Eukaryota] Theropithecus gelada GN=BCL2L10 (length=585 residues).
atggctgacccgttgcgggagcgcaccgagcggctcctggccgactatctggggtgctgcgcccgggaacccggcacccc
tgagccaaggccgtccacgcccgaggccgccgtgctgcgctcagcagccgtcaggttacggcagctccaccggtccttct
tctccgcctaccgcggctaccctgggaaccgcgtcgagctggtggcgctgatggcggaggccgtgctctccgacagcccc
ggccccacctggggcagggtggtgtcgctggtgaccttcgcggggacgctgctggagagagagccgctggtgacagcctg
gtggaagaagcggagcttccagccgcggctgaaggaacaggagggcgacgtcgcccgggactgccagcgcctggtggcct
tgctgagctcgcggctcgcggggcagcaccgcgcctggcttcaggctcagggcggctgggatggcttttgtcacttcttc
aggagcccctttccgctggctttttggagaaaactgctgatccaggctttcctggcatgcttgttagcaacagccttcgg
ttatctctggacacgattattatga
>gnl|bcl2dbcds|A0A8D2FJU1_BCL2L2-01 BCL2-like 2 gene OS=[Eukaryota] Theropithecus gelada GN=BCL2L2 (length=1098 residues).
atggcgaccccagcctcggccccagacacacgggctctggtggcagactttgtaggttataagctgaggcagaagggtta
tgtctgtggagctggccccggggagggcccagcagctgacccgctgcaccaagccatgcgggcagctggagatgagttcg
agacccgcttccggcgcaccttctctgatctggcggctcagctgcatgtgaccccaggctcagcacagcaacgcttcacc
caggtctccgatgaacttttccaagggggccccaactggggccgccttgtagccttctttgtctttggggctgcactgtg
tgctgagagtgtcaacaaggagatggaaccactggtgggacaagtgcaggagtggatggtggcctacctggagacgcggc
tggctgactggatccacagcagtgggggctggttatcccagatcactgaagctgagatggctgatgaagtaatttgcagt
gaaattttaagcgactgtgactctgctccaagttccccagatctcgaggagctggaagctatcaaagctcgagtcaggga
gatggaggaagaagctgagaagctaaaggagctacagaacgaggtagagaagcagatgaatatgagtccacctccaggca
atgctggcccagtgatcatgtccattgaggagaagatggaggctgatgcccgttccatctatgttggcaatgtggactat
ggtgcaacagcagaagagctggaagctcactttcatggctgtggatcagtcaaccgtgttaccatactctgtgacaaatt
tagtggccatcccaaaggatttgcgtatatagagttctcagacaaagagtcagtgaggacttccttggccttagatgagt
ccctatttagaggaaggcaaatcaaggtgatcccaaaacgaaccaacagaccaggcatcagcacaacagaccggggtttt
ccacgagcccgctaccgcgcccggaccaccaactacaacagttcccgctctcgattctacagtggttttaacagcaggcc
ccggggtcgtgtctacaggggccgggctagagcgacatcatggtattccccttactaa
>gnl|bcl2dbcds|A0A8D2FJU1_BCL2L2-02 BCL2-like 2 gene OS=[Eukaryota] Theropithecus gelada GN=BCL2L2 (length=582 residues).
atggcgaccccagcctcggccccagacacacgggctctggtggcagactttgtaggttataagctgaggcagaagggtta
tgtctgtggagctggccccggggagggcccagcagctgacccgctgcaccaagccatgcgggcagctggagatgagttcg
agacccgcttccggcgcaccttctctgatctggcggctcagctgcatgtgaccccaggctcagcacagcaacgcttcacc
caggtctccgatgaacttttccaagggggccccaactggggccgccttgtagccttctttgtctttggggctgcactgtg
tgctgagagtgtcaacaaggagatggaaccactggtgggacaagtgcaggagtggatggtggcctacctggagacgcggc
tggctgactggatccacagcagtgggggctgggcggagttcacagctctatacggggacggggccctggaggaggcgcgg
cgtctgcgggaggggaactgggcatcagtgaggacagtgctgacgggggccgtggcactgggggccctggtaactgtagg
ggccttttttgctagcaagtga
>gnl|bcl2dbcds|A0A8D2FJU1_BCL2L2-03 BCL2-like 2 gene OS=[Eukaryota] Theropithecus gelada GN=BCL2L2 (length=921 residues).
atggcggcggcggcggcggcggcagcagcagcgggggctgcgggcggtcggggctccgggccggggcggcggcgccatct
tgtgcccggggccggtggggaggccggggagggggccccggggggcgcaggggactacgggaacggcctggagtctgagg
aactggagcctgaggagctgctgctggagcccgagccggagcccgagcccgaagaggagccgccccggccccgcgccccc
ccgggagctccgggccctgggcctggttcgggagcccccggcagccaagaggaggaggaggagccgggactggtcgaggg
tgacccgggggacggcgccattgaggacccggagctggaagctatcaaagctcgagtcagggagatggaggaagaagctg
agaagctaaaggagctacagaacgaggtagagaagcagatgaatatgagtccacctccaggcaatgctggcccagtgatc
atgtccattgaggagaagatggaggctgatgcccgttccatctatgttggcaatgtggactatggtgcaacagcagaaga
gctggaagctcactttcatggctgtggatcagtcaaccgtgttaccatactctgtgacaaatttagtggccatcccaaag
gatttgcgtatatagagttctcagacaaagagtcagtgaggacttccttggccttagatgagtccctatttagaggaagg
caaatcaaggtgatcccaaaacgaaccaacagaccaggcatcagcacaacagaccggggttttccacgagcccgctaccg
cgcccggaccaccaactacaacagttcccgctctcgattctacagtggttttaacagcaggccccggggtcgtgtctaca
ggggccgggctagagcgacatcatggtattccccttactaa
© 1998-2023Legal notice