Dataset for CDS BCL-2-like of organism Macaca nemestrina

[Download (right click)] [Edit] [Sequences] [Repertoires]

8 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A2K6DS18_BCL2A1-      atgacagactgtgaa--------tttggatatatttacaggctagctcag
A0A2K6DS18_BCL2A1-      atgacagactgtgaa--------tttggatatatttacaggctagctcag
A0A2K6ECR0_MCL1-03      atgtttggcctcaaaagaaacgcggtaatcggactcaacctctactg---
A0A2K6ECR0_MCL1-02      atgtttggcctcaaaagaaacgcggtaatcggactcaacctctactg---
A0A2K6B2D9_BCL2L10      atggctgaccc-----gttgcg-ggagc--gcaccgagcggctcctggcc
A0A2K6CIX3_BCL2-01      atggcgcacgctgggagaacag-ggtac-gataaccgggagatagtgatg
A0A2K6EA59_BCL2L2-      atggcgacccc----agcctcg-gccccagacacacgggctctggtggca
A0A2K6EA59_BCL2L2-      atggcgacccc----agcctcg-gccccagacacacgggctctggtggca
                        ***     *                       *         *       

A0A2K6DS18_BCL2A1-      gactatttgcagtacgttc-----tgcagataccacaacctgga--tcgg
A0A2K6DS18_BCL2A1-      gactatttgcagtacgttc-----tgcagataccacaacctgga--tcgg
A0A2K6ECR0_MCL1-03      ------------------------tgggggggc--cggcttgggggccgg
A0A2K6ECR0_MCL1-02      ------------------------tgggggggc--cggcttgggggccgg
A0A2K6B2D9_BCL2L10      gactat------------------ctggggtgctgcgcccgggaacccgg
A0A2K6CIX3_BCL2-01      aagtacatccactataagctgtcgcagaggggctacgagtgggatgcggg
A0A2K6EA59_BCL2L2-      gactttgtaggttataagctgaggcagaagggttatgtctgtggagctgg
A0A2K6EA59_BCL2L2-      gactttgtaggttataagctgaggcagaagggttatgtctgtggagctgg
                                                                  *     **

A0A2K6DS18_BCL2A1-      ----gtccaagcaaaacgtccagagt------------------------
A0A2K6DS18_BCL2A1-      ----gtccaagcaaaacgtccagagt------------------------
A0A2K6ECR0_MCL1-03      cagcggcggcgccacccctccgggag------------------------
A0A2K6ECR0_MCL1-02      cagcggcggcgccacccctccgggag------------------------
A0A2K6B2D9_BCL2L10      ---------------cacccctgag-------------------------
A0A2K6CIX3_BCL2-01      ggatgtgggcgcggcgacccctggggccgcccccgcaccgggcatcttct
A0A2K6EA59_BCL2L2-      ------------------ccctgggg------------------------
A0A2K6EA59_BCL2L2-      ------------------ccctgggg------------------------
                                           ** *                           

A0A2K6DS18_BCL2A1-      --------------------------------------------------
A0A2K6DS18_BCL2A1-      --------------------------------------------------
A0A2K6ECR0_MCL1-03      ---------------ggcggcttttggccac--------------cggcg
A0A2K6ECR0_MCL1-02      ---------------ggcggcttttggctacggagaaggaggcctcggc-
A0A2K6B2D9_BCL2L10      --------------------------------------------------
A0A2K6CIX3_BCL2-01      cctcccagcccgggcacacgccccatcccgccgcgtcccgggacccggtc
A0A2K6EA59_BCL2L2-      --------------------------------------------------
A0A2K6EA59_BCL2L2-      --------------------------------------------------
                                                                          

