Dataset for CDS BOK of Organism Homo sapiens

[Download (right click)] [Alignment] [Repertoires]

3 sequence(s)

>gnl|bcl2dbcds|A0A481T0W6_BOK-01 BCL2-related ovarian killer gene OS=[Eukaryota] Homo sapiens GN=BOK (length=354 residues).
atggaggtgctgcggcgctcctcggtcttcgccgccgagatcatggacgcctttgaccgctcgcccacagacaaggagct
ggtggcccaggccaaggcgctgggccgggagtacgtgcacgcgcggctgctgcgcgccggcctctcctggagcgcgcccg
agcgtgccgcgccggtcccgggacgcctggctgaggtgtgcgcggtgctgctgcgcctgggcgatgagctggagatgatc
cggcccagcgtctaccgcaacgtggcgcgtcagctgcacatctccctgcagtctgagcctgtggtgaccgatgcgttcct
ggccgtggctggccacatcttctctgcagactga
>gnl|bcl2dbcds|A0A4D6NU76_BOK-01 BCL2-related ovarian killer gene OS=[Eukaryota] Homo sapiens GN=BOK (length=405 residues).
atgatccggcccagcgtctaccgcaacgtggcgcgtcagctgcacatctccctgcagtctgagcctgtggtgaccgatgc
gttcctggccgtggctggccacatcttctctgcaggcatcacgtggggcaaggtggtgtccctgtatgcggtggccgcgg
ggctggccgtggactgtgtgaggcaggcccagcctgccatggtccacgccctcgtggactgcctgggggagttcgtgcgc
aagaccctggcaacctggctgcggagacgcggcggatggactgatgtcctcaagtgtgtggtcagcacagaccctggcct
ccgctcccactggctggtggctgcactctgcagcttcggccgcttcctgaaggctgccttcttcgtgctgctgccagaga
gatga
>gnl|bcl2dbcds|Q9UL32_BOK-01 BCL2-related ovarian killer gene OS=[Eukaryota] Homo sapiens GN=BOK (length=642 residues).
atggaggtgctgcggcgctcttcggtcttcgctgcggagatcatggacgcctttgatcgctggcccacagacaaggagct
ggtggcccaggctaaagcactaggccgggagtacgtgcacgcgcggcttttgcgcgccggcctctcctggagcgctccag
agcgtgcctcgcctgcccctggaggacgcctggcagaggtgtgcaccgtgctgctgcgcttgggagatgagctggagcag
atccgtcccagcgtatatcggaatgtggcccggcagctgcacatccctctgcagtctgagcctgtggtgactgatgcctt
cctcgctgtggccggccacatcttctcagcaggtatcacatggggcaaggtagtgtccctgtactcggcggctgcgggac
tagcggtggactgcgtccggcaagctcagccagccatggttcatgccctggttgactgcctgggggaatttgtacgcaag
accttggctacctggcttcggaggcgtggtggatggacggacgtcctcaagtgtgtggtcagcacaaaacctggcttccg
ctcccactggctcgtggccacactctgcagctttggccgcttcctgaaggctgcattcttcctcctgttgccagagagat
ga
© 1998-2023Legal notice