Dataset for CDS BCL-2-like of organism Macaca nemestrina

[Download (right click)] [Edit] [Sequences] [Repertoires]

11 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A2K6DS18_BCL2A1-      atgac---------------------------------------------
A0A2K6DS18_BCL2A1-      atgac---------------------------------------------
A0A2K6CIX3_BCL2-01      atggc-------------gcacgctgggagaacagggtacgataacc---
A0A2K6EA59_BCL2L2-      atggcggcggcggcggcggcgg-cagcagcagcggggg-------ctgcg
A0A2K6EA59_BCL2L2-      atggcggcggcggcggcggcgg-cagcagcagcggggg-------ctgcg
A0A2K6EA59_BCL2L2-      atggcgaccccagcctcggccc-cagacaca-cgggct-------ctggt
A0A2K6EA59_BCL2L2-      atggcgaccccagcctcggccc-cagacaca-cgggct-------ctggt
A0A2K6B2D9_BCL2L10      atggc-----------tgacccgttgcgggagcgcaccgagcgg-ctcct
A0A2K6ECQ5_MCL1-02      atgtt-----------tggcct-caaaagaaacgcggtaatcggactcaa
A0A2K6ECQ5_MCL1-01      atgtt-----------tggcct-caaaagaaacgcggtaatcggactcaa
A0A2K6ECQ5_MCL1-03      atgtt-----------tggcct-caaaagaaacgcggtaatcggactcaa
                        ***                                               

A0A2K6DS18_BCL2A1-      ---agactgtgaatttggatatatttacagg-------------------
A0A2K6DS18_BCL2A1-      ---agactgtgaatttggatatatttacagg-------------------
A0A2K6CIX3_BCL2-01      gggagatagtga--tgaagtacatccactataagctgtcgcagaggggct
A0A2K6EA59_BCL2L2-      ggcggtc-------ggggctccgggccgggg---------cggcggcgcc
A0A2K6EA59_BCL2L2-      ggcggtc-------ggggctccgggccgggg---------cggcggcgcc
A0A2K6EA59_BCL2L2-      ggcagacttt-g--taggttataagctgagg---------cagaagggtt
A0A2K6EA59_BCL2L2-      ggcagacttt-g--taggttataagctgagg---------cagaagggtt
A0A2K6B2D9_BCL2L10      ggccgactatct--ggggtgctgcgcccgggaacc-----------cggc
A0A2K6ECQ5_MCL1-02      cctctactgt-g--ggggggccg-gcttgggggccggcagcggcggcgcc
A0A2K6ECQ5_MCL1-01      cctctactgt-g--ggggggccg-gcttgggggccggcagcggcggcgcc
A0A2K6ECQ5_MCL1-03      cctctactgt-g--ggggggccg-gcttgggggccggcagcggcggcgcc
                                                                          

A0A2K6DS18_BCL2A1-      ----ctagctcaggactattt-----------------------------
A0A2K6DS18_BCL2A1-      ----ctagctcaggactattt-----------------------------
A0A2K6CIX3_BCL2-01      ac----------gagtgggatgcg--------------------------
A0A2K6EA59_BCL2L2-      atcttgtgcccggggccggt------------------------------
A0A2K6EA59_BCL2L2-      atcttgtgcccggggccggt------------------------------
A0A2K6EA59_BCL2L2-      a---tgtctgtggagctggccctg--------------------------
A0A2K6EA59_BCL2L2-      a---tgtctgtggagctggccctg--------------------------
A0A2K6B2D9_BCL2L10      acccctgagccaagaccgtccacgccc-----------------------
A0A2K6ECQ5_MCL1-02      acccctccgggagggcggcttttggctacggagaaggaggcctcggcccg
A0A2K6ECQ5_MCL1-01      acccctccgggagggcggcttttggctacggagaaggaggcctcggcccg
A0A2K6ECQ5_MCL1-03      acccctccgggagggcggctttt---------------------------
                                                                          

