Dataset for CDS BAX-like of Organism Labrus bergylta

[Download (right click)] [Edit] [Sequences] [Repertoires]

8 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A3Q3FWD6_BOK-01      atg---------------------------gaggtcctgcggaggtcctc
A0A3Q3GJV5_BAX-01      atg------------gcatcacacccgggaggaggcgatcaaggcagtac
A0A3Q3GJV5_BAX-02      atg------------gcatcacacccgggaggaggcgatcaaggta----
A0A3Q3N4D1_BAX-01      atggctgacggacgagaagaggagacgagagaagaagaccaggagcttct
A0A3Q3G721_BAX-01      atggctgatggacgagaagaggagaggagagaagaagaccaggagcttct
A0A3Q3G721_BAX-02      atggctgatggacgagaagaggagaggagagaagaagaccaggagcttct
A0A3Q3FPB4_BAX-01      atg---------------------------------------agccttct
A0A3Q3FPB4_BAX-02      atg------------------------------------cacagccctcc
                       ***                                               

A0A3Q3FWD6_BOK-01      tgtgtttgctgcagaggtcctg-------------------gatgtgttt
A0A3Q3GJV5_BAX-01      tacagatcagatactggaagtgggagctgttttgttaaag-gatttcatc
A0A3Q3GJV5_BAX-02      -acagtt-----------------------------------atttcatc
A0A3Q3N4D1_BAX-01      gggcgcagtgggaggggaa----------------------gatgtcatt
A0A3Q3G721_BAX-01      gggcgcagtgggaggggaa----------------------gatgtcatt
A0A3Q3G721_BAX-02      gggcgcagtgggaggggaa----------------------ggtat----
A0A3Q3FPB4_BAX-01      taaccag-----actgga-----------------------ggtgttagt
A0A3Q3FPB4_BAX-02      tcctctggtcttaccggagtcctctgctgttctgtctgctcggtgtgtgt
                                                                  * *    

A0A3Q3FWD6_BOK-01      gaccgctcgttaactgagaaggagctggtgacccagtc----aaaggccc
A0A3Q3GJV5_BAX-01      tatgagcg---------------------ggtccggcg--------gcat
A0A3Q3GJV5_BAX-02      tatgagcg---------------------ggtccggcg--------gcat
A0A3Q3N4D1_BAX-01      gatgaccccatcattgatcagggagcggtggtcctcag-----agggtat
A0A3Q3G721_BAX-01      gatgaccccatcgtggatctggctgcagtgctcctcag-----agggtat
A0A3Q3G721_BAX-02      ----------------------------------------------gtat
A0A3Q3FPB4_BAX-01      g--gaccag-------gaga---------ggtcctctgtgatgtgg----
A0A3Q3FPB4_BAX-02      ggcgaccggctagcttgatagcatcgtccggtactccgttgtttagccat
                                                                         

A0A3Q3FWD6_BOK-01      tgtgcagagactaca------tattgtcccgactgaaccagaa------c
A0A3Q3GJV5_BAX-01      ggagacggcaatgcta-----cagtgacccgggcgc--------------
A0A3Q3GJV5_BAX-02      ggagacggcaatgcta-----cagtgacccgggcgc--------------
A0A3Q3N4D1_BAX-01      gtgattgaacgtataaacgccgaggagcccggtcgacacgtgtcgcctga
A0A3Q3G721_BAX-01      gcgattgaaagtataaaggccgaggagcccggtcgacacgtgtcgcctga
A0A3Q3G721_BAX-02      gcgattgaaagtataaaggccgaggagcccggtcgacacgtgtcgcctga
A0A3Q3FPB4_BAX-01      gtccccaggaacttgaag--ctggagacacgttcaacagccat--cccgt
A0A3Q3FPB4_BAX-02      gtttccgtgaatatca-----tgacattacagtccata---at--tctct
                                                    *                    

A0A3Q3FWD6_BOK-01      ggactgggatggtccaaaactgaa----ctcaacctctctccttcaagtg
A0A3Q3GJV5_BAX-01      --agctgggcggaagtgagctgtg-------------tgaccc----gaa
A0A3Q3GJV5_BAX-02      --agctgggcggaagtgagctgtg-------------tgaccc----gaa
A0A3Q3N4D1_BAX-01      ggatctgggagg---aaggtcgag-------------tgaacaacaggat
A0A3Q3G721_BAX-01      ggatctgggagg---aaggtcgag-------------tgaacaacaggat
A0A3Q3G721_BAX-02      ggatctgggagg---aaggtcgag-------------tgaacaacaggat
A0A3Q3FPB4_BAX-01      tgatgtgaat-----ggggttgtgcgtgcttcctctttctctcctgaagt
A0A3Q3FPB4_BAX-02      tgctgtggatgatgcgaagtcgtaact-cgtccattttgttcaccaaaga
                             *              *               *            

