Dataset for CDS BCL-2-like of organism Oreochromis niloticus

[Download (right click)] [Edit] [Sequences] [Repertoires]

6 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


I3IZK7_BCL2L1-01        ---------------atgtctcaaaacagag----------------aac
A0A669EYA1_BCL2L10      ---------------atgtcgagaggcggagtcacacattctctatcagc
I3KXG5_MCL1-01          ---------------atgt--------------------tctccttaaat
A0A669C7T2_MCL1-03      atgaccaactttttgatgtcgaaaa--ggaaccagtgtaccttcatagac
A0A669C7T2_MCL1-01      atgaccaactttttgatgtcgaaaa--ggaaccagtgtaccttcatagac
A0A669C7T2_MCL1-02      atgaccaactttttgatgtcgaaaa--ggaaccagtgtaccttcatagac
                                       ****                               

I3IZK7_BCL2L1-01        tggtgcttttctacataaggtataaactctcccagagaaactatc-----
A0A669EYA1_BCL2L10      tg------------aagggaag-------actcaactgtaccgacgctct
I3KXG5_MCL1-01          tgctgtctgtct--gagtggtg-------tcc---aaacaacgatg----
A0A669C7T2_MCL1-03      tatcttcttcctcaaaatggag-------tcctggagggaccaat-----
A0A669C7T2_MCL1-01      tatcttcttcctcaaaatggag-------tcctggagggaccaat-----
A0A669C7T2_MCL1-02      tatcttcttcctcaaaatggag-------tcctggagggaccaat-----
                        *                 *           *        *          

I3IZK7_BCL2L1-01        ctctcaaccacatag-tactcaacgagcctttgaacaggactgatggggg
A0A669EYA1_BCL2L10      ccttccgccgtctgtatgtgcagagagcagtctgatatcgct-----ggg
I3KXG5_MCL1-01          ---tgggctttatagataattgggaaaccctct------gta-----gga
A0A669C7T2_MCL1-03      ------gcactatggat--cggggaaatcctct----ccgca-----gaa
A0A669C7T2_MCL1-01      ------gcactatggat--cggggaaatcctct----ccgca-----gaa
A0A669C7T2_MCL1-02      ------gcactatggat--cggggaaatcctct----ccgca-----gaa
                               *    *   *        *    *                *  

I3IZK7_BCL2L1-01        ggcggcggggttggatgaggaacagcgaatagacacacacgccaatggga
A0A669EYA1_BCL2L10      aggaaaatgaaattctgtgggctgtggaaa-gagaccctgctt-------
I3KXG5_MCL1-01          aacc---tggtcttgttagg-----agagacggcatc-----------ca
A0A669C7T2_MCL1-03      tgccacaggctcctctaaagactctagcaacgggattgtgtctaatggta
A0A669C7T2_MCL1-01      tgccacaggctcctctaaagactctagcaacgggattgtgtctaatggta
A0A669C7T2_MCL1-02      tgccacaggctcctctaaagactctagcaacgggattgtgtctaatggta
                                *      *   *      *    *  *               

I3IZK7_BCL2L1-01        cttttaatggcacga-----gtcccgggacccctccggcatccccgcagc
A0A669EYA1_BCL2L10      -------ttggccgaggactacct----gtccttttgctg--cacgagtc
I3KXG5_MCL1-01          tcccactttggatgg--agcagctc----tcatttcta------------
A0A669C7T2_MCL1-03      cccccaaacggccga--acaacctcggggtaacctcaaca--aacgggta
A0A669C7T2_MCL1-01      cccccaaacggccga--acaacctcggggtaacctcaaca--aacgggta
A0A669C7T2_MCL1-02      cccccaaacggccga--acaacctcggggtaacctcaaca--aacgggta
                                 *   *        *                           

I3IZK7_BCL2L1-01        ggcagcagcagccgccatcaac-----gacggacc--tcgacgcagtgaa
A0A669EYA1_BCL2L10      cacatcaagcccctcc----acctcccagcgaatcagccgctgccatga-
I3KXG5_MCL1-01          ------gaaatct--------------ggaagacggttcgttgcc--ga-
A0A669C7T2_MCL1-03      tacaacaaaagctatccgggaccgggaggaagacggttcgttgcc--ga-
A0A669C7T2_MCL1-01      tacaacaaaagctatccgggaccgggaggaagacggttcgttgcc--ga-
A0A669C7T2_MCL1-02      tacaacaaaagctatccgggaccgggaggaagacggttcgttgcc--ga-
                                   *                    *     **  **   ** 

I3IZK7_BCL2L1-01        ggaggcgctccggg-----------------acacggccaatgagttcga
A0A669EYA1_BCL2L10      ----ggcgtctggg------------------------ctgggacatcga
I3KXG5_MCL1-01          ----gcaccccgga------------------------------------
A0A669C7T2_MCL1-03      ----gcaccccggagtatcatttggacggtgaatccgacgaggagctgga
A0A669C7T2_MCL1-01      ----gcaccccggagtatcatttggacggtgaatccgacgaggagctgga
A0A669C7T2_MCL1-02      ----gcaccccggagtatcatttggacggtgaatccgacgaggagctgga
                            *    * **                                     

I3IZK7_BCL2L1-01        gctgcgatac---gctcgtgccttcagcgaccttcacagccagctg---c
A0A669EYA1_BCL2L10      aagacagcaccaagctcgcttcgacaacctcgctcagaccttcctggtgc
I3KXG5_MCL1-01          ---agaa-actaaact-----------cattattcacagttttttgggag
A0A669C7T2_MCL1-03      gagagaa-acgaaact-----------ccttattcacagttttttgggtg
A0A669C7T2_MCL1-01      gagagaa-acgaaact-----------ccttattcacagttttttgggtg
A0A669C7T2_MCL1-02      gagagaa-acgaaact-----------ccttattcacagttttttgggtg
                                **    **           *     *** *      **    

