Dataset for CDS BAX-like of Organism Danio rerio

[Download (right click)] [Edit] [Sequences] [Repertoires]

12 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


D2Y5Q2_BCLWAV-01       atggg------------------acggtcagacgacgctgtgattggtcg
B0S7M3_BOK-01          atgcgggac----------------------atgaacgtgt---------
B2GRX5_BOK-01          -------------------------------atgaacgtgt---------
Q7T381_BOK-01          -------------------------------atgaacgtgt---------
A0A0R4IZP5_BOK-02      atgaagggc----------------------atggagatgt---------
A0A0R4IZP5_BOK-01      atgaagggc----------------------atggagatgt---------
Q6DC66_BOK-01          -------------------------------atggagatgt---------
B2GR48_BAX-03          atggc---------------agcgccgtcgggtggaggcga---------
Q9I9N4_BAX-01          atggc---------------agcgccgtcgggtggaggcga---------
B2GPC6_BAX-01          atggcagatgggaagaatggagagacgacagacgaaaatgagttaaaggg
Q08BX9_BAX-01          atggcagatgggaagaatggagagacgacagacgaaaatgagttaaaggg
A9JSY8_BAX-01          atggcagatgggaagaatggagagacgacagacgaaaatgagttaaaggg
                                                        *     *          

D2Y5Q2_BCLWAV-01       aggcctgaacagtccagatccactagtgcgtgaagctttt-------ctg
B0S7M3_BOK-01          -----tcgcgcgctcctccgtgctcgccgccgagatgatggatgtgtttg
B2GRX5_BOK-01          -----tcgcgcgctcctccgtgctcgccgccgagatgattgatgtgtttg
Q7T381_BOK-01          -----tcgcgcgctcctccgtgctcgccgccgagatgattgatgtgtttg
A0A0R4IZP5_BOK-02      -----tgcgccgctcctcagtgtttgcggctgaagtcatggaggtgtttg
A0A0R4IZP5_BOK-01      -----tgcgccgctcctcagtgtttgcggctgaagtcatggaggtgtttg
Q6DC66_BOK-01          -----tgcgccgctcctcagtgtttgcggctgaagtcatggaggtgtttg
B2GR48_BAX-03          ---tacgggcagtggcaat---------gaccagatacttgac----ttg
Q9I9N4_BAX-01          ---tacgggcagtggcaat---------gaccagatacttgac----ttg
B2GPC6_BAX-01          agctacaggtggtgaagatgtggtagacgatgcgatcattgag----cag
Q08BX9_BAX-01          agctacaggtggtgaagatgtggtagatgatgcgatcattgag----cag
A9JSY8_BAX-01          agctacagggggtgaagatgtggtagatgatgcgatcattgag----cag
                                  *                          *          *

D2Y5Q2_BCLWAV-01       atggcgtacgactacatcag----------ctacgtgacagccaaaccag
B0S7M3_BOK-01          atcgcactcacacggagaaa----------gagctcgtctttcagtccaa
B2GRX5_BOK-01          atcgcactcacacggagaaa----------gagctcgtctttcagtccaa
Q7T381_BOK-01          atcgcactcacacggagaaa----------gagctcgtctttcagtccaa
A0A0R4IZP5_BOK-02      atcgctctcccacggacaag----------gagctcgtgtctcagtccaa
A0A0R4IZP5_BOK-01      atcgctctcccacggacaag----------gagctcgtgtctcagtccaa
Q6DC66_BOK-01          atcgctctcccacggacaag----------gagctcgtgtctcagtccaa
B2GR48_BAX-03          ggagctgcacttctcaacaactttgtgtatgagcgtgttcgtcgg--cat
Q9I9N4_BAX-01          ggagctgcacttctcaacaactttgtgtatgagcgtgttcgtcgg--cat
B2GPC6_BAX-01          agtgctgttctacttaga------------gggtacgttattcag--caa
Q08BX9_BAX-01          agtgctgttctacttaga------------gggtacgttattcag--caa
A9JSY8_BAX-01          agtgctgttctacttaga------------gggtacgttattcag--caa
                          **          *                    *     *    ** 

