Dataset for CDS BCL-2 of organism Cyprinus carpio

[Download (right click)] [Edit] [Sequences] [Repertoires]

6 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A8C1WYA7_BCL2-01      atggccaacgaaattcgctatgacaatcggaatattgtggagaaatacct
X4ZGI8_BCL2-01          atggccaacgaaattcgctatgacaatcggaatattgtggagaaatacct
A0A8C1S8K5_BCL2-01      atggcacaggagaatgtgtatgataaccgcagtatagtggagaagtacat
A0A8C1IQE4_BCL2-01      atggcacaggagaatgtgtatgataaccgcagtatagtggagaagtacat
A0A8C2KJQ5_BCL2-01      atggcacaggagaatgtgtatgataaccgcagtatagtggtgaagtacat
A0A8C2KJQ5_BCL2-02      atggcacaggagaatgtgtatgataaccgcagtatagtggtgaagtacat
                        *****  * ** * *   ***** ** ** * *** **** *** *** *

A0A8C1WYA7_BCL2-01      caatcacaaactttcaaagaagggatatgagtggaaatttcaatcttccg
X4ZGI8_BCL2-01          caatcacaaactttcaaagaagggatatgagtggaaatttcaatcttccg
A0A8C1S8K5_BCL2-01      ccaccataagctctggaagaaggggtacgtgtgggaagtgaa------cg
A0A8C1IQE4_BCL2-01      ccaccataagctctggaagaaggggtacgtgtgggaa-------------
A0A8C2KJQ5_BCL2-01      ccaccataagctctggaagaaggggtacgtgtgggaagtgaa------cg
A0A8C2KJQ5_BCL2-02      ccaccataagctctggaagaaggggtacgtgtgggaa-------------
                        * * ** ** ** *  ******** ** * **** **             

A0A8C1WYA7_BCL2-01      gggaggatgatgacactatcaatacgggagtggaggactcctctccgagc
X4ZGI8_BCL2-01          gggaggatgatgacactatcaatacgggagtggaggactcctctccgagc
A0A8C1S8K5_BCL2-01      gacacgatgacagcgtctcgaatggactgatgatgga-------------
A0A8C1IQE4_BCL2-01      --------------------------------------------------
A0A8C2KJQ5_BCL2-01      gacacgatgaccgcgtctcgaatggactgatgatggg-------------
A0A8C2KJQ5_BCL2-02      --------------------------------------------------
                                                                          

A0A8C1WYA7_BCL2-01      tctgacaggaggctccaggctccctcagccggagggggaaacaactctga
X4ZGI8_BCL2-01          tctgacaggaggctccaggctccctcagccggagggggaaacaactctga
A0A8C1S8K5_BCL2-01      -gaggcaggaggaccgcggc------------------------------
A0A8C1IQE4_BCL2-01      --------gaggaccgcggc------------------------------
A0A8C2KJQ5_BCL2-01      -gaggcaggaggaccgcggc------------------------------
A0A8C2KJQ5_BCL2-02      --------gaggaccgcggc------------------------------
                                ****  *  ***                              

A0A8C1WYA7_BCL2-01      atgcctgatagcaaaccgggtcacacgttcagacccttattcgaggatct
X4ZGI8_BCL2-01          atgcctgatagcaaaccgggtcacacgttcagacccttattcgaggatct
A0A8C1S8K5_BCL2-01      -------------------ggcacccgtcacgacccgtgcagcgccctcc
A0A8C1IQE4_BCL2-01      -------------------ggcacccgtcacgacccgtgcagcgcgcttc
A0A8C2KJQ5_BCL2-01      -------------------ggcacccgtcacgacccgtgcagcgcgcttc
A0A8C2KJQ5_BCL2-02      -------------------ggcacccgtcacgacccgtgcagcgcgcttc
                                           * *** ***   ***** *         *  

A0A8C1WYA7_BCL2-01      accgatcgttacgcgaggctggagaccagatagaaaggatgtaccagcgt
X4ZGI8_BCL2-01          accgatcgttacgcgaggctggagaccagatagaaaggatgtaccagcgt
A0A8C1S8K5_BCL2-01      acacggtgctacgggaggctggggacgaactggagcggctttatcagtcg
A0A8C1IQE4_BCL2-01      ataaggtgctgcgggaggccggggacgagctggagcggctttatcagtcg
A0A8C2KJQ5_BCL2-01      ataaggtgctgcgggaggccggggacgagctggagcggctttatcagtcc
A0A8C2KJQ5_BCL2-02      ataaggtgctgcgggaggccggggacgagctggagcggctttatcagtcc
                        *      * * ** ***** ** *** *  * **  ** * ** ***   

A0A8C1WYA7_BCL2-01      gaatttgaggagatgtcccaccagatgacattcagtcccagtgcagcaca
X4ZGI8_BCL2-01          gaatttgaggagatgtcccaccagatgacattcagtcccagtgcagcaca
A0A8C1S8K5_BCL2-01      gactttgcggagatgtccaaacagctgcatatcacgtccatcacggcgca
A0A8C1IQE4_BCL2-01      gactttgcggagatgtccaaacagctgcatctcacgtccatcacggcgca
A0A8C2KJQ5_BCL2-01      gactttgcggagatgtccaaacagctgcatctcacgtccatcacggcgca
A0A8C2KJQ5_BCL2-02      gactttgcggagatgtccaaacagctgcatctcacgtccatcacggcgca
                        ** **** ********** * *** **    ***   ***   * ** **