A0A2K6DS18_BCL2A1-      -------------------------------------------------g
A0A2K6DS18_BCL2A1-      -------------------------------------------------g
A0A2K6CIX3_BCL2-01      -------------------ggggatgt------------------gggcg
A0A2K6EA59_BCL2L2-      -------------------ggggaggccggggagggggccccggggggcg
A0A2K6EA59_BCL2L2-      -------------------ggggaggccggggagggggccccggggggcg
A0A2K6EA59_BCL2L2-      -------------------gggagggcccagcagctgaccc-----gctg
A0A2K6EA59_BCL2L2-      -------------------gggagggcccagcagctgaccc-----gctg
A0A2K6B2D9_BCL2L10      -------------------gaggccgccgtgctg----------------
A0A2K6ECQ5_MCL1-02      gcgagagatagggggaggggaggccggcacggtgattggcggaagcgccg
A0A2K6ECQ5_MCL1-01      gcgagagatagggggaggggaggccggcacggtgattggcggaagcgccg
A0A2K6ECQ5_MCL1-03      --------------------------------------------------
                                                                          

A0A2K6DS18_BCL2A1-      cagtacgttctgcagatacc------------------------------
A0A2K6DS18_BCL2A1-      cagtacgttctgcagatacc------------------------------
A0A2K6CIX3_BCL2-01      cggcgacccctggggccgcccccgcaccgggcatcttctcctcccagccc
A0A2K6EA59_BCL2L2-      caggggactacgggaacggcctg----gag------tct------gag--
A0A2K6EA59_BCL2L2-      caggggactacgggaacggcctg----gag------tct------gag--
A0A2K6EA59_BCL2L2-      caccaagccatgcgggcagctggagatgag------ttc------gagac
A0A2K6EA59_BCL2L2-      caccaagccatgcgggcagctggagatgag------ttc------gagac
A0A2K6B2D9_BCL2L10      -----cgctccgcggccgcc-------------------------aggtt
A0A2K6ECQ5_MCL1-02      gcgcaagccccccggccgccctcacgccag------acgcccggagggtc
A0A2K6ECQ5_MCL1-01      gcgcaagccccccggccgccctcacgccag------acgcccggagggtc
A0A2K6ECQ5_MCL1-03      --------------------------------------------------
                                                                          

A0A2K6DS18_BCL2A1-      --------------------------------------------------
A0A2K6DS18_BCL2A1-      --------------------------------------------------
A0A2K6CIX3_BCL2-01      gggcacacgccccatcccgccgcgtcccgggacccggtcgccagga----
A0A2K6EA59_BCL2L2-      ----------------------gaactggagcctgaggagctgctgctgg
A0A2K6EA59_BCL2L2-      ----------------------gaactggagcctgagga-----------
A0A2K6EA59_BCL2L2-      ccgcttccggcgcaccttctctgatctggcggctcagctgcatgtg----
A0A2K6EA59_BCL2L2-      ccgcttccggcgcaccttctctgatctggcggctcagctgcatgtg----
A0A2K6B2D9_BCL2L10      acggcagctccacc------------------------------------
A0A2K6ECQ5_MCL1-02      gcgcggccgccgcccattggcgcggaggtccccgacgtcaccgcgagccc
A0A2K6ECQ5_MCL1-01      gcgcggccgccgcccattggcgcggaggtccccgacgtcaccgcgagccc
A0A2K6ECQ5_MCL1-03      --------------------------------------------------
                                                                          