A0A2K6DS18_BCL2A1-      -------------------------------------------------g
A0A2K6DS18_BCL2A1-      -------------------------------------------------g
A0A2K6ECR0_MCL1-03      ccaaggacacaaagccaatgggcaggtc--------------tggggcca
A0A2K6ECR0_MCL1-02      ccggcgagagatagggggaggggaggccggcacggtgattggcggaagcg
A0A2K6B2D9_BCL2L10      -ccaagaccgtccacgcccgag------------------------gccg
A0A2K6CIX3_BCL2-01      gccaggacc--tcgccgctgccgacccc--------ggctgcccccgccg
A0A2K6EA59_BCL2L2-      ---agggcc--cagcagctgac-------------------------ccg
A0A2K6EA59_BCL2L2-      ---agggcc--cagcagctgac-------------------------ccg
                                                                          

A0A2K6DS18_BCL2A1-      ctacaaaaggttgcattctcagtccaaaaaga------------------
A0A2K6DS18_BCL2A1-      ctacaaaaggttgcattctcagtccaaaaaga------------------
A0A2K6ECR0_MCL1-03      ccagcaggaaggctctgg-agaccttac----gacgg-------------
A0A2K6ECR0_MCL1-02      ccggcgcaagccccccggccgccctcacgccagacgc-------------
A0A2K6B2D9_BCL2L10      ccgtgctgcgctccgcggccg-----------------------------
A0A2K6CIX3_BCL2-01      ccgccgcggggcctgcgctcagcccggtgccacctgtggtccacctgacc
A0A2K6EA59_BCL2L2-      ctgcaccaagccatgcgggca-----------------------------
A0A2K6EA59_BCL2L2-      ctgcaccaagccatgcgggca-----------------------------
                        *                                                 

A0A2K6DS18_BCL2A1-      ---------agtggaaaagaatctg-------------------------
A0A2K6DS18_BCL2A1-      ---------agtggaaaagaatctg-------------------------
A0A2K6ECR0_MCL1-03      ---------gttggggatggcgtg--------------------------
A0A2K6ECR0_MCL1-02      ---------ccggagggtcgcgcggccgccgcccattggcgcggaggtcc
A0A2K6B2D9_BCL2L10      ---------ccaggttacggcagct-------ccac--------------
A0A2K6CIX3_BCL2-01      ctccgccaggccggtgacgacttctcccgccgctac--------------
A0A2K6EA59_BCL2L2-      ---------gctggagatgagttcgagacccgcttc--------------
A0A2K6EA59_BCL2L2-      ---------gctggagatgagttcgagacccgcttc--------------
                                    *                                     

A0A2K6DS18_BCL2A1-      -------aagccatgcttggacaatgttaa--------------------
A0A2K6DS18_BCL2A1-      -------aagccatgcttggacaatgttaa--------------------
A0A2K6ECR0_MCL1-03      -------cagcgcaa---ccacgagacggccttcc---------------
A0A2K6ECR0_MCL1-02      ccgacgtcaccgcgagccccgcgaggctgcttttctttgcgcccacccgc
A0A2K6B2D9_BCL2L10      -------cggtccttcttctccg----------cc---------------
A0A2K6CIX3_BCL2-01      -------cgccgcgacttcgccgagatgtccagcc---------------
A0A2K6EA59_BCL2L2-      -------cggcgcaccttctctgatctggcggctc---------------
A0A2K6EA59_BCL2L2-      -------cggcgcaccttctctgatctggcggctc---------------
                                                                          

A0A2K6DS18_BCL2A1-      -------tgttgcat----ccatagacactgcc--------agaacacta
A0A2K6DS18_BCL2A1-      -------tgttgcat----ccatagacactgcc--------agaacacta
A0A2K6ECR0_MCL1-03      ----aaggcatgcttcggaaactggacatcaaa----aacgaagacgatg
A0A2K6ECR0_MCL1-02      cgcgcggggccgcttgaggagatggaagccccg----gccgccgacgcca
A0A2K6B2D9_BCL2L10      -------taccgcggct-accccgggaaccgcgtcgagctggtggcgc--
A0A2K6CIX3_BCL2-01      -------agctgcacctgacgcccttcaccgcg------cggggacgc--
A0A2K6EA59_BCL2L2-      -------agctgcatgtgaccccaggctcagca------cagcaacgc--
A0A2K6EA59_BCL2L2-      -------agctgcatgtgaccccaggctcagca------cagcaacgc--
                                   **                                *    