A0A3Q3FWD6_BOK-01      caatg------------ctcactgaggtgtctttggttcttctctgttta
A0A3Q3GJV5_BAX-01      ccaca----------------agaagctcgcccagtgcctgcagcagatc
A0A3Q3GJV5_BAX-02      ccaca----------------agaagctcgcccagtgcctgcagcagatc
A0A3Q3N4D1_BAX-01      ccaca-----------agtcaaagaagtggtggaacagctgctaaagatc
A0A3Q3G721_BAX-01      ccaca-----------agtcaaagaaatggtggaacagctgctaaagatc
A0A3Q3G721_BAX-02      ccaca-----------agtcaaagaaatggtggaacagctgctaaagatc
A0A3Q3FPB4_BAX-01      ccacgatgatctccttcgtcttgctggtgttgaggagcagg-------tt
A0A3Q3FPB4_BAX-02      ccgca-------cattagcgaggaaaatgctgggtaacgggagacggtgc
                       *                          *                      

A0A3Q3FWD6_BOK-01      ggtgatgagctggagtgtat--------gcagcccaatttgtacaggaac
A0A3Q3GJV5_BAX-01      ggcgacgagctcgatgggaatgtaga--gctccaaag---------gatg
A0A3Q3GJV5_BAX-02      ggcgacgagctcgatgggaatgtaga--gctccaaag---------gatg
A0A3Q3N4D1_BAX-01      gctgatgagctgaacaggaacgccga--gctccaaca-------------
A0A3Q3G721_BAX-01      ac---tgagctgaacaggaacgccga--gctccaaca-------------
A0A3Q3G721_BAX-02      ac---tgagctgaacaggaacgccga--gctccaaca-------------
A0A3Q3FPB4_BAX-01      gttg-tcagc------------------acaccagtattttcttgctgtc
A0A3Q3FPB4_BAX-02      ggtg-ttagctttagcttagcccttatacctccgctattttcttgctgtc
                              ***                   *  *                 

A0A3Q3FWD6_BOK-01      gtggcacggcagctcaacatttctgttgctatggaaaacatggtttcaga
A0A3Q3GJV5_BAX-01      ataaac----aattcatcaatca-gtccc---acaaaa----------ga
A0A3Q3GJV5_BAX-02      ataaac----aattcatcaatca-gtccc---acaaaa----------ga
A0A3Q3N4D1_BAX-01      -----------actcatcaaccaggttcc---aggcaactgcgcccaggg
A0A3Q3G721_BAX-01      -----------actcatcaaccaggttct---aggcaactgtgcccgggg
A0A3Q3G721_BAX-02      -----------actcatcaaccaggttct---aggcaactgtgcccgggg
A0A3Q3FPB4_BAX-01      atgtca----gactcatcaaccaggttcc---aggcaactgtgcccgggg
A0A3Q3FPB4_BAX-02      atgtca----gactcatcaaccaggttcc---aggcaactgtgcccgggg
                                    *** **     **          **          * 

A0A3Q3FWD6_BOK-01      tgccttcatcggtgtggcaacagagattttctcaacaggta---taacgt
A0A3Q3GJV5_BAX-01      catgtttgtgaaagtcgccatagagatcttttcagatgggaggttcaact
A0A3Q3GJV5_BAX-02      catgtttgtgaaagtcgccatagagatcttttcagatgggaggttcaact
A0A3Q3N4D1_BAX-01      tatcttcatgaaggtggccagaaacatctttgctgatggca---tcaact
A0A3Q3G721_BAX-01      tatcttcacgaaggtggccagaaacaactttgctgatggca---tcaact
A0A3Q3G721_BAX-02      tatcttcacgaaggtggccagaaacaactttgctgatggca---tcaact
A0A3Q3FPB4_BAX-01      tatcttcatgaaggtggccagaaacatctttgctgatggca---tccact
A0A3Q3FPB4_BAX-02      tatcttcatgaaggtggccagaaacatctttgctgatggca---tccact
                           **       ** ** * * * *  **  *    ** *   *    *

A0A3Q3FWD6_BOK-01      ggggtaaagtagtgtccatgtttgcagtgg-ctggagccctagcagt-ag
A0A3Q3GJV5_BAX-01      ggggccgggttgtcgccctgttctacttcgcctgtcgccttgtcatcaaa
A0A3Q3GJV5_BAX-02      ggggccgggttgtcgccctgttctacttcgcctgtcgccttgtcatcaaa
A0A3Q3N4D1_BAX-01      ggggtcgtgtggtggctctcttccatctggcctacagactcatctacaag
A0A3Q3G721_BAX-01      ggggtcgtgtggtggctctcttccatctggcctacagactcatctacaag
A0A3Q3G721_BAX-02      ggggtcgtgtggtggctctcttccatctggcctacagactcatctacaag
A0A3Q3FPB4_BAX-01      ggggtcgtgtggtggctctcttccatctggcctacagactcatctacaag
A0A3Q3FPB4_BAX-02      ggggtcgtgtggtggctctcttccatctggcctacagactcatctacaag
                       ****    ** **  *  * **     * * **   * *    *    * 