A0A2K6DS18_BCL2A1-      --------------------------------------acaacctggatc
A0A2K6DS18_BCL2A1-      --------------------------------------acaacctggatc
A0A2K6CIX3_BCL2-01      ---------cctcgccgctgccgaccccggctgcccccgccgccgccgcg
A0A2K6EA59_BCL2L2-      agcccgagccggagcccgagcccgaagaggagccgccccggcccc-----
A0A2K6EA59_BCL2L2-      --------------------------------------------------
A0A2K6EA59_BCL2L2-      -------accccaggctcagcacagcaacgcttcacccaggtctccgatg
A0A2K6EA59_BCL2L2-      -------accccaggctcagcacagcaacgcttcacccaggtctccgatg
A0A2K6B2D9_BCL2L10      -----ggtccttcttctccgcctaccgcggctaccccgggaaccgcgtcg
A0A2K6ECQ5_MCL1-02      cgcgaggctgcttttctttgcgcccacccgccgcgcggggccgcttgagg
A0A2K6ECQ5_MCL1-01      cgcgaggctgcttttctttgcgcccacccgccgcgcggggccgcttgagg
A0A2K6ECQ5_MCL1-03      --------------------------------------------------
                                                                          

A0A2K6DS18_BCL2A1-      gggtccaagcaaaacgtccagagtgctac---------------------
A0A2K6DS18_BCL2A1-      gggtccaagcaaaacgtccagagtgctac---------------------
A0A2K6CIX3_BCL2-01      gggcctgc-------gctcagcccggtgccacct----------------
A0A2K6EA59_BCL2L2-      -gcgcccccccgggagctccg----------------ggccctgggcctg
A0A2K6EA59_BCL2L2-      --------------------------------------------------
A0A2K6EA59_BCL2L2-      aacttttccaagggggccccaactggggccgccttgtagccttctttgtc
A0A2K6EA59_BCL2L2-      aacttttccaagggggccccaactggggccgccttgtagccttctttgtc
A0A2K6B2D9_BCL2L10      agct-------ggtggcgctgatggcggaggccgt---------------
A0A2K6ECQ5_MCL1-02      agat-------ggaagccccggccgccgacgccatcatgtcgcccgaaga
A0A2K6ECQ5_MCL1-01      agat-------ggaagccccggccgccgacgccatcatgtcgcccgaaga
A0A2K6ECQ5_MCL1-03      --------------------------------------------------
                                                                          

A0A2K6DS18_BCL2A1-      ----------------------------------aaaaggttgcattctc
A0A2K6DS18_BCL2A1-      ----------------------------------aaaaggttgcattctc
A0A2K6CIX3_BCL2-01      ---------------------------------------gtggtccacct
A0A2K6EA59_BCL2L2-      gttcgggagcccccggcagccaagag-------gaggaggagga------
A0A2K6EA59_BCL2L2-      -------------------ccaagag-------gaggaggagga------
A0A2K6EA59_BCL2L2-      tttggggctgcactgtgtgctgagagtgtcaacaaggagatgga------
A0A2K6EA59_BCL2L2-      tttggggctgcactgtgtgctgagagtgtcaacaaggagatgga------
A0A2K6B2D9_BCL2L10      -------------------------gctctccgacagc---------ccc
A0A2K6ECQ5_MCL1-02      ggagctggacgggtacgagccggagcctctcgggaagcggccggctgtcc
A0A2K6ECQ5_MCL1-01      ggagctggacgggtacgagccggagcctctcgggaagcggccggctgtcc
A0A2K6ECQ5_MCL1-03      --------------------------------------------------
                                                                          