A0A2K6DS18_BCL2A1-      --------------------------------------------------
A0A2K6DS18_BCL2A1-      --------------------------------------------------
A0A2K6ECR0_MCL1-03      tcaaatc-------------------------------------------
A0A2K6ECR0_MCL1-02      tcatgtcgcccgaagaggagctggacgggtacgagccggagcctctcggg
A0A2K6B2D9_BCL2L10      --------------------------------------------------
A0A2K6CIX3_BCL2-01      --------------------------------------------------
A0A2K6EA59_BCL2L2-      --------------------------------------------------
A0A2K6EA59_BCL2L2-      --------------------------------------------------
                                                                          

A0A2K6DS18_BCL2A1-      ------------------------------ttcaatcaagtgatggaaaa
A0A2K6DS18_BCL2A1-      ------------------------------ttcaatcaagtgatggaaaa
A0A2K6ECR0_MCL1-03      ------------------------------tttgtc------tcgagtga
A0A2K6ECR0_MCL1-02      aagcggccggctgtcctgcccctgctggagttggtcggggaatctggtaa
A0A2K6B2D9_BCL2L10      ------------------------------t-------gatggcggaggc
A0A2K6CIX3_BCL2-01      ------------------------------tttgccacggtggtggagga
A0A2K6EA59_BCL2L2-      ------------------------------ttcacccaggtctccgatga
A0A2K6EA59_BCL2L2-      ------------------------------ttcacccaggtctccgatga
                                                      *                   

A0A2K6DS18_BCL2A1-      gga--------------------gtttgaagatggcatcattaactgggg
A0A2K6DS18_BCL2A1-      gga--------------------gtttgaagatggcatcattaactgggg
A0A2K6ECR0_MCL1-03      tggtccatgt-------------tttcagcgacggcgtaacaaactgggg
A0A2K6ECR0_MCL1-02      tagccccagtacggatgggtcactaccctcgacgccgccgccagcagagg
A0A2K6B2D9_BCL2L10      cgtgct-----------------ctccgacagccccggccccacctgggg
A0A2K6CIX3_BCL2-01      ---gct-----------------cttcaggga---cggggtgaactgggg
A0A2K6EA59_BCL2L2-      ---act-----------------tttccaagg---gggccccaactgggg
A0A2K6EA59_BCL2L2-      ---act-----------------tttccaagg---gggccccaactgggg
                                                                  * * * **

A0A2K6DS18_BCL2A1-      aagaa----------ttgt--------------------aaccatatttg
A0A2K6DS18_BCL2A1-      aagaa----------ttgt--------------------aaccatatttg
A0A2K6ECR0_MCL1-03      cagga----------ttgt---gactctcatt--------tcttttggtg
A0A2K6ECR0_MCL1-02      -aggaggaggacgagttgtaccggcagtcgctggagattatctctcggta
A0A2K6B2D9_BCL2L10      caggg----------tggt--------------------gtcgctggtga
A0A2K6CIX3_BCL2-01      gagga----------tcgt--------------------ggccttctttg
A0A2K6EA59_BCL2L2-      ccgcc----------ttgt--------------------agccttctttg
A0A2K6EA59_BCL2L2-      ccgcc----------ttgt--------------------agccttctttg
                          *            * **                      *  *     

A0A2K6DS18_BCL2A1-      catttgaaggtattct-catcaagaaacttct------------------
A0A2K6DS18_BCL2A1-      catttgaaggtattct-catcaagaaacttct------------------
A0A2K6ECR0_MCL1-03      cctttgtg-gcgaaacacttg----aagac--------------------
A0A2K6ECR0_MCL1-02      ccttcgggagcaggccaccggcgccaagga--------------------
A0A2K6B2D9_BCL2L10      ccttcgcggggacgctgc-tggagagagagccgctggtgacagcctggtg
A0A2K6CIX3_BCL2-01      agttcggtggggtcatgtgtgtggagagcgtc------------------
A0A2K6EA59_BCL2L2-      tctttggggctgcactgtgtgctgagagtgtc------------------
A0A2K6EA59_BCL2L2-      tctttggggctgcactgtgtgctgagagtgtc------------------
                          ** *                    *                       