D2Y5Q2_BCLWAV-01       gcgtcccgttgtgtccggcaccttcccgtgcttc---cgctgccctgcgc
B0S7M3_BOK-01          ggagctgtgtagagacttca--ttcactcca------ggatcacgagaga
B2GRX5_BOK-01          ggagctgtgtagagacttca--ttcactcca------ggatcacgagaga
Q7T381_BOK-01          ggagctgtgtagagacttca--ttcactcca------ggatcacgagaga
A0A0R4IZP5_BOK-02      agtgttgtgtagggattata--ttcactcca------gactgcaccgggc
A0A0R4IZP5_BOK-01      agtgttgtgtagggattata--ttcactcca------gactgcaccgggc
Q6DC66_BOK-01          agtgttgtgtagggattata--ttcactcca------gactgcaccgggc
B2GR48_BAX-03          ggcgacagggatg---------ctgaagtga-----------cccggagt
Q9I9N4_BAX-01          ggcgacagggatg---------ctgaagtga-----------cccggagt
B2GPC6_BAX-01          gctactatagatgatccaaacattcacgtgagtcacgagactctcggagg
Q08BX9_BAX-01          gctactatagatgatccaaacattcacgtgagtcacgagactctcggagg
A9JSY8_BAX-01          gctactatagatgatccaaacattcacgtgagtcacgagactctcggagg
                                              *                      * * 

D2Y5Q2_BCLWAV-01       cacgctgga-----------------gacgagctgct-gatccgc-----
B0S7M3_BOK-01          aggactgagttggtcaaaagtcgagc-tggacctgccagaaccgcgcgga
B2GRX5_BOK-01          aggactgagttggtcaaaagtcgagc-tggacctgccagaaccgcgcgga
Q7T381_BOK-01          aggactgagttggtcaaaagtcgagc-tggacctgccagaaccgcgcgga
A0A0R4IZP5_BOK-02      tggaatcgggtggtcgaaaccagaacacgggtctggaggaacc-------
A0A0R4IZP5_BOK-01      tggaatcgggtggtcgaaaccagaacacgggtctggaggaacc-------
Q6DC66_BOK-01          tggaatcgggtggtcgaaaccagaacacgggtctggaggaacc-------
B2GR48_BAX-03          cag-cttgg-------------gggcgtggagctgtgtgaccc---c--a
Q9I9N4_BAX-01          cag-cttgg-------------gggcgtggagctgtgtgaccc---c--a
B2GPC6_BAX-01          aagacctca-------------ggatgaagag------gatcc---tcaa
Q08BX9_BAX-01          aagacctca-------------ggatgaagag------gatcc---tcaa
A9JSY8_BAX-01          aagacctca-------------ggatgaagag------gatcc---tcaa
                                                    *        ** **       

D2Y5Q2_BCLWAV-01       -------------ttcccgatcttctttcgccgctggccgagagttttcc
B0S7M3_BOK-01          gttcttgtagacgtgtctgtggtgctgcttaaactgggtgatgaact---
B2GRX5_BOK-01          gttcttgtagacgtgtctgtggtgctgcttaaactgggtgatgaact---
Q7T381_BOK-01          gttcttgtagacgtgtctgtggtgctgcttaaactgggtgatgaact---
A0A0R4IZP5_BOK-02      ---ctggctgaggtgtcttcagtcctgctgtggttgggtgatgagct---
A0A0R4IZP5_BOK-01      ---ctggctgaggtgtcttcagtcctgctgtggttgggtgatgagct---
Q6DC66_BOK-01          ---ctggctgaggtgtcttcagtcctgctgtggttgggtgatgagct---
B2GR48_BAX-03          gccataaacgcc-tcgcgcagtgtttgcagcagatcggagatgagctgga
Q9I9N4_BAX-01          gccataaacgcc-tcgcgcagtgtttgcagcagatcggagatgagctgga
B2GPC6_BAX-01          atcaaagaagttgtagatcagctttt---gaagatagctgacgaccttaa
Q08BX9_BAX-01          atcaaagaagttgtagatcagctttt---gaagatagctgacgaccttaa
A9JSY8_BAX-01          atcaaagaagttgtagatcagctttt---gaagatagctgacgaccttaa
                                    *           *        * *  **     *   