A0A2K6DS18_BCL2A1-      agtcca----aaaagaagtggaaaagaatctgaagccatgcttgga----
A0A2K6DS18_BCL2A1-      agtcca----aaaagaagtggaaaagaatctgaagccatgcttgga----
A0A2K6CIX3_BCL2-01      gaccctccgccaggccggtgacgacttctcccgccgctaccgccgc----
A0A2K6EA59_BCL2L2-      -gcc------gggac--------tggtcgagggtgac---ccgggg----
A0A2K6EA59_BCL2L2-      -gcc------gggac--------tggtcgagggtgac---ccgggg----
A0A2K6EA59_BCL2L2-      -accactggtgggacaagtgcaggagtggatggtggcctacctgga----
A0A2K6EA59_BCL2L2-      -accactggtgggacaagtgcaggagtggatggtggcctacctgga----
A0A2K6B2D9_BCL2L10      ggccccacctggggcagggt--ggtgtcgctggtgaccttcgcggg----
A0A2K6ECQ5_MCL1-02      tgcccctgctggagttggtc--ggggaatctggtaatagccccagtacgg
A0A2K6ECQ5_MCL1-01      tgcccctgctggagttggtc--ggggaatctggtaatagccccagtacgg
A0A2K6ECQ5_MCL1-03      --------------------------------------------------
                                                                          

A0A2K6DS18_BCL2A1-      ---------caatgttaatgttgcat------------------------
A0A2K6DS18_BCL2A1-      ---------caatgttaatgttgcat------------------------
A0A2K6CIX3_BCL2-01      ----------------gacttcgccg------------------------
A0A2K6EA59_BCL2L2-      ----------------gacggcgc--------------------------
A0A2K6EA59_BCL2L2-      ----------------gacggcgc--------------------------
A0A2K6EA59_BCL2L2-      ----------------gacgcggctg------------------------
A0A2K6EA59_BCL2L2-      ----------------gacgcggctg------------------------
A0A2K6B2D9_BCL2L10      ----------------gacgctgctg------------------------
A0A2K6ECQ5_MCL1-02      atgggtcactaccctcgacgccgccgccagcagaggaggaggaggacgag
A0A2K6ECQ5_MCL1-01      atgggtcactaccctcgacgccgccgccagcagaggaggaggaggacgag
A0A2K6ECQ5_MCL1-03      --------------------------------------------------
                                                                          

A0A2K6DS18_BCL2A1-      --------------------------------------------------
A0A2K6DS18_BCL2A1-      --------------------------------------------------
A0A2K6CIX3_BCL2-01      ----------------------------------------------agat
A0A2K6EA59_BCL2L2-      ----------------------------------------cattgaggac
A0A2K6EA59_BCL2L2-      ----------------------------------------cattgaggac
A0A2K6EA59_BCL2L2-      -----------------------gctgactggatccacagcagtgggggc
A0A2K6EA59_BCL2L2-      -----------------------gctgactggatccacagcagtgggggc
A0A2K6B2D9_BCL2L10      ----------------------------------------gagagagagc
A0A2K6ECQ5_MCL1-02      ttgtaccggcagtcgctggagattatctctcggtaccttcgggagcaggc
A0A2K6ECQ5_MCL1-01      ttgtaccggcagtcgctggagattatctctcggtaccttcgggagcaggc
A0A2K6ECQ5_MCL1-03      -----------------------------------------------ggc
                                                                          

A0A2K6DS18_BCL2A1-      ------------------------ccatagacactgccagaacactattc
A0A2K6DS18_BCL2A1-      ------------------------ccatagacactgccagaacactattc
A0A2K6CIX3_BCL2-01      gtccagccagctgcacctgacgccc--ttcaccgcgcggggacgctttgc
A0A2K6EA59_BCL2L2-      ccggagctggaagctatcaaagctcgagtcagggagatggaggaagaagc
A0A2K6EA59_BCL2L2-      ccggagctggaagctatcaaagctcgagtcagggagatggaggaagaagc
A0A2K6EA59_BCL2L2-      tgggagctggaagctatcaaagctcgagtcagggagatggaggaagaagc
A0A2K6EA59_BCL2L2-      tgggcg------gagttcacagctctatacgggg----------------
A0A2K6B2D9_BCL2L10      cgctggtgac----------agc-ctggtggaagaagcggggcttccagc
A0A2K6ECQ5_MCL1-02      caccggcgccaaggacacaaagc-caatgggcaggtctggggccaccagc
A0A2K6ECQ5_MCL1-01      caccggcgccaaggacacaaagc-caatgggcaggtctggggccaccagc
A0A2K6ECQ5_MCL1-03      caccggcgccaaggacacaaagc-caatgggcaggtctggggccaccagc
                                                *                         