A0A2K6DS18_BCL2A1-      -----acgacagcgaattgccccggatgtggatacttataaggagatttc
A0A2K6DS18_BCL2A1-      -----acgacagcgaattgccccggatgtggatacttataaggagatttc
A0A2K6ECR0_MCL1-03      -----cataaa-ccaagaaagctgcatcgaaccattagcagaaagtatc-
A0A2K6ECR0_MCL1-02      -----cacaaagccaatgggcaggtctggggccaccagcaggaaggctct
A0A2K6B2D9_BCL2L10      gaagaagcggggcttccagccgcggctgaaggagcaggagggcgacgtcg
A0A2K6CIX3_BCL2-01      -----aaccggg-----------agatgtcgcccctggtggacaacatcg
A0A2K6EA59_BCL2L2-      -----aacaagg-----------agatggaaccactggtgggacaagtgc
A0A2K6EA59_BCL2L2-      -----aacaagg-----------agatggaaccactggtgggacaagtgc
                                                  *                    *  

A0A2K6DS18_BCL2A1-      gtat------tttgttgctgagttcataatgaataacacag---------
A0A2K6DS18_BCL2A1-      gtat------tttgttgctgagttcataatgaataacacag---------
A0A2K6ECR0_MCL1-03      acaga-----cgttctcgtaaggacaaaacgggactggc---tagt---t
A0A2K6ECR0_MCL1-02      ggaga-----cctt------acgacgggttggggatggcgtgcagc---g
A0A2K6B2D9_BCL2L10      cccgggactgccagcgcctggtggccttgctgagctcgcggctcgcgggg
A0A2K6CIX3_BCL2-01      c---------cctgtggatgactgagtacctgaaccggcacctgca----
A0A2K6EA59_BCL2L2-      a---------ggagtggatggtggcctacctggagacgcggctggc----
A0A2K6EA59_BCL2L2-      a---------ggagtggatggtggcctacctggagacgcggctggc----
                                                              *           

A0A2K6DS18_BCL2A1-      -------gagaatggataaggcaaaacggaggct-gggaaaatggctttg
A0A2K6DS18_BCL2A1-      -------gagaatggataaggcaaaacggaggctgggggaaatggc----
A0A2K6ECR0_MCL1-03      aaacaaagaggctg----------------ggatgggtttgtggagttct
A0A2K6ECR0_MCL1-02      caaccacgagacggccttccaa--------ggatgggtttgtggagttct
A0A2K6B2D9_BCL2L10      cagcaccgcgcctggcttcaggctcagggcggctgggat-----ggcttt
A0A2K6CIX3_BCL2-01      --------cacctggatccaggataacggaggctgggac------gcctt
A0A2K6EA59_BCL2L2-      --------tgactggatccacagcagtgggggctgggcg------gagtt
A0A2K6EA59_BCL2L2-      --------tgactggatccacagcagtgggggctgggagctggaagctat
                                     *                ** * **             

A0A2K6DS18_BCL2A1-      taaagaagtttgaa------------------------------------
A0A2K6DS18_BCL2A1-      ---acaatcacatg------------------------------------
A0A2K6ECR0_MCL1-03      t------ccatgtagagg--------------------------------
A0A2K6ECR0_MCL1-02      t------ccatgtagagg--------------------------------
A0A2K6B2D9_BCL2L10      tgtcacttcttcaggag---------------------------------
A0A2K6CIX3_BCL2-01      tgtggaactgtacgg-----------------------------------
A0A2K6EA59_BCL2L2-      cacagctctatacgggg---------------------------------
A0A2K6EA59_BCL2L2-      caaagctcgagtcagggagatggaggaagaagctgagaagctaaaggagc
                                                                          