D2Y5Q2_BCLWAV-01       aggacgtgacggagc----acacggcctgccccacgctgctctccatcct
B0S7M3_BOK-01          --ggagtg-cat-gcgtccatatgtgtatcgtaatattgcaaagcagctg
B2GRX5_BOK-01          --ggagtg-cat-gcgtccatatgtgtatcgtaatattgcaaagcagctg
Q7T381_BOK-01          --ggagtg-cat-gcgtccatatgtgtatcgtaatattgcaaagcagctg
A0A0R4IZP5_BOK-02      --agagta-cct-gcgtcccaacgtctaccgcaacgtagctcgacagctc
A0A0R4IZP5_BOK-01      --agagta-cct-gcgtcccaacgtctaccgcaacgtagctcgacagctc
Q6DC66_BOK-01          --agagta-cct-gcgtcccaacgtgtaccgcaacgtagctcgacagctc
B2GR48_BAX-03          tggaaatg-cgcagctgcaaagcatgttaaacaactctaatcttcagccg
Q9I9N4_BAX-01          tggaaatg-cgcagctgcaaagcatgttaaacaactctaatcttcagccg
B2GPC6_BAX-01          caagaatg-ctgagcttcaacatctcatcagcaccg------ttcagtca
Q08BX9_BAX-01          taagaatg-ctgagcttcaacatctcatcagcaccg------ttcagtca
A9JSY8_BAX-01          caagaatg-ctgagcttcaacatctcatcagcaccg------ttcagtca
                             *  *   **                             **    

D2Y5Q2_BCLWAV-01       gga----------------------------cgaacacttcgctcccacg
B0S7M3_BOK-01          aatatcagcgtatcggtggaagctgtggtttcagatgcatttctctcggt
B2GRX5_BOK-01          aatatcagcgtatcggtggaagctgtggtttcagatgcatttctctcggt
Q7T381_BOK-01          aatatcagcgtatcggtggaagctgtggtttcagatgcatttctctcggt
A0A0R4IZP5_BOK-02      aacatcacaatagcctctgagaatatcgtctctgatgcctttctggccgt
A0A0R4IZP5_BOK-01      aacatcacaatagcctctgagaatatcgtctctgatgcctttctggccgt
Q6DC66_BOK-01          aacatcacaatagcctctgagaatatcgtctctgatgcctttctggccgt
B2GR48_BAX-03          a---------------------------ctcaagatgtcttcatcagagt
Q9I9N4_BAX-01          a---------------------------ctcaagacgtcttcatcagagt
B2GPC6_BAX-01          aactgc---------------------gctcaggacgtcttcatgactgt
Q08BX9_BAX-01          aactgc---------------------gctcaggacgtcttcatgactgt
A9JSY8_BAX-01          aactgc---------------------gctcaggacgtcttcatgactgt
                                                         *    *   *      

D2Y5Q2_BCLWAV-01       aggcgcagggatc-------------------------------------
B0S7M3_BOK-01          agcaacagaagtcatagccat-----------------------------
B2GRX5_BOK-01          agcaacagaagtcatagccat-----------------------------
Q7T381_BOK-01          agcaacagaagtcatagccat-----------------------------
A0A0R4IZP5_BOK-02      cgctgctgaaatcttctccacaggctctgtct------gttt------ct
A0A0R4IZP5_BOK-01      cgctgctgaaatcttctccacagaatatagtcgaaaaggtttggaaaaac
Q6DC66_BOK-01          cgctgctgaaatcttctccacagaatatagtcgaaaaggtttggaaaaac
B2GR48_BAX-03          ggcccgtgagatcttctctga-----------------------------
Q9I9N4_BAX-01          ggcccgtgagatcttctctga-----------------------------
B2GPC6_BAX-01          ggccagaagcatttttgatga-----------------------------
Q08BX9_BAX-01          ggccagaagcatttttgatga-----------------------------
A9JSY8_BAX-01          ggccagaagcatttttgatga-----------------------------
                        *         *                                      