A0A2K6DS18_BCL2A1-      aatcaagtgatggaaaaggagtttgaagatggcatcattaactggggaag
A0A2K6DS18_BCL2A1-      aatcaagtgatggaaaaggagtttgaagatggcatcattaactggggaag
A0A2K6CIX3_BCL2-01      ca-----cggtggtggaggagctcttcagggacggggtgaactgggggag
A0A2K6EA59_BCL2L2-      tg-----agaagctaaaggagctacagaacgaggtagagaagcagatgaa
A0A2K6EA59_BCL2L2-      tg-----agaagctaaaggagctacagaacgaggtagagaagcagatgaa
A0A2K6EA59_BCL2L2-      tg-----agaagctaaaggagctacagaacgaggtagagaagcagatgaa
A0A2K6EA59_BCL2L2-      ----------------------------acgggg----------------
A0A2K6B2D9_BCL2L10      cgcggctgaaggagcaggag---------------ggcgacgtcgcccgg
A0A2K6ECQ5_MCL1-02      ag-----gaaggctctggagaccttacgacgggttggggatggcgtgcag
A0A2K6ECQ5_MCL1-01      ag-----gaaggctctggagaccttacgacgggttggggatggcgtgcag
A0A2K6ECQ5_MCL1-03      ag-----gaaggctctggagaccttacgacgggttggggatggcgtgcag
                                                                          

A0A2K6DS18_BCL2A1-      aattgtaaccatat--ttgcatttgaaggtattc------------tcat
A0A2K6DS18_BCL2A1-      aattgtaaccatat--ttgcatttgaaggtattc------------tcat
A0A2K6CIX3_BCL2-01      gatcg-----------tggccttctttgagttcggtggggtcatgtgtgt
A0A2K6EA59_BCL2L2-      ta-tgagtccacctccaggcaatgctggcccagt----gatcatgtccat
A0A2K6EA59_BCL2L2-      ta-tgagtccacctccaggcaatgctggcccagt----gatcatgtccat
A0A2K6EA59_BCL2L2-      ta-tgagtccacctccaggcaatgctggcccagt----gatcatgtccat
A0A2K6EA59_BCL2L2-      ----------------------------------------------ccct
A0A2K6B2D9_BCL2L10      gactgccagcgcctggtggccttgctgagctcgc----------------
A0A2K6ECQ5_MCL1-02      ---cgcaaccacgagacggccttccaa-----------------------
A0A2K6ECQ5_MCL1-01      ---cgcaaccacgagacggccttccaaggcatgcttcggaaactggacat
A0A2K6ECQ5_MCL1-03      ---cgcaaccacgagacggccttccaaggcatgcttcggaaactggacat
                                                                          

A0A2K6DS18_BCL2A1-      caagaaacttctacgacagcgaattgcccc--------------------
A0A2K6DS18_BCL2A1-      caagaaacttctacgacagcgaattgcccc--------------------
A0A2K6CIX3_BCL2-01      ggagagcgtcaaccgggagatgtcgcccct--------ggtggacaacat
A0A2K6EA59_BCL2L2-      tgaggaga--agatggaggctgatgcccgttccatctatgttggcaatgt
A0A2K6EA59_BCL2L2-      tgaggaga--agatggaggctgatgcccgttccatctatgttggcaatgt
A0A2K6EA59_BCL2L2-      tgaggaga--agatggaggctgatgcccgttccatctatgttggcaatgt
A0A2K6EA59_BCL2L2-      ggaggagg--cg-cggcgtctg----------------------------
A0A2K6B2D9_BCL2L10      --------------------------------------------------
A0A2K6ECQ5_MCL1-02      --------------------------------------------------
A0A2K6ECQ5_MCL1-01      caaaaacg--aagacgatgtcaaatctttgtctcgagtgatggtccatgt
A0A2K6ECQ5_MCL1-03      caaaaacg--aagacgatgtcaaatctttgtctcgagtgatggtccatgt
                                                                          

