Dataset for CDS MCL-1 of organism Myotis lucifugus

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

G1PZ39_MCL1-01      -------gccccg-----------------------------------------------
G1QAV8_MCL1-01      atgtttggccccaaaagaaatgcattcatcggactcaacctccactgcgggggggcagtt

G1PZ39_MCL1-01      ------------------------------------------------------------
G1QAV8_MCL1-01      gggggcctgtggcggcagcgaagcctacatctccttcaggaaggaggtccctgcccccaa

G1PZ39_MCL1-01      ------------------------------------------------------------
G1QAV8_MCL1-01      gagtcaggggcggggagggaaacgggcacggtgattggctggagcgctggcgcgagcccc

G1PZ39_MCL1-01      ---------------------------------------ccctctcccattagcggccga
G1QAV8_MCL1-01      caagccactctcgcgagggatcctgggagggtcgctcgcccctcgcccatgggc-acgga
                                                           ***** *****  **  * **

G1PZ39_MCL1-01      gggccccgacgtcatcgggacccttcgcgcggcggctgtttgcgccccttggctgtgcgg
G1QAV8_MCL1-01      gggtcccgatggcaccgcggcccct-gccaggtggctgttctcgcccatcagc----cgg
                    *** ***** * ** ** * *** * **  ** *******  ***** *  **    ***

G1PZ39_MCL1-01      ggctgccc-gcggagatggaaagccgcggccgccgacgccatcatgtcgccggaagagga
G1QAV8_MCL1-01      aattgccctgaagagctgg-gagctctggcagccgacgccatcatgtcgcccggagagga
                       ***** *  *** ***  ***   *** ******************** * ******

G1PZ39_MCL1-01      gctggacgggtacgagccggagcctctcgggaagcggccggccgtcctgcccttggtgca
G1QAV8_MCL1-01      gctgggcaggtatgagccggagcc------gaagcagccggctgtcctgcccttgctcca
                    ***** * **** ***********      ***** ****** ************ * **

G1PZ39_MCL1-01      gctggtcggggaggccagcggcggccccggcgcggggggctcgctgccctccacgccgcc
G1QAV8_MCL1-01      gctggtcggggaggccagcgaaggccc---cgcaggtggctcactgccctcgaccccgcc
                    ********************  *****   *** ** ***** ******** ** *****

G1PZ39_MCL1-01      ccccgcggaggaggaggaggacgagctgttccggcagtcgctggagatcatctctcggta
G1QAV8_MCL1-01      ccctgctgaggaggaggag---gaattgtcac------tgctggagatgatccctcagca
                    *** ** ************   **  ***  *       ********* *** *** * *

G1PZ39_MCL1-01      cc---gggagcaggcgaccggcgccaaggac----gccaagcccctgggcgggcccgcgg
G1QAV8_MCL1-01      ccttagggaacggg---ctggcgccagggaccaaagccagggccc---gcgggtcggcgg
                    **   **** * **   * ******* ****    **** * ***   ***** * ****

G1PZ39_MCL1-01      cctccagccggaaggcgctggagaccctgcggcgggtcggggacggcgtgcagcggaacc
G1QAV8_MCL1-01      ggtgcagc-----ggcg----------tgcagcagggtgcag-cggggtgcggcag----
                      * ****     ****          *** ** **  *  * *** **** ** *    

G1PZ39_MCL1-01      acgagatggccttccaaggtgagcgggggccgcgcgcc----------------------
G1QAV8_MCL1-01      --gagactgccttcctaggtatgcttgaactggacaccgaaaacgaagacaacgtcaaat
                      ****  ******* ****  **  *  * *  * **                      

G1PZ39_MCL1-01      ctctgtcttgtccgcgatcgct-gggctcccgtgggtggaaaccgagacgagcccgggct
G1QAV8_MCL1-01      cttcgtctca--agcgatggttcatgcttttagggacgga----gtgacaaac---ggca
                    **  ****     ***** * *   ***     **  ***    * *** * *   *** 

G1PZ39_MCL1-01      ggaagggctctccgcccgtttccgaaaccagcatattctggccatgagtcattgtttccg
G1QAV8_MCL1-01      gga--------------------------------------ttgtgactcatttctt---
                    ***                                         *** *****  **   

G1PZ39_MCL1-01      cccacccgattccttgggaaccgctctccgctcaaaggcc-ggaaaggtgtgggagacct
G1QAV8_MCL1-01      -----ttggtgcctttgtagccacttgaagagcataaaccaagaaagctgcattgaaccg
                           * * **** * * ** **    *  ** *  **  ***** **      *** 

G1PZ39_MCL1-01      ccaacacttgcca--------------------------------tggct--tcaa----
G1QAV8_MCL1-01      ttagcagaagacatcacagatgttctcgtagggacagaacgaggctggctagtcaaacag
                      * **   * **                                *****  ****    

G1PZ39_MCL1-01      --------ggatgggtttgtggaattcttccatgtagaggacctagaaggcggcatcaga
G1QAV8_MCL1-01      agaggctgggatgggtttgtggaattcttccaggtggaggacctagaaggcggcgtcaga
                            ************************ ** ****************** *****

G1PZ39_MCL1-01      aatgtgctgctggcttttgcaggtgttgctggagtaggagctggtttggcatatctaata
G1QAV8_MCL1-01      aatgtgctgctggcttttgcagg---tgctggagtaggagctggtttgccatatctaata
                    ***********************   ********************** ***********

G1PZ39_MCL1-01      agatag
G1QAV8_MCL1-01      aggtag
                    ** ***

© 1998-2020Legal notice