Dataset for CDS Unclassified of organism Crassostrea gigas

[Download (right click)]

20 sequence(s)

>gnl|bcl2dbcds|A0A8W8I482_uncBCL2L1-01 Putative BCL2-like 1 gene OS=[Eukaryota] Crassostrea gigas (length=189 residues).
gattcatgtgccaaaattcgtctacagcttggcaaacttgggaatttaaatatcttgattaaatggaccaatgatgcgtt
ttctgattattttcccgagcaaggagcaacagaggacaagctttggaagggcctgatgttcactgcagtaggtctcgtga
cattgggaaccatggttgctaggagttga
>gnl|bcl2dbcds|A0A8W8I482_uncBCL2L1-03 Putative BCL2-like 1 gene OS=[Eukaryota] Crassostrea gigas (length=525 residues).
accacaccgatggataaagtccgacagacagcagaggtgatagcttctgatgttattgccacatttgaagatgattctac
caaaactccacaaaacagatactgtaaaacaatgagaagaactgtaaaagaaatgtccgaccgacataatatcgctttta
aatctatggtgcagaaattgaatgtgaatgacactaatgccttctcaacattcgtatcagttgcggatgagatttttgag
gacgggacaattaattgggggagaatcgttgctgtctacacttttgcttcacgattggcagcccattgtaaaaaacataa
ccccgaatcagaagaaaggatagcactctatgcaggaaaatatgtggcaagcaaattggggaaatggatcttggataatg
ggggatgggatgcgttttctgattattttcccgagcaaggagcaacagaggacaagctttggaagggcctgatgttcact
gcagtaggtctcgtgacattgggaaccatggttgctaggagttga
>gnl|bcl2dbcds|A0A8W8I482_uncBCL2L1-04 Putative BCL2-like 1 gene OS=[Eukaryota] Crassostrea gigas (length=561 residues).
acaaaattagaccaagaaacacagactcctggcagtaccacaccgatggataaagtccgacagacagcagaggtgatagc
ttctgatgttattgccacatttgaagatgattctaccaaaactccacaaaacagatactgtaaaacaatgagaagaactg
taaaagaaatgtccgaccgacataatatcgcttttaaatctatggtgcagaaattgaatgtgaatgacactaatgccttc
tcaacattcgtatcagttgcggatgagatttttgaggacgggacaattaattgggggagaatcgttgctgtctacacttt
tgcttcacgattggcagcccattgtaaaaaacataaccccgaatcagaagaaaggatagcactctatgcaggaaaatatg
tggcaagcaaattggggaaatggatcttggataatgggggatgggatgcgttttctgattattttcccgagcaaggagca
acagaggacaagctttggaagggcctgatgttcactgcagtaggtctcgtgacattgggaaccatggttgctaggagttg
a
>gnl|bcl2dbcds|A0A8W8I482_uncBCL2L1-05 Putative BCL2-like 1 gene OS=[Eukaryota] Crassostrea gigas (length=333 residues).
actaatgccttctcaacattcgtatcagttgcggatgagatttttgaggacgggacaattaattgggggagaatcgttgc
tgtctacacttttgcttcacgattggcagcccattgtaaaaaacataaccccgaatcagaagaaaggatagcactctatg
caggaaaatatgtggcaagcaaattggggaaatggatcttggataatgggggatgggatgcgttttctgattattttccc
gagcaaggagcaacagaggacaagctttggaagggcctgatgttcactgcagtaggtctcgtgacattgggaaccatggt
tgctaggagttga
>gnl|bcl2dbcds|A0A8W8I482_uncBCL2L1-06 Putative BCL2-like 1 gene OS=[Eukaryota] Crassostrea gigas (length=684 residues).