A0A2K6DS18_BCL2A1-      -----------------------ggatgtgga------------------
A0A2K6DS18_BCL2A1-      -----------------------ggatgtgga------------------
A0A2K6CIX3_BCL2-01      cgccctgtggatgactgagtacctgaaccggcacctg-------------
A0A2K6EA59_BCL2L2-      ggactatggtgcaacagcaga--agagctggaagctcactttcatggctg
A0A2K6EA59_BCL2L2-      ggactatggtgcaacagcaga--agagctggaagctcactttcatggctg
A0A2K6EA59_BCL2L2-      ggactatggtgcaacagcaga--agagctggaagctcactttcatggctg
A0A2K6EA59_BCL2L2-      --------------cgggagg--ggaactgg-------------------
A0A2K6B2D9_BCL2L10      --------------------------------------------------
A0A2K6ECQ5_MCL1-02      --------------------------------------------------
A0A2K6ECQ5_MCL1-01      tttcagcgacggcgtaacaaactggggcaggattgtgactctcatttctt
A0A2K6ECQ5_MCL1-03      tttcagcgacggcgtaacaaactggggcaggattgtgactctcatttctt
                                                                          

A0A2K6DS18_BCL2A1-      --------------------------------------------------
A0A2K6DS18_BCL2A1-      --------------------------------------------------
A0A2K6CIX3_BCL2-01      --------------------------------------------------
A0A2K6EA59_BCL2L2-      tggat---------------------------------------------
A0A2K6EA59_BCL2L2-      tggat---------------------------------------------
A0A2K6EA59_BCL2L2-      tggat---------------------------------------------
A0A2K6EA59_BCL2L2-      --------------------------------------------------
A0A2K6B2D9_BCL2L10      --------------------------------------------------
A0A2K6ECQ5_MCL1-02      --------------------------------------------------
A0A2K6ECQ5_MCL1-01      ttggtgcctttgtggcgaaacacttgaagaccataaaccaagaaagctgc
A0A2K6ECQ5_MCL1-03      ttggtgcctttgtggcgaaacacttgaagaccataaaccaagaaagctgc
                                                                          

A0A2K6DS18_BCL2A1-      -------------------------------tacttataaggagatttcg
A0A2K6DS18_BCL2A1-      -------------------------------tacttataaggagatttcg
A0A2K6CIX3_BCL2-01      ------------------------------------------------ca
A0A2K6EA59_BCL2L2-      -------------------------cagtcaaccgtgttaccatactctg
A0A2K6EA59_BCL2L2-      -------------------------cagtcaaccgtgttaccatactctg
A0A2K6EA59_BCL2L2-      -------------------------cagtcaaccgtgttaccatactctg
A0A2K6EA59_BCL2L2-      --------------------------------------------------
A0A2K6B2D9_BCL2L10      -------------------------------ggctcgcggggcagcaccg
A0A2K6ECQ5_MCL1-02      --------------------------------------------------
A0A2K6ECQ5_MCL1-01      atcgaaccattagcagaaagtatcacagacgttctcgtaaggacaaaacg
A0A2K6ECQ5_MCL1-03      atcgaaccattagcagaaagtatcacagacgttctcgtaaggacaaaacg
                                                                          