A0A3Q3FWD6_BOK-01      attgtgtcagacaaggttacccgactaccgttcacatcctcgtggacagt
A0A3Q3GJV5_BAX-01      gctctcatgaccca--agttcctgatatcatcagaacaataatcaactgg
A0A3Q3GJV5_BAX-02      gctctcatgaccca--agttcctgatatcatcagaacaataatcaactgg
A0A3Q3N4D1_BAX-01      gcgataacaagcaa--ccatctagagaacatcaaaatcatcatcagctgg
A0A3Q3G721_BAX-01      gcgataacaagcaa--ccatctagagaacatcaaaatcatcttcagctgg
A0A3Q3G721_BAX-02      gcgataacaagcaa--ccatctagagaacatcaaaatcatcttcagctgg
A0A3Q3FPB4_BAX-01      gcaataaccagcaa--ccatgaagagaacatcaaaatcatcttcagctgg
A0A3Q3FPB4_BAX-02      gcaataaccagcaa--ccatgaagagaacatcaaaatcatcttcagctgg
                           *      * *            * * *    *   *  *   * * 

A0A3Q3FWD6_BOK-01      ctgggccagtttgttcgcaagtttctggttccctggctgaagagacgggg
A0A3Q3GJV5_BAX-01      accttggactacctccaggaaaatgtgatcaactggatcagggagcaagg
A0A3Q3GJV5_BAX-02      accttggactacctccaggaaaatgtgatcaactggatcagggagcaagg
A0A3Q3N4D1_BAX-01      gttcttcaggtcatcagagagcagctccacacctggctcgtacagcaggg
A0A3Q3G721_BAX-01      tttcttcaggtcatcagagagcagctccacacctggctcgtacagcaggg
A0A3Q3G721_BAX-02      tttcttcaggtcatcagagagcagctccacacctggctcgtacagcaggg
A0A3Q3FPB4_BAX-01      gttcttcaggtcatcagagagcagctccacacctggctcgtacagcaggg
A0A3Q3FPB4_BAX-02      gttcttcaggtcatcagagagcagctccacacctggctcgtacagcaggg
                              *     *     *     *      **** *       *  **

A0A3Q3FWD6_BOK-01      aggatgggcggaaat---aacaaaatgtgtggtgaagaaggatctaacgc
A0A3Q3GJV5_BAX-01      tggctgggaggggattcggtcctacttcg----------gcactcccaca
A0A3Q3GJV5_BAX-02      tggctgggaggggattcggtcctacttcg----------gcactcccaca
A0A3Q3N4D1_BAX-01      aggctgggagggagt--gatcc----gtg----------ggatttctcgc
A0A3Q3G721_BAX-01      aggctgggagggggt--gatcc----gtg----------ggatttctcgc
A0A3Q3G721_BAX-02      aggctgggagggggt--gatcc----gtg----------ggatttctcgc
A0A3Q3FPB4_BAX-01      aggctgggtgggggt--gatcc----ttg----------ggatttctcgt
A0A3Q3FPB4_BAX-02      aggctgggt--gagt--gat-------------------ggatggtctgt
                        ** ****      *                        * *        

A0A3Q3FWD6_BOK-01      ctgagcagcactggctgtcgtctagcatcgattccctgaagtatttcctt
A0A3Q3GJV5_BAX-01      tggcaga-ccgtgggagtttt---------cttggctggtgttc----tc
A0A3Q3GJV5_BAX-02      tggcaga-ccgtgggagtttt---------cttggctggtgttc----tc
A0A3Q3N4D1_BAX-01      tggagga-cagtagccatagt---------agcatcagtagtat----ta
A0A3Q3G721_BAX-01      tggagga-cagtagccatagt---------agcatcagtagtat----ta
A0A3Q3G721_BAX-02      tggagga-cagtagccatagt---------agcatcagtagtat----ta
A0A3Q3FPB4_BAX-01      tggagga-cagtagccatagt---------agcatcagtagtat----ta
A0A3Q3FPB4_BAX-02      --aagga-cc----------------------tgtcagt-----------
                             * *                          * *            

A0A3Q3FWD6_BOK-01      actacagtatacgtctacatcatgaaggagcagtga
A0A3Q3GJV5_BAX-01      accactgttctagtcattcgcaagatg------tga
A0A3Q3GJV5_BAX-02      accactgttctagtcattcgcaagatg------tga
A0A3Q3N4D1_BAX-01      gtggcaacttttgtttactacaggagaacacgctga
A0A3Q3G721_BAX-01      gtggcaacttttgtttactacaggagaacacgctga
A0A3Q3G721_BAX-02      gtggcaacttttgtttactacaggagaacacgctga
A0A3Q3FPB4_BAX-01      gtggcaacttttgtttactgcaggaaaacacactga
A0A3Q3FPB4_BAX-02      -------catgtgctta------------------a
                                   *                      *

© 1998-2023Legal notice