atggctaccgaattagaaaacataaagcattccaatggaacctatctgaaaggaaatctattcaatgaaatccaccggca
gcttggtattcttcctggacttgctggattagggcaagatatgacaaaattagaccaagaaacacagactcctggcagta
ccacaccgatggataaagtccgacagacagcagaggtgatagcttctgatgttattgccacatttgaagatgattctacc
aaaactccacaaaacagatactgtaaaacaatgagaagaactgtaaaagaaatgtccgaccgacataatatcgcttttaa
atctatggtgcagaaattgaatgtgaatgacactaatgccttctcaacattcgtatcagttgcggatgagatttttgagg
acgggacaattaattgggggagaatcgttgctgtctacacttttgcttcacgattggcagcccattgtaaaaaacataac
cccgaatcagaagaaaggatagcactctatgcaggaaaatatgtggcaagcaaattggggaaatggatcttggataatgg
gggatgggatgcgttttctgattattttcccgagcaaggagcaacagaggacaagctttggaagggcctgatgttcactg
cagtaggtctcgtgacattgggaaccatggttgctaggagttga
>gnl|bcl2dbcds|A0A8W8I482_uncBCL2L1-07 Putative BCL2-like 1 gene OS=[Eukaryota] Crassostrea gigas (length=684 residues).
atggctaccgaattagaaaacataaagcattccaatggaacctatctgaaaggaaatctattcaatgaaatccaccggca
gcttggtattcttcctggacttgctggattagggcaagatatgacaaaattagaccaagaaacacagactcctggcagta
ccacaccgatggataaagtccgacagacagcagaggtgatagcttctgatgttattgccacatttgaagatgattctacc
aaaactccacaaaacagatactgtaaaacaatgagaagaactgtaaaagaaatgtccgaccgacataatatcgcttttaa
atctatggtgcagaaattgaatgtgaatgacactaatgccttctcaacattcgtatcagttgcggatgagatttttgagg
acgggacaattaattgggggagaatcgttgctgtctacacttttgcttcacgattggcagcccattgtaaaaaacataac
cccgaatcagaagaaaggatagcactctatgcaggaaaatatgtggcaagcaaattggggaaatggatcttggataatgg
gggatgggatgcgttttctgattattttcccgagcaaggagcaacagaggacaagctttggaagggcctgatgttcactg
cagtaggtctcgtgacattgggaaccatggttgctaggagttga
>gnl|bcl2dbcds|A0A8W8I482_uncBCL2L1-08 Putative BCL2-like 1 gene OS=[Eukaryota] Crassostrea gigas (length=216 residues).
aaaaaacataaccccgaatcagaagaaaggatagcactctatgcaggaaaatatgtggcaagcaaattggggaaatggat
cttggataatgggggatgggatgcgttttctgattattttcccgagcaaggagcaacagaggacaagctttggaagggcc
tgatgttcactgcagtaggtctcgtgacattgggaaccatggttgctaggagttga
>gnl|bcl2dbcds|A0A8W8I482_uncBCL2L1-09 Putative BCL2-like 1 gene OS=[Eukaryota] Crassostrea gigas (length=606 residues).
cagcttggtattcttcctggacttgctggattagggcaagatatgacaaaattagaccaagaaacacagactcctggcag
taccacaccgatggataaagtccgacagacagcagaggtgatagcttctgatgttattgccacatttgaagatgattcta
ccaaaactccacaaaacagatactgtaaaacaatgagaagaactgtaaaagaaatgtccgaccgacataatatcgctttt
aaatctatggtgcagaaattgaatgtgaatgacactaatgccttctcaacattcgtatcagttgcggatgagatttttga
ggacgggacaattaattgggggagaatcgttgctgtctacacttttgcttcacgattggcagcccattgtaaaaaacata
accccgaatcagaagaaaggatagcactctatgcaggaaaatatgtggcaagcaaattggggaaatggatcttggataat
gggggatgggatgcgttttctgattattttcccgagcaaggagcaacagaggacaagctttggaagggcctgatgttcac
tgcagtaggtctcgtgacattgggaaccatggttgctaggagttga
>gnl|bcl2dbcds|A0A8W8I482_uncBCL2L1-12 Putative BCL2-like 1 gene OS=[Eukaryota] Crassostrea gigas (length=684 residues).
atggctaccgaattagaaaacataaagcattccaatggaacctatctgaaaggaaatctattcaatgaaatccaccggca
gcttggtattcttcctggacttgctggattagggcaagatatgacaaaattagaccaagaaacacagactcctggcagta
ccacaccgatggataaagtccgacagacagcagaggtgatagcttctgatgttattgccacatttgaagatgattctacc
aaaactccacaaaacagatactgtaaaacaatgagaagaactgtaaaagaaatgtccgaccgacataatatcgcttttaa
atctatggtgcagaaattgaatgtgaatgacactaatgccttctcaacattcgtatcagttgcggatgagatttttgagg
acgggacaattaattgggggagaatcgttgctgtctacacttttgcttcacgattggcagcccattgtaaaaaacataac
cccgaatcagaagaaaggatagcactctatgcaggaaaatatgtggcaagcaaattggggaaatggatcttggataatgg
gggatgggatgcgttttctgattattttcccgagcaaggagcaacagaggacaagctttggaagggcctgatgttcactg
cagtaggtctcgtgacattgggaaccatggttgctaggagttga
>gnl|bcl2dbcds|A0A8W8I482_uncBCL2L1-13 Putative BCL2-like 1 gene OS=[Eukaryota] Crassostrea gigas (length=684 residues).
