Dataset for CDS BCL-2-like of organism Chrysolophus pictus

[Download (right click)] [Edit] [Sequences] [Repertoires]

3 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A8C3KTI3_BCL2A1-      atg-------------ga------------aactgct-----gagttcta
A0A8C3LBC4_BCL2-01      atggctcaccccgggagaagaggctatgacaaccgcgagatagtgctgaa
A0A8C3LRK6_BCL2L1-      atg------tccagcaga------------aaccgggagttagtgattga
                        ***             **            *** *       * * *  *

A0A8C3KTI3_BCL2A1-      ctatgtttattatttagct-------------------------------
A0A8C3LBC4_BCL2-01      gtacatccacta-taaactctcgcagcggggctacgactgggcc--gccg
A0A8C3LRK6_BCL2L1-      ctttgtttccta-caagctctcgcagaaggggcactgctggagcgagctg
                         *   *    **   * **                               

A0A8C3KTI3_BCL2A1-      -----------caagattat-----------------------------c
A0A8C3LBC4_BCL2-01      g----------cgaggacaggccacccgtacccccggccctggctcccac
A0A8C3LRK6_BCL2L1-      gaggaagaggatgagaacag---------------------gactgacac
                                     **   *                              *

A0A8C3KTI3_BCL2A1-      tgcagtatgtgcttc------------------aggaatcacatcttgg-
A0A8C3LBC4_BCL2-01      tgctgctcccactgcggtggctgctgc------tggagcctcctcccacc
A0A8C3LRK6_BCL2L1-      tgcagcagaggcagagatggacagcgtcctcaatgggagcccgtcctggc
                        *** *      *                      **   * * **     

A0A8C3KTI3_BCL2A1-      acc-----------------------------------------------
A0A8C3LBC4_BCL2-01      accgccccgagccccccggctcggctgctgctagtga--ggtgccccca-
A0A8C3LRK6_BCL2L1-      acc------cgcctgccggccacg-------tagtgaatggagccaccgt

A0A8C3KTI3_BCL2A1-      ------------agcccaaa-----------------------ccagagt
A0A8C3LBC4_BCL2-01      gctgaggggctgagccccgcacctc------------------ccggcgt
A0A8C3LRK6_BCL2L1-      gcacaggagc--agcctggaagttcatgaaattgttcgagcatctgacgt
                                    ****                           *    **

A0A8C3KTI3_BCL2A1-      tgctcatgtcttgcgaaacat------tgcatcctcactccaagatcaga
A0A8C3LBC4_BCL2-01      ccacctcgccctgcgccaggctggggacgaattctcacgccgctaccaga
A0A8C3LRK6_BCL2L1-      gaggcaggcgctgagagatgcaggggatgagtttgagctgaggtaccgga
                            *  *   ** *  *          *  *     *      * * **

A0A8C3KTI3_BCL2A1-      cagaggaggctctcagacccttcctggacaggatcgatattacctccgta
A0A8C3LBC4_BCL2-01      ------gggactttgcccagatgtcgggccagctgcacctgacgccctt-
A0A8C3LRK6_BCL2L1-      ------gggctttcagcgacctcacctcccagctccacatcacccctgg-
                               **   *        *      *  * *  *  * **  *    

A0A8C3KTI3_BCL2A1-      gatgttgccaagagaattttcaatggagtcatggaagaaaaatttgctga
A0A8C3LBC4_BCL2-01      --cacggcccacggccgcttcgtggccgtggtggaggagcttttccgtga
A0A8C3LRK6_BCL2L1-      --cacggcgtaccagagctttgagcaggtagtgaatgaactcttccatga
                              **  *       **       **  ** * **    **   ***

A0A8C3KTI3_BCL2A1-      tggaaatactaactggggacgaattatgaccatatttacttttggaggtc
A0A8C3LBC4_BCL2-01      tgg---ggtcaactggggtcggatcgtcgccttctttgagttcggtggcg
A0A8C3LRK6_BCL2L1-      tgg---tgtgaactgggggcgcatcgtggctttcttctccttcggagggg
                        ***       ******** ** **  *  *  * **    ** ** **  

A0A8C3KTI3_BCL2A1-      ttctcaccaagaagcttcaagagcat------ggagttcagctcactgga
A0A8C3LBC4_BCL2-01      tgat-------gtgcgtcgagagcgtcaaccgggagatgtcgccgctgg-
A0A8C3LRK6_BCL2L1-      cttt-------gtgcgtggagagcgtggacaaggagatgcgggtactgg-
                           *         ** *  ***** *      **** *       **** 

A0A8C3KTI3_BCL2A1-      gaggagaaggagcagatttcttatttcatcacagagtacatcataaataa
A0A8C3LBC4_BCL2-01      -------tggacaacattgccacctggatgaccgagtacctgaacaggca
A0A8C3LRK6_BCL2L1-      -------tgggacgcattgtgtcttggatgaccacgtacttgaccgacca
                                **     ***      *  ** **   **** * *      *

A0A8C3KTI3_BCL2A1-      caaagccgcatggatagatgcaaacggtggctggga----------aaac
A0A8C3LBC4_BCL2-01      cctgcataactggatccaggacaacggaggatgggatgccttcgtggaat
A0A8C3LRK6_BCL2L1-      tctagatccctggatccaggagaatggcggctgggagcgctttgtggacc
                                  *****  * *  ** ** ** *****           *  

A0A8C3KTI3_BCL2A1-      ggtttcctaacaaagtt------------------tgaaagaagatcacc
A0A8C3LBC4_BCL2-01      tgtacggcaacag-------------------------catgaggccttt
A0A8C3LRK6_BCL2L1-      tgtatgggaataatgctgctgccgagctgaggaagggccaggagaccttc
                         **     ** *                           *  **  *   

A0A8C3KTI3_BCL2A1-      actatctttctccacaattac-----agacatatttgcagctgttttttc
A0A8C3LBC4_BCL2-01      gtttgatttctcctggatctctctgaagaccatcctgagcctggttctgg
A0A8C3LRK6_BCL2L1-      aacaaatggctcctga----ccggggcgaccgtggctggagtgcttctgc
                              *  ****       *      ***           ** ** *  

A0A8C3KTI3_BCL2A1-      -----------------cttg--------tttagagagtactactga
A0A8C3LBC4_BCL2-01      tgggagcttgcatcactcttggcgcttatcttgga---cataagtag
A0A8C3LRK6_BCL2L1-      tgggatc----------cctg--------ctgagc---cgcaagtga
                                         * **         *  *        * *  

© 1998-2023Legal notice