A0A2K6DS18_BCL2A1-      tattttgttgctgagttcataatgaataacacaggagaatggat------
A0A2K6DS18_BCL2A1-      tattttgttgctgagttcataatgaataacacaggagaatggat------
A0A2K6CIX3_BCL2-01      cacctggat-ccaggataacggaggctgggacgcctttgtggaactgt--
A0A2K6EA59_BCL2L2-      tgacaaatt-tagtggccatcccaaaggatttgcgtatatagagttctca
A0A2K6EA59_BCL2L2-      tgacaaatt-tagtggccatcccaaaggatttgcgtatatagagttctca
A0A2K6EA59_BCL2L2-      tgacaaatt-tagtggccatcccaaaggatttgcgtatatagagttctca
A0A2K6EA59_BCL2L2-      --------------------------------------------------
A0A2K6B2D9_BCL2L10      cgcctggct-tcaggctcagggcggctgggatggcttttgtcacttct--
A0A2K6ECQ5_MCL1-02      ----------------------------ggatgggtttgtggagttct--
A0A2K6ECQ5_MCL1-01      ggactggct-agttaaacaaagaggctgggatgggtttgtggagttct--
A0A2K6ECQ5_MCL1-03      ggactggct-agttaaacaaagaggctgggatgggtttgtggagttct--
                                                                          

A0A2K6DS18_BCL2A1-      ------aaggcaaaacggaggct--------gggaaaatgg--------c
A0A2K6DS18_BCL2A1-      ------aaggcaaaacggaggctg-------ggggaaatgg--------c
A0A2K6CIX3_BCL2-01      ---acggccccagcatgcggcctctgtttgatttctcctgg--------c
A0A2K6EA59_BCL2L2-      gacaaagagtcagtgaggacttcc-------ttggccttagatgagtccc
A0A2K6EA59_BCL2L2-      gacaaagagtcagtgaggacttcc-------ttggccttagatgagtccc
A0A2K6EA59_BCL2L2-      gacaaagagtcagtgaggacttcc-------ttggccttagatgagtccc
A0A2K6EA59_BCL2L2-      ------gcatcagtgaggac------------------------------
A0A2K6B2D9_BCL2L10      ---------tca----ggagcccc-------tttccgctgg--------c
A0A2K6ECQ5_MCL1-02      ---------tccatgtagaggacc-------tagaaggtgg--------c
A0A2K6ECQ5_MCL1-01      ---------tccatgtagaggacc-------tagaaggtgg--------c
A0A2K6ECQ5_MCL1-03      ---------tccatgtagaggacc-------tagaaggtgg--------c
                                  *                                       

A0A2K6DS18_BCL2A1-      tttgtaaagaagtttgaacctaaat-------------------------
A0A2K6DS18_BCL2A1-      -------acaatcacatgcctatg--------------------------
A0A2K6CIX3_BCL2-01      tgtctctgaagactctgctcagtttggcc---------------------
A0A2K6EA59_BCL2L2-      tatttagaggaaggcaaatcaaggtgatcccaaaacgaaccaacagacca
A0A2K6EA59_BCL2L2-      tatttagaggaaggcaaatcaaggtgatcccaaaacgaaccaacagacca
A0A2K6EA59_BCL2L2-      tatttagaggaaggcaaatcaaggtgatcccaaaacgaaccaacagacca
A0A2K6EA59_BCL2L2-      ----------------------agtg------------------------
A0A2K6B2D9_BCL2L10      tttttggagaaa----------actg------------------------
A0A2K6ECQ5_MCL1-02      atc----agaaa----------tgtg------------------------
A0A2K6ECQ5_MCL1-01      atc----agaaa----------tgtg------------------------
A0A2K6ECQ5_MCL1-03      atc----agaaa----------tgtg------------------------
                                                                          