atggctaccgaattagaaaacataaagcattccaatggaacctatctgaaaggaaatctattcaatgaaatccaccggca
gcttggtattcttcctggacttgctggattagggcaagatatgacaaaattagaccaagaaacacagactcctggcagta
ccacaccgatggataaagtccgacagacagcagaggtgatagcttctgatgttattgccacatttgaagatgattctacc
aaaactccacaaaacagatactgtaaaacaatgagaagaactgtaaaagaaatgtccgaccgacataatatcgcttttaa
atctatggtgcagaaattgaatgtgaatgacactaatgccttctcaacattcgtatcagttgcggatgagatttttgagg
acgggacaattaattgggggagaatcgttgctgtctacacttttgcttcacgattggcagcccattgtaaaaaacataac
cccgaatcagaagaaaggatagcactctatgcaggaaaatatgtggcaagcaaattggggaaatggatcttggataatgg
gggatgggatgcgttttctgattattttcccgagcaaggagcaacagaggacaagctttggaagggcctgatgttcactg
cagtaggtctcgtgacattgggaaccatggttgctaggagttga
>gnl|bcl2dbcds|A0A8W8I482_uncBCL2L1-15 Putative BCL2-like 1 gene OS=[Eukaryota] Crassostrea gigas (length=618 residues).
atggctaccgaattagaaaacataaagcattccaatggaacctatctgaaaggaaatctattcaatgaaatccaccggca
gcttggtattcttcctggacttgctggattagggcaagatatgacaaaattagaccaagaaacacagactcctggcagta
ccacaccgatggataaagtccgacagacagcagaggtgatagcttctgatgttattgccacatttgaagatgattctacc
aaaactccacaaaacagatactgtaaaacaatgagaagaactgtaaaagaaatgtccgaccgacataatatcgcttttaa
atctatggtgcagaaattgaatgtgaatgacactaatgccttctcaacattcgtatcagttgcggatgagatttttgagg
acgggacaattaattgggggagaatcgttgctgtctacacttttgcttcacgattggcagcccattgtaaaaaacataac
cccgaatcagaagaaaggatagcactctatgcaggaaaatatgtggcaagcaaattggggaaatggatcttggataatgg
gggatgggttagtattgatttgaatgtcaactgtaacttgaagagatcattagtataa
>gnl|bcl2dbcds|A0A8W8I482_uncBCL2L1-16 Putative BCL2-like 1 gene OS=[Eukaryota] Crassostrea gigas (length=684 residues).
atggctaccgaattagaaaacataaagcattccaatggaacctatctgaaaggaaatctattcaatgaaatccaccggca
gcttggtattcttcctggacttgctggattagggcaagatatgacaaaattagaccaagaaacacagactcctggcagta
ccacaccgatggataaagtccgacagacagcagaggtgatagcttctgatgttattgccacatttgaagatgattctacc
aaaactccacaaaacagatactgtaaaacaatgagaagaactgtaaaagaaatgtccgaccgacataatatcgcttttaa
atctatggtgcagaaattgaatgtgaatgacactaatgccttctcaacattcgtatcagttgcggatgagatttttgagg
acgggacaattaattgggggagaatcgttgctgtctacacttttgcttcacgattggcagcccattgtaaaaaacataac
cccgaatcagaagaaaggatagcactctatgcaggaaaatatgtggcaagcaaattggggaaatggatcttggataatgg
gggatgggatgcgttttctgattattttcccgagcaaggagcaacagaggacaagctttggaagggcctgatgttcactg
cagtaggtctcgtgacattgggaaccatggttgctaggagttga
>gnl|bcl2dbcds|A0A8W8I482_uncBCL2L1-19 Putative BCL2-like 1 gene OS=[Eukaryota] Crassostrea gigas (length=585 residues).
