Dataset for CDS Unclassified of organism Rhinopithecus bieti

[Download (right click)]

2 sequence(s)

>gnl|bcl2dbcds|A0A2K6LPH6_uncBCL2L1-01 Putative BCL2-like 1 gene OS=[Eukaryota] Rhinopithecus bieti (length=702 residues).
atgtctcagagcaaccgggagctggtggttgactttctctcctacaagctttcccagaaaggatacagctggagtcagtt
tagtgatgtggaagagaacaggactgaggccccagaagggactgaatcggagatggagacccccagtgccatcaatggca
acccatcctggcacctggtggacagccccgcggtgaatggagccactggccacagcagcagtttggatgcccgggaggtg
atccccatggcagcagtaaagcaagcgctgagggaggcaggcgacgagtttgaactgcggtaccggcgggcgttcagtga
cctgacatcccagctccacatcaccccagggacagcatatcagagctttgaacaggtagtgaatgaactcttccgggatg
gggtaaactggggtcgcattgtggcctttttctccttcggcggggcactgtgcgtggaaagcgtagacaaggagatgcag
gtattggtgagtcggatcgcagcttggatggccacttatctgaatgaccacctagagccttggatccaggagaacggcgg
ctgggacacttttgtggaactctatgggaacaatgcagcagccgagagccgaaagggccaggagcgcttcaaccgctggt
tcctgacgggcatgactgtggccggcgtggttctgctgggctcactcttcagtcggaaatga
>gnl|bcl2dbcds|A0A2K6LPH6_uncBCL2L1-02 Putative BCL2-like 1 gene OS=[Eukaryota] Rhinopithecus bieti (length=438 residues).
atgtggaagagaacaggactgaggccccagaagggactgaatcggagatggagacccccagtgccatcaatggcaaccca
tcctgggacagcatatcagagctttgaacaggtagtgaatgaactcttccgggatggggtaaactggggtcgcattgtgg
cctttttctccttcggcggggcactgtgcgtggaaagcgtagacaaggagatgcaggtattggtgagtcggatcgcagct
tggatggccacttatctgaatgaccacctagagccttggatccaggagaacggcggctgggacacttttgtggaactcta
tgggaacaatgcagcagccgagagccgaaagggccaggagcgcttcaaccgctggttcctgacgggcatgactgtggccg
gcgtggttctgctgggctcactcttcagtcggaaatga
© 1998-2020Legal notice