A0A2K6DS18_BCL2A1-      -------------ctggctggatgacttttctaga---------------
A0A2K6DS18_BCL2A1-      -------------ctagtagagtcagtggcccaca---------------
A0A2K6CIX3_BCL2-01      -------------ctggtggga---gcttgcatca---------------
A0A2K6EA59_BCL2L2-      ggcatcagcacaacagaccggg---gttttccacgagcccgctaccgcgc
A0A2K6EA59_BCL2L2-      ggcatcagcacaacagaccggg---gttttccacgagcccgctaccgcgc
A0A2K6EA59_BCL2L2-      ggcatcagcacaacagaccggg---gttttccacgagcccgctaccgcgc
A0A2K6EA59_BCL2L2-      -------------ctgacgggg---g------------------------
A0A2K6B2D9_BCL2L10      -------------ctgatccag---gctttcctgg---------------
A0A2K6ECQ5_MCL1-02      -------------ctg--ctgg---cttttgcagg---------------
A0A2K6ECQ5_MCL1-01      -------------ctg--ctgg---cttttgcagg---------------
A0A2K6ECQ5_MCL1-03      -------------ctg--ctgg---cttttgcagg---------------
                                     *                                    

A0A2K6DS18_BCL2A1-      -------------------------------------------agttaca
A0A2K6DS18_BCL2A1-      -------------------------------------------agaagaa
A0A2K6CIX3_BCL2-01      --------------------------------------------------
A0A2K6EA59_BCL2L2-      ccggaccaccaactacaacagttcccgctctcgattctacagtggtttta
A0A2K6EA59_BCL2L2-      ccggaccaccaactacaacagttcccgctctcgattctacagtggtttta
A0A2K6EA59_BCL2L2-      ccggaccaccaactacaacagttcccgctctcgattctacagtggtttta
A0A2K6EA59_BCL2L2-      ---------------------------------------ccgtggc----
A0A2K6B2D9_BCL2L10      -------------------------------------catgcttg--tta
A0A2K6ECQ5_MCL1-02      -------------------------------------tgttgctggagta
A0A2K6ECQ5_MCL1-01      -------------------------------------tgttgctggagta
A0A2K6ECQ5_MCL1-03      -------------------------------------tgttgctggagta
                                                                          

A0A2K6DS18_BCL2A1-      ggaaagatctgtgaaatgctctctcttctgaagcaatactgt--------
A0A2K6DS18_BCL2A1-      gaaaatggctttgtaa----------------------------------
A0A2K6CIX3_BCL2-01      --------ccctg----ggtgcctatctgggcc-----------------
A0A2K6EA59_BCL2L2-      acagcaggccccggggtcgtgtctacaggggccgggctagagcgacatca
A0A2K6EA59_BCL2L2-      acagcaggccccggggtcgtgtctacaggggccgggctagagcgacatca
A0A2K6EA59_BCL2L2-      acagcaggccccggggtcgtgtctacaggggccgggctagagcgacatca
A0A2K6EA59_BCL2L2-      actgggggccctg-----gtaactgtaggggcc-----------------
A0A2K6B2D9_BCL2L10      gcaacagccttcg----gttatct--ctggacacgattatta--------
A0A2K6ECQ5_MCL1-02      ggagctggtttgg----catatctaataagatagccttactg--------
A0A2K6ECQ5_MCL1-01      ggagctggtttgg----catatctaataagatag----------------
A0A2K6ECQ5_MCL1-03      ggagctggtttgg----catatctaataagatag----------------
                                    *                                     

A0A2K6DS18_BCL2A1-      ------------------tga
A0A2K6DS18_BCL2A1-      ---------------------
A0A2K6CIX3_BCL2-01      -------------acaagtga
A0A2K6EA59_BCL2L2-      tggtattccccttac---taa
A0A2K6EA59_BCL2L2-      tggtattccccttac---taa
A0A2K6EA59_BCL2L2-      tggtattccccttac---taa
A0A2K6EA59_BCL2L2-      ---ttttttgctagcaagtga
A0A2K6B2D9_BCL2L10      ------------------tga
A0A2K6ECQ5_MCL1-02      ------------------taa
A0A2K6ECQ5_MCL1-01      ---------------------
A0A2K6ECQ5_MCL1-03      ---------------------
                                             

© 1998-2022Legal notice