atggctaccgaattagaaaacataaagcattccaatggaacctatctgaaaggaaatctattcaatgaaatccaccggca
gcttggtattcttcctggacttgctggattagggcaagatatgacaaaattagaccaagaaacacagactcctggcagta
ccacaccgatggataaagtccgacagacagcagaggtgatagcttctgatgttattgccacatttgaagatgattctacc
aaaactccacaaaacagatactgtaaaacaatgagaagaactgtaaaagaaatgtccgaccgacataatatcgcttttaa
atctatggtgcagaaattgaatgtgaatgacactaatgccttctcaacattcgtatcagttgcggatgagatttttgagg
acgggacaattaattgggggagaatcgttgctgtctacacttttgcttcacgattggcagcccattgtaaaaaacataac
cccgaatcagaagaaaggatagcactctatgcaggaaaatatgtggcaagcaaattggggaaatggatcttggagatgaa
caatcttatattgaaggacacttga
>gnl|bcl2dbcds|A0A8W8I482_uncBCL2L1-20 Putative BCL2-like 1 gene OS=[Eukaryota] Crassostrea gigas (length=684 residues).
atggctaccgaattagaaaacataaagcattccaatggaacctatctgaaaggaaatctattcaatgaaatccaccggca
gcttggtattcttcctggacttgctggattagggcaagatatgacaaaattagaccaagaaacacagactcctggcagta
ccacaccgatggataaagtccgacagacagcagaggtgatagcttctgatgttattgccacatttgaagatgattctacc
aaaactccacaaaacagatactgtaaaacaatgagaagaactgtaaaagaaatgtccgaccgacataatatcgcttttaa
atctatggtgcagaaattgaatgtgaatgacactaatgccttctcaacattcgtatcagttgcggatgagatttttgagg
acgggacaattaattgggggagaatcgttgctgtctacacttttgcttcacgattggcagcccattgtaaaaaacataac
cccgaatcagaagaaaggatagcactctatgcaggaaaatatgtggcaagcaaattggggaaatggatcttggataatgg
gggatgggatgcgttttctgattattttcccgagcaaggagcaacagaggacaagctttggaagggcctgatgttcactg
cagtaggtctcgtgacattgggaaccatggttgctaggagttga
>gnl|bcl2dbcds|A0A8W8J5P7_uncBCL2L1-01 Putative BCL2-like 1 gene OS=[Eukaryota] Crassostrea gigas (length=1392 residues).
atggctgaaagcaaaaaaacggagttggagatccatagggagatgatgacactgttatcacatcttagggaaaaaaagac
cagagttcgcaagaaagtacctatggcccaaacatcaaagcaagaaatcaaagctgacgttcgcaaaatcttggaacaat
tcctaaagaaacaacaactgaacgatgatgaagaggaaggtgcaataccaactggatttcagagagaagatgttgagaat
gtgactgaaacttatcgatcaggcagcacaaacacatcttgggaagaatacgagtgccttcgttgtgaggcaggatgccg
gagcaaagtcatcaagtccattcccacttgttctaatcgatctcccaccgacgatacgactaatttcactttcattgatg
agtatgaacatgacgttgaacgttctgataaggaccactcagaaaggtccaatagtccacccttcagtgataagataccg
gtatatggagcaggtccgccacaaagactacagtctggaacagaatctgagaccgataatactgactacgatgaagtcat
ctccccaaacgaggatgcagaaaagatagcagaagtaataataaaaagatggaaatctagaaaaaagaaagacattgatt
caagtgtcaataagagaggagatgttgttcaaaatgttcacacccacaaaattagtcacgttgaacaacataactacacc
aatggaaataaatcgggaatgttgatggagagtgaagtgtgggagtgtaaagatttggctggaaagtctgaacacaagca
tggagagaggcactccaacatcagggagacaatgcgtccaagacatgcaacatcaggacggactagctctgaaaaagacc
gtctgtacactgcagttgcagagaagttggcacacattggggaccactataaggcaacaagtccactgtctgatagtacc
agaagctccgtggataacactgcgactaggagagctagtgccagaaccccaaacctaccgggagtggacgaaagaggcag
tgatggattgacagcgcttgaaagacaactgattgacactctaagagaagtgggggattcttttcagcttaaattatctc
cgaacgctgtcaaggaaattgtaaagcaggccatgtaccaaaggttccaggaagtggtcgacaaaaagaccggtcctggc
aacagctgggaccatattgccgccgtgttctacctgaccaagaaagttgtcaccatggcgggagtgggcagagccgttgc
actgcaggtgaaagatttggcagcggaatacgtggccgataagtttgccacatggattgtggatcagggtggttgggata
cgtttctggacagtgactcagacctggactag
>gnl|bcl2dbcds|A0A8W8J978_uncBCL2L1-01 Putative BCL2-like 1 gene OS=[Eukaryota] Crassostrea gigas (length=2196 residues).
