Dataset for CDS BCL-2 of organism Cyprinus carpio

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A8C1IQE4_BCL2-01      atggcacaggagaatgtgtatgataaccgcagtatagtggagaagtacat
X4ZGI8_BCL2-01          atggccaacgaaattcgctatgacaatcggaatattgtggagaaatacct
                        *****  * ** * *   ***** ** ** * *** ******** *** *

A0A8C1IQE4_BCL2-01      ccaccataagctctggaagaaggggtacgtgtgggaa-------------
X4ZGI8_BCL2-01          caatcacaaactttcaaagaagggatatgagtggaaatttcaatcttccg
                        * * ** ** ** *  ******** ** * **** **             

A0A8C1IQE4_BCL2-01      --------------------------------gaggaccgc---------
X4ZGI8_BCL2-01          gggaggatgatgacactatcaatacgggagtggaggactcctctccgagc
                                                        ******  *         

A0A8C1IQE4_BCL2-01      -------ggcggcacccgtc------------------------------
X4ZGI8_BCL2-01          tctgacaggaggctccaggctccctcagccggagggggaaacaactctga
                               ** *** ** * *                              

A0A8C1IQE4_BCL2-01      ----------acgacccgtgcagcgcgcttcata----------agg---
X4ZGI8_BCL2-01          atgcctgatagcaaaccgggtcacacg-ttcagacccttattcgaggatc
                                   * * *** *   * ** **** *          ***   

A0A8C1IQE4_BCL2-01      -------tgctgcgggaggccggggacgagctggagcggctttatcagtc
X4ZGI8_BCL2-01          taccgatcgttacgcgaggctggagaccagatagaaaggatgtaccagcg
                                * * ** ***** ** *** ** * **  ** * ** ***  

A0A8C1IQE4_BCL2-01      ggactttgcggagatgtccaaacagctgcatctcacgtccatcacggcgc
X4ZGI8_BCL2-01          tgaatttgaggagatgtcccaccagatgacattcagtcccagtgcagcac
                         ** **** ********** * *** **    ***   ***   * ** *

A0A8C1IQE4_BCL2-01      agcagcgctttaccgcggtcatagacgagctgttcagggacggcgtgaac
X4ZGI8_BCL2-01          aacgcagcttcttagctgtggctgaagagctcttcagagacggagtgaac
                        * *   ****    ** **    ** ***** ***** ***** ******

A0A8C1IQE4_BCL2-01      tggggcagaatcatcgcttttttcgagtttggagggaccgtttgtgtcga
X4ZGI8_BCL2-01          tgggggcggatcgtcgctttctttgagtttggtgggaccatgtgtgtgga
                        *****  * *** ******* ** ******** ****** * ***** **

A0A8C1IQE4_BCL2-01      atgcgtgaataaggagatgacggcgcatgtggataacatcgcgggctgga
X4ZGI8_BCL2-01          gagcttcaaccgggagatggcgtcccaggtagataatattgcacactgga
                          ** * **   ******* ** * ** ** ***** ** **   *****

A0A8C1IQE4_BCL2-01      tgaccgagtatctgaatgggccgctgcacgcctggatccaggagaacggc
X4ZGI8_BCL2-01          tgacagactacctgaacgggccactggaaaactggatcgaggaaaatgga
                        **** ** ** ***** ***** *** *   ******* **** ** ** 

A0A8C1IQE4_BCL2-01      ggctgggaggcgtttgtggagctctacggcaggcagagggactcggtgtt
X4ZGI8_BCL2-01          ggctgggacgcctttgtggagttatacagtcagcagagagaccctatgtt
                        ******** ** ********* * *** *   ****** *** *  ****

A0A8C1IQE4_BCL2-01      tcgcagctcgtggtcatcaatagtaacggtcttcggtctagccgctctcg
X4ZGI8_BCL2-01          cc---acccattgtcgtacctaacgaaagtgcttggattggcagcactag
                         *    * * * *** *   **   *  **  * **  * ** ** ** *

A0A8C1IQE4_BCL2-01      gggctgttggcttgaccataggagcctaccttgctcagaaatga
X4ZGI8_BCL2-01          gcttggcaggagtgaccatcggagcctttttcgctcagaagtga
                        *    *  **  ******* *******   * ******** ***

© 1998-2023Legal notice