A0A2K6DS18_BCL2A1-      --------------------------------------------------
A0A2K6DS18_BCL2A1-      --------------------------------------------------
A0A2K6ECR0_MCL1-03      --------------------------------------------------
A0A2K6ECR0_MCL1-02      --------------------------------------------------
A0A2K6B2D9_BCL2L10      --------------------------------------------------
A0A2K6CIX3_BCL2-01      --------------------------------------------------
A0A2K6EA59_BCL2L2-      ------acgggg--------------------------------------
A0A2K6EA59_BCL2L2-      tacagaacgaggtagagaagcagatgaatatgagtccacctccaggcaat
                                                                          

A0A2K6DS18_BCL2A1-      -------------------cctaaatctggctg-----------------
A0A2K6DS18_BCL2A1-      -------------------cctatg-ctagtag-----------------
A0A2K6ECR0_MCL1-03      -------------------acct-----agaaggtggcatcagaaat---
A0A2K6ECR0_MCL1-02      -------------------acct-----agaaggtggcatcagaaat---
A0A2K6B2D9_BCL2L10      -------------------cccc---------------------------
A0A2K6CIX3_BCL2-01      -------------------cccc-----agcatgcggcctctg-------
A0A2K6EA59_BCL2L2-      -------------------ccctggaggaggcg-cggcgtctg-------
A0A2K6EA59_BCL2L2-      gctggcccagtgatcatgtccattgaggagaagatggaggctgatgcccg
                                            *                             

A0A2K6DS18_BCL2A1-      ----------gatgacttttc-----------------------------
A0A2K6DS18_BCL2A1-      ----------agtcagtggcc-----------------------------
A0A2K6ECR0_MCL1-03      -----gtgctgctggcttttg-------------------caggtgttg-
A0A2K6ECR0_MCL1-02      -----gtgctgctggcttttg-------------------caggtgttg-
A0A2K6B2D9_BCL2L10      -----tttccgctggcttttt-----------------ggagaaaactg-
A0A2K6CIX3_BCL2-01      tttgatttctcctggctgtct-------------------------ctga
A0A2K6EA59_BCL2L2-      -----------------------------------cgggaggggaactgg
A0A2K6EA59_BCL2L2-      ttccatctatgttggcaatgtggactatggtgcaacagcagaagagctgg
                                                                          

A0A2K6DS18_BCL2A1-      --------------------------------------------------
A0A2K6DS18_BCL2A1-      --------------------------------------------------
A0A2K6ECR0_MCL1-03      --------------------------------------------------
A0A2K6ECR0_MCL1-02      --------------------------------------------------
A0A2K6B2D9_BCL2L10      --------------------------------------------------
A0A2K6CIX3_BCL2-01      agactc--------------------------------------------
A0A2K6EA59_BCL2L2-      --------------------------------------------------
A0A2K6EA59_BCL2L2-      aagctcactttcatggctgtggatcagtcaaccgtgttaccatactctgt
                                                                          

A0A2K6DS18_BCL2A1-      --------------------------------------------------
A0A2K6DS18_BCL2A1-      --------------------------------------------------
A0A2K6ECR0_MCL1-03      --------------------------------------------------
A0A2K6ECR0_MCL1-02      --------------------------------------------------
A0A2K6B2D9_BCL2L10      --------------------------------------------------
A0A2K6CIX3_BCL2-01      --------------------------------------------------
A0A2K6EA59_BCL2L2-      --------------------------------------------------
A0A2K6EA59_BCL2L2-      gacaaatttagtggccatcccaaaggatttgcgtatatagagttctcaga
                                                                          

