Dataset for CDS BCL-2-like of organism Chrysolophus pictus

[Download (right click)] [Alignment] [Repertoires]

3 sequence(s)

>gnl|bcl2dbcds|A0A8C3KTI3_BCL2A1-01 BCL2-related protein A1 gene OS=[Eukaryota] Chrysolophus pictus GN=BCL2A1 (length=525 residues).
atggaaactgctgagttctactatgtttattatttagctcaagattatctgcagtatgtgcttcaggaatcacatcttgg
accagcccaaaccagagttgctcatgtcttgcgaaacattgcatcctcactccaagatcagacagaggaggctctcagac
ccttcctggacaggatcgatattacctccgtagatgttgccaagagaattttcaatggagtcatggaagaaaaatttgct
gatggaaatactaactggggacgaattatgaccatatttacttttggaggtcttctcaccaagaagcttcaagagcatgg
agttcagctcactggagaggagaaggagcagatttcttatttcatcacagagtacatcataaataacaaagccgcatgga
tagatgcaaacggtggctgggaaaacggtttcctaacaaagtttgaaagaagatcaccactatctttctccacaattaca
gacatatttgcagctgttttttccttgtttagagagtactactga
>gnl|bcl2dbcds|A0A8C3LBC4_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Chrysolophus pictus GN=BCL-2 (length=702 residues).
atggctcaccccgggagaagaggctatgacaaccgcgagatagtgctgaagtacatccactataaactctcgcagcgggg
ctacgactgggccgccggcgaggacaggccacccgtacccccggccctggctcccactgctgctcccactgcggtggctg
ctgctggagcctcctcccaccaccgccccgagccccccggctcggctgctgctagtgaggtgcccccagctgaggggctg
agccccgcacctcccggcgtccacctcgccctgcgccaggctggggacgaattctcacgccgctaccagagggactttgc
ccagatgtcgggccagctgcacctgacgcccttcacggcccacggccgcttcgtggccgtggtggaggagcttttccgtg
atggggtcaactggggtcggatcgtcgccttctttgagttcggtggcgtgatgtgcgtcgagagcgtcaaccgggagatg
tcgccgctggtggacaacattgccacctggatgaccgagtacctgaacaggcacctgcataactggatccaggacaacgg
aggatgggatgccttcgtggaattgtacggcaacagcatgaggcctttgtttgatttctcctggatctctctgaagacca
tcctgagcctggttctggtgggagcttgcatcactcttggcgcttatcttggacataagtag
>gnl|bcl2dbcds|A0A8C3LRK6_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Chrysolophus pictus GN=BCL2L1 (length=690 residues).
atgtccagcagaaaccgggagttagtgattgactttgtttcctacaagctctcgcagaaggggcactgctggagcgagct
ggaggaagaggatgagaacaggactgacactgcagcagaggcagagatggacagcgtcctcaatgggagcccgtcctggc
acccgcctgccggccacgtagtgaatggagccaccgtgcacaggagcagcctggaagttcatgaaattgttcgagcatct
gacgtgaggcaggcgctgagagatgcaggggatgagtttgagctgaggtaccggagggctttcagcgacctcacctccca
gctccacatcacccctggcacggcgtaccagagctttgagcaggtagtgaatgaactcttccatgatggtgtgaactggg
ggcgcatcgtggctttcttctccttcggaggggctttgtgcgtggagagcgtggacaaggagatgcgggtactggtggga
cgcattgtgtcttggatgaccacgtacttgaccgaccatctagatccctggatccaggagaatggcggctgggagcgctt
tgtggacctgtatgggaataatgctgctgccgagctgaggaagggccaggagaccttcaacaaatggctcctgaccgggg
cgaccgtggctggagtgcttctgctgggatccctgctgagccgcaagtga
© 1998-2022Legal notice