atggctgaaagcaagaaaccagtgctggagacctatacagtggcctccgatgtactatcaacgcatcttagggaaaagaa
ggccagagcccgcaagaaatcacctatgcccccaccttcagagcaagaaatcaaagctgaagttcgtaaaatcttggaac
aattcctaaagaaacaactgctgaataataatgaagaggaaagtgcaatacccactggatttcagagagtatctgtggag
gatgtggttgaaacagatgggccaggtagcacaagcacatctcgtgaaggatccaggtactcttccaaaaccaactgtgc
cagatgccgtagcgaggccagccagtctattcccacaagttctattcgatctctcactgacaatacaattgatttccctt
tcattgatgaggatgaaaatgaggttgatcattctgataaagaccactcagaaaggtctaagagtctaccctcaaatatt
ctatcgtctgtcaaaattcaggataaaaactcgcttgcattatcaaaatcacttagtccaaccaaactcagggaagtcat
caacaatggccctcctctaaataaagcatctgaaaaaggagacagggaacttagtctttatagcaatgaagattttctgc
aaacagggtctgggctcaaagacatagaggagataggtatatcaagagggcgacagagactgaagtctggaacagaatct
gggacagatgatactgactacgaggaagaagtcatctccccaaatcgaaagaagaaatctatctttacacgactgaagga
acgtatgaacaggagtttgagtcgtggtcgaatcaaagaaaatgaagaaaataaaagaacaaggtcccggtcagaaggtt
cagtaataataaaaagacggaaacctagaaaaaagaaagacattggttccagtgttgatagggtgagtgatgttgttcaa
aatgttcatacccacaaacatggccacgttgaacaacatcactacagcaatggaaataaatcgggaatgttgatggagag
tgaagtgtgggagtccacagatgtgactggagagtctgaacacaagcatgaagagaggcattccagcatcagggagagta
aggaacagccgtccgatggtgagaatggaatcatgagacggctgaagaaaatgacctccttcaagaagtccaagaaaaat
aaatctgattccccatcctcgaaagcatcaaaatcagacgaggttgattttgaccacaagaggccaaagtcccccaaaac
agactttggtcgttctgtgtcttctggtcaggggtaccaagaaagggtacatatgaatggagaccactccagacaaacca
ccactaccactgtggtaacggggacacaaatacaaggttgtaccgatgagaaccttccagagggccccattaaaggagaa
gtgatggatcttgccaagaagaacaaatcgttcgtgctggactttgagacttgtgagaggcagcaaaggagactccttcc
tgatggaagctttgacacgaccgtccaacaacatgtcaaggtcaaacactttgatgaaggtcatgatattgaagttgatg
gcactgaagaccaagtaatgtgtccaagacatgcagcatcaggacagcctaaccctgaaaaagaccgcctgtacactgca
gttgcagagaagttggcacacattggggaccactatatggccaccagtccactgtctgatagtaccagtagctccgtgga
tcacactgcgactaggagagtcagtgccagaaccccaaacctacctggagtggatgaaagagacagtgacggattgacac
agctagaaagacagataagagacaagtttagagaagtgggggatacattttctcttgacatttctcccgattctgtgaaa
gatgctgccatggaaattgccaagcaggcaacctaccagaagttccaggaagtggtcgacaacaagatcggccccggcaa
cagctgggaccagattgccgccgtgttctacctgaccacgaaagctgtcactcttgcaggggtgggcggggccgttgcac
tgcaggtgaaagatcttgcggcagaatacgtggccgataagtttgccacatggattgtggatcagggaggatgggatacg
tgtctggacagtgacacagacctggatatagactga
>gnl|bcl2dbcds|A0A8W8MFH4_uncBCL2L2-01 Putative BCL2-like 2 gene OS=[Eukaryota] Crassostrea gigas (length=549 residues).