D2Y5Q2_BCLWAV-01       ------------tggcctggagcgccgtgctgtcggtgttcgttctggct
B0S7M3_BOK-01          ----gggaa---tcacatggggtaaagtggtggccatctacgctgtagct
B2GRX5_BOK-01          ----gggaa---tcacatggggtaaagtggtggccatctacgctgtagct
Q7T381_BOK-01          ----gggaa---tcacatggggtaaagtggtggccatctacgctgtagct
A0A0R4IZP5_BOK-02      ttacaggtg---taacatgggggaagattgtgtctctgtatgcagtggct
A0A0R4IZP5_BOK-01      ataagggtg---taacatgggggaagattgtgtctctgtatgcagtggct
Q6DC66_BOK-01          ataagggtg---taacatgggggaagattgtgtctctgtatgcagtggct
B2GR48_BAX-03          ----tggcaagttcaactggggaagagttgtggcgcttttctactttgcc
Q9I9N4_BAX-01          ----tggcaagttcaactggggaagagttgtggcgcttttctactttgcc
B2GPC6_BAX-01          ----tggca---ttaactggggacgtgtggtggctctgtttcacctcgct
Q08BX9_BAX-01          ----tggca---ttaactggggacgtgtggtggctctgtttcacctcgct
A9JSY8_BAX-01          ----tggca---ttaactggggacgtgtggtggctctgtttcacctcgct
                                   *    *** *     *  ** *  * *      * ** 

D2Y5Q2_BCLWAV-01       ggtcagctggctct--gcactgccaggacaggggcatggaggacatcacg
B0S7M3_BOK-01          gccgggcttgcggt--ggactgtgtgcgactgggccatcctgtcatggtg
B2GRX5_BOK-01          gccgggcttgcggt--ggactgtgtgcgactgggccatcctgtcatggtg
Q7T381_BOK-01          gccgggcttgcggt--ggactgtgtgcgactgggccatcctgtcatggtg
A0A0R4IZP5_BOK-02      ggagctctagctgt--ggactgtgttcggcatggacatccagcaatggtg
A0A0R4IZP5_BOK-01      ggagctctagctgt--ggactgtgttcggcatggacatccagcaatggtg
Q6DC66_BOK-01          ggagctctagctgt--ggactgtgttcggaatggacatccagcaatggtg
B2GR48_BAX-03          tgtcgccttgtcatcaaggctatttcaaccagggttcct--gacatcatc
Q9I9N4_BAX-01          tgtcgccttgtcatcaaggctatttcaaccagggttcct--gacatcatc
B2GPC6_BAX-01          tataggctcattttccaggc--tctgactcagaaccacttggagattatc
Q08BX9_BAX-01          tataggctcattttccaggc--tctgactcagaaccacttggagattatc
A9JSY8_BAX-01          tataggctcattttccaggc--tctgactcagaaccactttgagattatc
                             **     *     *                     *  **    

D2Y5Q2_BCLWAV-01       ccgcagatacaggagtgtgtgggcagctacgtggagagggtcatctgccc
B0S7M3_BOK-01          cacactattgtggacagtctgggagagtttgtgcggagaagtctcgtgcc
B2GRX5_BOK-01          cacactattgtggacagtctgggagagtttgtgcggagaagtctcgtgcc
Q7T381_BOK-01          cacactattgtggacagtctgggagagtttgtgcggagaagtctcgtgcc
A0A0R4IZP5_BOK-02      cacactatcgtcgactgcatgggcgagtttgttcgcaaaagccttgcgtc
A0A0R4IZP5_BOK-01      cacactatcgtcgactgcatgggcgagtttgttcgcaaaagccttgcgtc
Q6DC66_BOK-01          cacactatcgtcgactgcatgggcgagtttgttcgcaaaagccttgcgtc
B2GR48_BAX-03          agaaccatcataagctggacgatgtcctacattcaggagcacgtcattaa
Q9I9N4_BAX-01          agaaccatcataagctggacgatgtcctacattcaggagcacgtcattaa
B2GPC6_BAX-01          aagaacatcattagctggtttttacagttcatgaagaaacacatttctgc
Q08BX9_BAX-01          aagaacatcattagctggtttttacagttcatgaagaaacacatttctgc
A9JSY8_BAX-01          aagaacatcattagctggtttttacagtttatgaagaaacacatttctgc
                             **        *          *   *           *      

