Dataset for CDS MCL-1 of organism Accipiter nisus

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A8B9M984_MCL1-01      atgttcgccgtgaagcggaacgccgtcatcggcttcaacctctactgcgg
A0A8B9M984_MCL1-02      atgttcgccgtgaagcggaacgccgtcatcggcttcaacctctactgcgg

A0A8B9M984_MCL1-01      cggcggcccggccctggcgcccgcctcgccgggaggggggccggccccgc
A0A8B9M984_MCL1-02      cggcggcccggccctggcgcccgcctcgccgggaggggggccggccccgc

A0A8B9M984_MCL1-01      cgccgccgcccgccgccgccgctgaggtacccgggaccctgattggctcc
A0A8B9M984_MCL1-02      cgccgccgcccgccgccgccgctgaggtacccgggaccctgattggctcc

A0A8B9M984_MCL1-01      gtggcggcctgggccgccgccggtcgccccgagcacccccgcgcgctggt
A0A8B9M984_MCL1-02      gtggcggcctgggccgccgccggtcgccccgagcacccccgcgcgctggt

A0A8B9M984_MCL1-01      tggctgcggcgcggccccccgcgcggcgctgccccccgcggcgcggccgg
A0A8B9M984_MCL1-02      tggctgcggcgcggccccccgcgcggcgctgccccccgcggcgcggccgg

A0A8B9M984_MCL1-01      gcgcgctgtggagccccgaggaggagctggacggctgcgagccggaggcc
A0A8B9M984_MCL1-02      gcgcgctgtggagccccgaggaggagctggacggctgcgagccggaggcc

A0A8B9M984_MCL1-01      gagcgcggcccggcgggggactcgctgcccggcacgccgcccgggccgcc
A0A8B9M984_MCL1-02      gagcgcggcccggcgggggactcgctgcccggcacgccgcccgggccgcc

A0A8B9M984_MCL1-01      ggagccgcccgatgggctgcggcaggactcgctggagctcatcagccgct
A0A8B9M984_MCL1-02      ggagccgcccgatgggctgcggcaggactcgctggagctcatcagccgct

A0A8B9M984_MCL1-01      acctgcgggaggcggcgggcgaggccgagcccgccgtgaagaagcttttt
A0A8B9M984_MCL1-02      acctgcgggaggcggcgggcgaggccgagcccgccgtgaagaagcttttt

A0A8B9M984_MCL1-01      ccggggctgctgggcgggcccggccggcccgggggatcgggcgatgccgt
A0A8B9M984_MCL1-02      ccggggctgctgggcgggcccggccggcccgggggatcgggcgatgccgt

A0A8B9M984_MCL1-01      gatggagaaggcgctggagacgctgcggagggtgggcgacggcgtcatgc
A0A8B9M984_MCL1-02      gatggagaaggcgctggagacgctgcggagggtgggcgacggcgtcatgc

A0A8B9M984_MCL1-01      agaaacacgagctggccttccagggaatgcttcggaaactggaaatccag
A0A8B9M984_MCL1-02      agaaacacgagctggccttccagggaatgcttcggaaactggaaatccag

A0A8B9M984_MCL1-01      aaagaggaagatctgcagtcggtgtgtgaagtggctgcccacgtgttcag
A0A8B9M984_MCL1-02      aaagaggaagatctgcagtcggtgtgtgaagtggctgcccacgtgttcag

A0A8B9M984_MCL1-01      tgatggagtaacaaactggggtcgagtggtgacactcatctcgttcggtg
A0A8B9M984_MCL1-02      tgatggagtaacaaactggggtcgagtggtgacactcatctcgttcggtg

A0A8B9M984_MCL1-01      cctttgttgcgaaacacctgaaaagcataaaccaggagaggtgcatcagc
A0A8B9M984_MCL1-02      cctttgttgcgaaacacctgaaaagcataaaccaggagaggtgcatcagc

A0A8B9M984_MCL1-01      tcgctggcagggatcatcacagatgcacttgtctcatctaagcgcgagtg
A0A8B9M984_MCL1-02      tcgctggcagggatcatcacagatgcacttgtctcatctaagcgcgagtg

A0A8B9M984_MCL1-01      gctaatgagccagggaggctgggagggctttgttgacttctttcgagtcg
A0A8B9M984_MCL1-02      gctaatgagccagggaggctgggagggctttgttgacttctttcgagtcg

A0A8B9M984_MCL1-01      aggacctagaaggcagcatcagaaatgtactgatggcgtttgcaggtgtg
A0A8B9M984_MCL1-02      aggacctagaaggcagcatcagaaatgtactgatggcgtttgcaggtgtg

A0A8B9M984_MCL1-01      gctggactaggagcgagcttggcctacatgatccggaatgtcaccaactg
A0A8B9M984_MCL1-02      gctggactaggagcgagcttggcctacatgatcc----------------

A0A8B9M984_MCL1-01      ctggatccctagcctgggatggcagggaacagagttctgctcctcctggg
A0A8B9M984_MCL1-02      -----------------gattgcaggta----------------------
                                         *** ***** *                      

A0A8B9M984_MCL1-01      atggctcatgtccaaggccagcattgcttctttctatgccagggacactg
A0A8B9M984_MCL1-02      --------------------------------------------------

A0A8B9M984_MCL1-01      caggagacctggcaggcacatcccaggagtgctcattccttcttcctttc
A0A8B9M984_MCL1-02      ---------------------ccaatgaggatttattgctt---------
                                             ** * ***   * *** ***         

A0A8B9M984_MCL1-01      ctcctctcagctcaagcccttgtccttgctggtgagtctctgcttgcaga
A0A8B9M984_MCL1-02      --------------------------------------------------

A0A8B9M984_MCL1-01      gttatggtgacagtccttggggtcctgaacagttcttgctgaacaaggca
A0A8B9M984_MCL1-02      --------------------------------------------------

A0A8B9M984_MCL1-01      acaggccttggtgtcccctcaagcagcagcaagtcatgttgcgactctgc
A0A8B9M984_MCL1-02      --------------------------------------------------

A0A8B9M984_MCL1-01      tgtccttccatgtgctgcctggctcaaaaggtgtccggcagcactgggca
A0A8B9M984_MCL1-02      --------------------------------------------tgggaa
                                                                    **** *

A0A8B9M984_MCL1-01      ccaggtgcaagccctgccacccctctgaaagattagacagtctccccaaa
A0A8B9M984_MCL1-02      --------------------------gagaaagtgga-------------
                                                  ** * * * **             

A0A8B9M984_MCL1-01      tcccaccagtgccctagaaaccccagtgagcactggggttctgccctctt
A0A8B9M984_MCL1-02      --------------------------------------------------

A0A8B9M984_MCL1-01      ccccccttccagagtccatgctcagggttgg
A0A8B9M984_MCL1-02      -----------------------agaattga
                                               **  *** 

© 1998-2023Legal notice