A0A8C1WYA7_BCL2-01      acgcagcttcttagctgtggctgaagagctcttcagagacggagtgaact
X4ZGI8_BCL2-01          acgcagcttcttagctgtggctgaagagctcttcagagacggagtgaact
A0A8C1S8K5_BCL2-01      gcagcgcttcaccgcggtcatagacgagctgttcagggacggcgtgaact
A0A8C1IQE4_BCL2-01      gcagcgctttaccgcggtcatagacgagctgttcagggacggcgtgaact
A0A8C2KJQ5_BCL2-01      gcagcgcttcaccgcggtcatagacgagctgttcagggacggcgtgaact
A0A8C2KJQ5_BCL2-02      gcagcgcttcaccgcggtcatagacgagctgttcagggacggcgtgaact
                         *   ****    ** **    ** ***** ***** ***** *******

A0A8C1WYA7_BCL2-01      gggggcggatcgtcgctttctttgagtttggtgggaccatgtgtgtggag
X4ZGI8_BCL2-01          gggggcggatcgtcgctttctttgagtttggtgggaccatgtgtgtggag
A0A8C1S8K5_BCL2-01      ggggcagaatcatcgcttttttcgagtttggagggaccgtttgtgtcgaa
A0A8C1IQE4_BCL2-01      ggggcagaatcatcgcttttttcgagtttggagggaccgtttgtgtcgaa
A0A8C2KJQ5_BCL2-01      ggggcagaatcatcgcttttttcgagtttggagggaccgtttgtgtcgaa
A0A8C2KJQ5_BCL2-02      ggggcagaatcatcgcttttttcgagtttggagggaccgtttgtgtcgaa
                        ****  * *** ******* ** ******** ****** * ***** ** 

A0A8C1WYA7_BCL2-01      agcttcaaccgggagatggcgtcccaggtagataatattgcacactggat
X4ZGI8_BCL2-01          agcttcaaccgggagatggcgtcccaggtagataatattgcacactggat
A0A8C1S8K5_BCL2-01      tgcgtgaataaggagatgacggcgcatgtggataacatcgcgggctggat
A0A8C1IQE4_BCL2-01      tgcgtgaataaggagatgacggcgcatgtggataacatcgcgggctggat
A0A8C2KJQ5_BCL2-01      tgcgtgaataaggagatgacggcgcatgtggataacatcgcgggctggat
A0A8C2KJQ5_BCL2-02      tgcgtgaataaggagatgacggcgcatgtggataacatcgcgggctggat
                         ** * **   ******* ** * ** ** ***** ** **   ******

A0A8C1WYA7_BCL2-01      gacagactacctgaacgggccactggaaaactggatcgaggaaaatggag
X4ZGI8_BCL2-01          gacagactacctgaacgggccactggaaaactggatcgaggaaaatggag
A0A8C1S8K5_BCL2-01      gaccgagtatctgaacgggccgctgcacgcctggatccaggagaacggcg
A0A8C1IQE4_BCL2-01      gaccgagtatctgaatgggccgctgcacgcctggatccaggagaacggcg
A0A8C2KJQ5_BCL2-01      gaccgagtatctgaacgggccgctgcacgcctggatccaggagaacggcg
A0A8C2KJQ5_BCL2-02      gaccgagtatctgaacgggccgctgcacgcctggatccaggagaacggcg
                        *** ** ** ***** ***** *** *   ******* **** ** ** *

A0A8C1WYA7_BCL2-01      gctgggatgcctttgtggagttatacagtcagcagagagactctatgttc
X4ZGI8_BCL2-01          gctgggacgcctttgtggagttatacagtcagcagagagaccctatgttc
A0A8C1S8K5_BCL2-01      gctgggaggcgtttgtggagctctacggcaggcagagggactcggtgttt
A0A8C1IQE4_BCL2-01      gctgggaggcgtttgtggagctctacggcaggcagagggactcggtgttt
A0A8C2KJQ5_BCL2-01      gctgggaggcgtttgtggagctctacggcaggcagagggactctgtgttt
A0A8C2KJQ5_BCL2-02      gctgggaggcgtttgtggagctctacggcaggcagagggactctgtgttt
                        ******* ** ********* * *** *   ****** *** *  **** 

A0A8C1WYA7_BCL2-01      c---acccattgtcgtacctaacgaaagtgcttggattggcagcactagg
X4ZGI8_BCL2-01          c---acccattgtcgtacctaacgaaagtgcttggattggcagcactagg
A0A8C1S8K5_BCL2-01      cgcagctcgtggtcatcaatagtaacggtcttcggtctagccgctctcgg
A0A8C1IQE4_BCL2-01      cgcagctcgtggtcatcaatagtaacggtcttcggtctagccgctctcgg
A0A8C2KJQ5_BCL2-01      cgcagctcgtggtcatcaatagtaacggtcttcggtctagccgctctcgg
A0A8C2KJQ5_BCL2-02      cgcagctcgtggtcatcaatagtaacggtcttcggtctagccgctctcgg
                        *    * * * *** *   **   *  **  * **  * ** ** ** **

A0A8C1WYA7_BCL2-01      cttggcaggagtgaccatcggagcctttttcgctcagaagtga
X4ZGI8_BCL2-01          cttggcaggagtgaccatcggagcctttttcgctcagaagtga
A0A8C1S8K5_BCL2-01      ggctgttggcttgaccataggagcctaccttgctcagaaatga
A0A8C1IQE4_BCL2-01      ggctgttggcttgaccataggagcctaccttgctcagaaatga
A0A8C2KJQ5_BCL2-01      ggctgttggcttgaccataggagcctaccttgcgcagaaatga
A0A8C2KJQ5_BCL2-02      ggctgttggcttgaccataggagcctaccttgcgcagaaatga
                            *  **  ******* *******   * ** ***** ***

© 1998-2022Legal notice