D2Y5Q2_BCLWAV-01       cgagatccgggacaaaggaggatggtcaggttttatctctcgctttggag
B0S7M3_BOK-01          atggctcaaaaagagaggaggatgggttga---cattttaaaatgtgtgg
B2GRX5_BOK-01          atggctcaaaaagagaggaggatgggttga---cattttaaaatgtgtgg
Q7T381_BOK-01          atggctcaaaaagagaggaggatgggttga---cattttaaaatgtgtgg
A0A0R4IZP5_BOK-02      atggttaaagaagagaggaggctgggcgga---cataacaaagtgtgtcg
A0A0R4IZP5_BOK-01      atggttaaagaagagaggaggctgggcgga---cataacaaagtgtgtcg
Q6DC66_BOK-01          atggttaaagaagagaggaggctgggcgga---cataacaaagtgtgtcg
B2GR48_BAX-03          ctggatcagggaacagggtggatgggacgg---aa---------------
Q9I9N4_BAX-01          ctggatcagggaacagggtggatgggacgg---aa---------------
B2GPC6_BAX-01          ctggatcagacagcaaggaggatgggaggg---cattt------------
Q08BX9_BAX-01          ctggatcagacagcaaggaggatgggaggg---cattt------------
A9JSY8_BAX-01          ctggatcagacagcaaggaggatgggaggg---cattt------------
                          * *     *    ** ** ***   *     *               

D2Y5Q2_BCLWAV-01       aaaagcagaatcttgaagaccatgtggtaaaggtgtgttgctggtctctg
B0S7M3_BOK-01          tgaacatggactctagagctcatgtcca-ttggttatcgacagcagtgtt
B2GRX5_BOK-01          taaacatggactctagagctcatgtcca-ttggttatcgacagcagtgtt
Q7T381_BOK-01          taaacatggactctagagctcatgtcca-ttggttatcgacagcagtgtt
A0A0R4IZP5_BOK-02      tcagtacagaccccagtttccactctca-ctggctagtaacggccgcctg
A0A0R4IZP5_BOK-01      tcagtacagaccccagtttccactctca-ctggctagtaacggccgcctg
Q6DC66_BOK-01          tcagtacagaccccagtttccactctca-ctggctagtaacggccgcctg
B2GR48_BAX-03          tccgcagttattttgg----cacccccacctggcagacagtcggagtttt
Q9I9N4_BAX-01          tccgcagttattttgg----cacccccacctggcagacagtcggagtttt
B2GPC6_BAX-01          tccgca---------g----catgacgagatggcgcacagt----gtcta
Q08BX9_BAX-01          tccgca---------g----catgacgagatggcgcacagt----gtcta
A9JSY8_BAX-01          tccgca---------g----catgacgagatggcgcacagt----gtcta
                                           **         **               * 

D2Y5Q2_BCLWAV-01       ctcctgctgtgtgttggcatcttatcctatttcatatggacaagaagaaa
B0S7M3_BOK-01          aacatggaggg-aattca-taaagactatgtacgtctacctgacgaagta
B2GRX5_BOK-01          aacatggaggg-aattca-taaagactatgtacgtctacctgacgaagta
Q7T381_BOK-01          aacatggaggg-aattca-taaagactatgtacgtctacctgacgaagta
A0A0R4IZP5_BOK-02      cgcctgcggtc-actacc-ttaaggctgtggttttctacctgctgagaga
A0A0R4IZP5_BOK-01      cgcctgcggtc-actacc-ttaaggctgtggttttctacctgctgagaga
Q6DC66_BOK-01          cgcctgcggtc-actacc-ttaaggctgtggttttctacctgctgagaga
B2GR48_BAX-03          cc-tcgctgga-gttatcaccacagcattggtgattcgcaaaatgtga--
Q9I9N4_BAX-01          cc-tcgctgga-gttatcaccacagcattggtgattcgcaaaatgtga--
B2GPC6_BAX-01          ccatcgcagca-gtggcgttcattgtagctgttgtttactggagaagaac
Q08BX9_BAX-01          ccatcgcagca-gtggcgttcattgtagctgttgtttactggagaagaac
A9JSY8_BAX-01          ccatcgcagca-gtggcgttcattgtagctgttgtttactggagaagaac
                            *  *                         *               

D2Y5Q2_BCLWAV-01       aacctag
B0S7M3_BOK-01          g------
B2GRX5_BOK-01          g------
Q7T381_BOK-01          g------
A0A0R4IZP5_BOK-02      gaaatga
A0A0R4IZP5_BOK-01      gaaatga
Q6DC66_BOK-01          gaaatga
B2GR48_BAX-03          -------
Q9I9N4_BAX-01          -------
B2GPC6_BAX-01          tcgctag
Q08BX9_BAX-01          tcgctag
A9JSY8_BAX-01          tcgctag
                              

© 1998-2023Legal notice