A0A2K6DS18_BCL2A1-      --------------------------------------------------
A0A2K6DS18_BCL2A1-      --------------------------------------------------
A0A2K6ECR0_MCL1-03      --------------------------------------------------
A0A2K6ECR0_MCL1-02      --------------------------------------------------
A0A2K6B2D9_BCL2L10      --------------------------------------------------
A0A2K6CIX3_BCL2-01      ----tgctcagtttggcc--------------------------------
A0A2K6EA59_BCL2L2-      ----gcatcagtgaggac--------------------------------
A0A2K6EA59_BCL2L2-      caaagagtcagtgaggacttccttggccttagatgagtccctatttagag
                                                                          

A0A2K6DS18_BCL2A1-      --------------------------------------------------
A0A2K6DS18_BCL2A1-      --------------------------------------------------
A0A2K6ECR0_MCL1-03      --------------------------------------------------
A0A2K6ECR0_MCL1-02      --------------------------------------------------
A0A2K6B2D9_BCL2L10      --------------------------------------------------
A0A2K6CIX3_BCL2-01      --------------------------------------------------
A0A2K6EA59_BCL2L2-      -------------agtg---------------------------------
A0A2K6EA59_BCL2L2-      gaaggcaaatcaaggtgatcccaaaacgaaccaacagaccaggcatcagc
                                                                          

A0A2K6DS18_BCL2A1-      ----tagaagttacagga--------------------------------
A0A2K6DS18_BCL2A1-      ----cacaagaagaagaa--------------------------------
A0A2K6ECR0_MCL1-03      ----ctggagtaggagct--------------------------------
A0A2K6ECR0_MCL1-02      ----ctggagtaggagct--------------------------------
A0A2K6B2D9_BCL2L10      ----ctg--atccaggctt-------------------------------
A0A2K6CIX3_BCL2-01      ----ctg--gtgggagcttgcatc--------------------------
A0A2K6EA59_BCL2L2-      ----ctg--acggggg----------------------------------
A0A2K6EA59_BCL2L2-      acaacag--accggggttttccacgagcccgctaccgcgcccggaccacc
                                       *                                  

A0A2K6DS18_BCL2A1-      --------------------------------------------------
A0A2K6DS18_BCL2A1-      --------------------------------------------------
A0A2K6ECR0_MCL1-03      -----------------------------------------------ggt
A0A2K6ECR0_MCL1-02      -----------------------------------------------ggt
A0A2K6B2D9_BCL2L10      ------------------------------------------------tc
A0A2K6CIX3_BCL2-01      -----------------------------------------------acc
A0A2K6EA59_BCL2L2-      -----------------------------ccgtggc----actgggggcc
A0A2K6EA59_BCL2L2-      aactacaacagttcccgctctcgattctacagtggttttaacagcaggcc
                                                                          

A0A2K6DS18_BCL2A1-      -------aagatctgtgaa-----------------------atgctctc
A0A2K6DS18_BCL2A1-      -------aatggctttgta-----------------------a-------
A0A2K6ECR0_MCL1-03      ttgg---catatctaataa-------------------------------
A0A2K6ECR0_MCL1-02      ttgg---catatctaataa-------------------------------
A0A2K6B2D9_BCL2L10      ctgg---catgcttgttagcaacagcc---------------ttcggtta
A0A2K6CIX3_BCL2-01      ctgg----gtgcctatctg----ggcc-----------------------
A0A2K6EA59_BCL2L2-      ctg-----gtaactgtagg----ggcc--------------------ttt
A0A2K6EA59_BCL2L2-      ccggggtcgtgtctacagg----ggccgggctagagcgacatcatggtat
                                     *                                    

A0A2K6DS18_BCL2A1-      tcttctgaagcaatactgttga
A0A2K6DS18_BCL2A1-      ----------------------
A0A2K6ECR0_MCL1-03      ------gatag-----------
A0A2K6ECR0_MCL1-02      ------gatagccttactgtaa
A0A2K6B2D9_BCL2L10      tctctggacacgattattatga
A0A2K6CIX3_BCL2-01      -------acaag-------tga
A0A2K6EA59_BCL2L2-      tttgctagcaag-------tga
A0A2K6EA59_BCL2L2-      tccccttac----------taa
                                              

© 1998-2020Legal notice