Dataset for CDS BOK of Organism Homo sapiens

[Download (right click)] [Edit] [Sequences] [Repertoires]

3 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A4D6NU76_BOK-01      at------------------------------------------------
A0A481T0W6_BOK-01      atggaggtgctgcggcgctcctcggtcttcgccgccgagatcatggacgc
Q9UL32_BOK-01          atggaggtgctgcggcgctcttcggtcttcgctgcggagatcatggacgc
                       **                                                

A0A4D6NU76_BOK-01      --------------------------------------------------
A0A481T0W6_BOK-01      ctttgaccgctcgcccacagacaaggagctggtggcccaggccaaggcgc
Q9UL32_BOK-01          ctttgatcgctggcccacagacaaggagctggtggcccaggctaaagcac
                                                                         

A0A4D6NU76_BOK-01      --------------------------------------------------
A0A481T0W6_BOK-01      tgggccgggagtacgtgcacgcgcggctgctgcgcgccggcctctcctgg
Q9UL32_BOK-01          taggccgggagtacgtgcacgcgcggcttttgcgcgccggcctctcctgg
                                                                         

A0A4D6NU76_BOK-01      --------------------------------------------------
A0A481T0W6_BOK-01      agcgcgcccgagcgtgccgcgccggtccc---gggacgcctggctgaggt
Q9UL32_BOK-01          agcgctccagagcgtgcctcgcctgcccctggaggacgcctggcagaggt
                                                                         

A0A4D6NU76_BOK-01      ---------------------------------------gatccggccca
A0A481T0W6_BOK-01      gtgcgcggtgctgctgcgcctgggcgatgagctggagatgatccggccca
Q9UL32_BOK-01          gtgcaccgtgctgctgcgcttgggagatgagctggagcagatccgtccca
                                                              ****** ****

A0A4D6NU76_BOK-01      gcgtctaccgcaacgtggcgcgtcagctgcacatctccctgcagtctgag
A0A481T0W6_BOK-01      gcgtctaccgcaacgtggcgcgtcagctgcacatctccctgcagtctgag
Q9UL32_BOK-01          gcgtatatcggaatgtggcccggcagctgcacatccctctgcagtctgag
                       **** ** ** ** ***** ** ************ * ************

A0A4D6NU76_BOK-01      cctgtggtgaccgatgcgttcctggccgtggctggccacatcttctctgc
A0A481T0W6_BOK-01      cctgtggtgaccgatgcgttcctggccgtggctggccacatcttctctgc
Q9UL32_BOK-01          cctgtggtgactgatgccttcctcgctgtggccggccacatcttctcagc
                       *********** ***** ***** ** ***** ************** **

A0A4D6NU76_BOK-01      aggcatcacgtggggcaaggtggtgtccctgtatgcggtggccgcggggc
A0A481T0W6_BOK-01      agac----------------------------------------------
Q9UL32_BOK-01          aggtatcacatggggcaaggtagtgtccctgtactcggcggctgcgggac
                       **                                                

A0A4D6NU76_BOK-01      tggccgtggactgtgtgaggcaggcccagcctgccatggtccacgccctc
A0A481T0W6_BOK-01      --------------------------------------------------
Q9UL32_BOK-01          tagcggtggactgcgtccggcaagctcagccagccatggttcatgccctg
                                                                         

A0A4D6NU76_BOK-01      gtggactgcctgggggagttcgtgcgcaagaccctggcaacctggctgcg
A0A481T0W6_BOK-01      --------------------------------------------------
Q9UL32_BOK-01          gttgactgcctgggggaatttgtacgcaagaccttggctacctggcttcg
                                                                         

A0A4D6NU76_BOK-01      gagacgcggcggatggactgatgtcctcaagtgtgtggtcagcacagacc
A0A481T0W6_BOK-01      --------------------------------------------------
Q9UL32_BOK-01          gaggcgtggtggatggacggacgtcctcaagtgtgtggtcagcacaaaac
                                                                         

A0A4D6NU76_BOK-01      ctggcctccgctcccactggctggtggctgcactctgcagcttcggccgc
A0A481T0W6_BOK-01      --------------------------------------------------
Q9UL32_BOK-01          ctggcttccgctcccactggctcgtggccacactctgcagctttggccgc
                                                                         

A0A4D6NU76_BOK-01      ttcctgaaggctgccttcttcgtgctgctgccagagagatga
A0A481T0W6_BOK-01      ---------------------------------------tga
Q9UL32_BOK-01          ttcctgaaggctgcattcttcctcctgttgccagagagatga
                                                              ***

© 1998-2023Legal notice