atgggagaggaagattaccgtgcccttgtggctgattatgtgaattatcgactcagcaagcacggttaccagtgggaaaa
tggcccggcccagcgaaaaaacaacaaagtgttccaggcggttagaaaactgggggacgagtttgaaaacaaacaagatt
catgtgactttcaagaaatggtgactagccttcatattacacccgatacggcccagtccactttctcaactgtgacaaac
gagatgttttcaaacggtattaactggggcagggtggtagcgcttatcgggttcggaggggcattttccgtcgagtgtgt
gtcccgtaacatgccacagttagtagactctgtagtagactgggtagccacgtatatgaactctaacctcaaagactgga
tctcacacaacgggggatggcaaggcttcgtcgacttctactcgcggaaggaccaatcaaacaatgacgacaacccctgg
gtgaagtacggggtcctaggagccgtgggggtagtggtgttgggggcattgatgacacaaaggacgtga
>gnl|bcl2dbcds|A0A8W8MFH4_uncBCL2L2-05 Putative BCL2-like 2 gene OS=[Eukaryota] Crassostrea gigas (length=549 residues).
atgggagaggaagattaccgtgcccttgtggctgattatgtgaattatcgactcagcaagcacggttaccagtgggaaaa
tggcccggcccagcgaaaaaacaacaaagtgttccaggcggttagaaaactgggggacgagtttgaaaacaaacaagatt
catgtgactttcaagaaatggtgactagccttcatattacacccgatacggcccagtccactttctcaactgtgacaaac
gagatgttttcaaacggtattaactggggcagggtggtagcgcttatcgggttcggaggggcattttccgtcgagtgtgt
gtcccgtaacatgccacagttagtagactctgtagtagactgggtagccacgtatatgaactctaacctcaaagactgga
tctcacacaacgggggatggcaaggcttcgtcgacttctactcgcggaaggaccaatcaaacaatgacgacaacccctgg
gtgaagtacggggtcctaggagccgtgggggtagtggtgttgggggcattgatgacacaaaggacgtga
>gnl|bcl2dbcds|A0A8W8MFH4_uncBCL2L2-09 Putative BCL2-like 2 gene OS=[Eukaryota] Crassostrea gigas (length=549 residues).
atgggagaggaagattaccgtgcccttgtggctgattatgtgaattatcgactcagcaagcacggttaccagtgggaaaa
tggcccggcccagcgaaaaaacaacaaagtgttccaggcggttagaaaactgggggacgagtttgaaaacaaacaagatt
catgtgactttcaagaaatggtgactagccttcatattacacccgatacggcccagtccactttctcaactgtgacaaac
gagatgttttcaaacggtattaactggggcagggtggtagcgcttatcgggttcggaggggcattttccgtcgagtgtgt
gtcccgtaacatgccacagttagtagactctgtagtagactgggtagccacgtatatgaactctaacctcaaagactgga
tctcacacaacgggggatggcaaggcttcgtcgacttctactcgcggaaggaccaatcaaacaatgacgacaacccctgg
gtgaagtacggggtcctaggagccgtgggggtagtggtgttgggggcattgatgacacaaaggacgtga
>gnl|bcl2dbcds|A0A8W8MHR4_uncBCL2L1-01 Putative BCL2-like 1 gene OS=[Eukaryota] Crassostrea gigas (length=465 residues).
atggtgatcgctagccgtaagatggaccgtttgggaacgagatatattgtgactgactacttgaaccatcgtctgtcgaa
gaatgggcacacatggactcactgcccgcccctcctggatccccccctcaagatccacaccacaatgcgggacaaggggg
acgaattcgaggaactatacaaggtccagttccaggacttggtggaccagctgcacgtgacccacgatacgtgttatccc
atgtttaaggcggtggttgaggaactgttccaagggggcacgaattggggtcgggtggtggcgctgttcgcgttcagtgg
ctccctggccacgcgctgtgtggagaaagggatggcgggactagtggactctatcgtggactgggtgacacagttcatag
aacaggacctacgtcagtggatagaccagcacgggggatggaagtattacggctggacattttag
© 1998-2023Centre National de la Recherche Scientifique logoInstitut national de la sante et de la recherche médicale logoUniversité de Lyon logoLegal notice