I3IZK7_BCL2L1-01        acatcacgccgg-------ccacggcct------------accaaagctt
A0A669EYA1_BCL2L10      agtgtgggccggaccactgcctcagcctcag-------------------
I3KXG5_MCL1-01          acttt--actgg---actttctcagcctcaacgaaaggaaaccaaagcac
A0A669C7T2_MCL1-03      atttt--actgg---actttctcagcctcaacgaaaggaaaccaaagcac
A0A669C7T2_MCL1-01      atttt--actgg---actttctcagcctcaacgaaaggaaaccaaagcac
A0A669C7T2_MCL1-02      atttt--actgg---actttctcagcctcaacgaaaggaaaccaaagcac
                        *       * **        * * ****                      

I3IZK7_BCL2L1-01        tgagaacgtgatggacgaggtgttccgggacg------------------
A0A669EYA1_BCL2L10      -aaagg--tgatgaaggagctggttggagatg---------------gac
I3KXG5_MCL1-01          taaaaa--tgatgaaaagagttgttgcggacgtattagaaaagcacagat
A0A669C7T2_MCL1-03      taaaaa--cgatgaaaagagttgttgcggacgtattagaaaagcacagat
A0A669C7T2_MCL1-01      taaaaa--cgatgaaaagagttgttgcggacgtattagaaaagcacagat
A0A669C7T2_MCL1-02      taaaaa--cgatgaaaagagttgttgcggacgtattagaaaagcacagat
                          *      **** *     *  *    ** *                  

I3IZK7_BCL2L1-01        --------------------------------------------------
A0A669EYA1_BCL2L10      acttgaactgggggagggttgtt----tctctt-----------------
I3KXG5_MCL1-01          atgcttacaacggaatgattaataaattgtcattggatgaaagagaagaa
A0A669C7T2_MCL1-03      acgcttacaacggaatgattaataaactgtcattggatgaaagacacgag
A0A669C7T2_MCL1-01      acgcttacaacggaatgattaataaactgtcattggatgaaagacacgag
A0A669C7T2_MCL1-02      acgcttacaacggaatgattaataaactgtcattggatgaaagacacgag
                                                                          

I3IZK7_BCL2L1-01        ------------------------gcg-----------------------
A0A669EYA1_BCL2L10      ---------tttgcctttactggagtgctggccagaaagatcct------
I3KXG5_MCL1-01          gatatgtcatt---------tgtagcg---------aagagcctctttgg
A0A669C7T2_MCL1-03      gatatgtcatttgtcggtgctgtagcg---------aagagcctctttgc
A0A669C7T2_MCL1-01      gatatgtcatttgtcggtgctgtagcg---------aagagcctctttgc
A0A669C7T2_MCL1-02      gatatgtcatttgtcggtgctgtagcg---------aagagcctctttgc
                                                * *                       

I3IZK7_BCL2L1-01        -----------tcaactggggccgcatcgtagggctttttgcgttcggcg
A0A669EYA1_BCL2L10      ggagcaga-----agccggggctggaccctgggcaacagcaggaact--g
I3KXG5_MCL1-01          agaccacacgaccaactggggtcgta---ttgtcagctttgtggccttcg
A0A669C7T2_MCL1-03      agaccacacgaccaactggggtcgta---ttgtcagctttgtggccttcg
A0A669C7T2_MCL1-01      agaccacacgaccaactggggtcgta---ttgtcagctttgtggccttcg
A0A669C7T2_MCL1-02      agaccacacgaccaactggggtcgta---ttgtcagctttgtggccttcg
                                     * * ****  * *   * *          *  *   *

I3IZK7_BCL2L1-01        gggcactgtgtgttgagtgcgtcgagaaggagatgag------ccccttg
A0A669EYA1_BCL2L10      ggacaggag---cccatgagctgcagaaggctggcagagaccatagctga
I3KXG5_MCL1-01          gggcagtggtgtctcagcacctgaaggaaaagggcagggacaactgcgtg
A0A669C7T2_MCL1-03      gagcagtggtgtctcagcacctgaaggaaaagggcagagacaactgcgtg
A0A669C7T2_MCL1-01      gagcagtggtgtctcagcacctgaaggaaaagggcagagacaactgcgtg
A0A669C7T2_MCL1-02      gagcagtggtgtctcagcacctgaaggaaaagggcagagacaactgcgtg
                        *  **          *     *  ** *       **         *   

I3IZK7_BCL2L1-01        gtgggcaggatcgtagag----tggatgaccgtctacctagacaaccaca
A0A669EYA1_BCL2L10      ttacctgggag--aagaga------------------------agaaaga
I3KXG5_MCL1-01          gtgctagtgagtcaagagatttctgcatacttgctgtctgaacagcgaga
A0A669C7T2_MCL1-03      gcgctagtgagccaagaggtttctgcatacctgctgtctgaacagcgaga
A0A669C7T2_MCL1-01      gcgctagtgagccaagaggtttctgcatacctgctgtctgaacagcgaga
A0A669C7T2_MCL1-02      gcgctagtgagccaagaggtttctgcatacctgctgtctgaacagcgaga
                                **    ****                         *   * *

I3IZK7_BCL2L1-01        ttcagccctggatccagagccaaggaggatgggagcgcttcgctgaaatc
A0A669EYA1_BCL2L10      -------ctggctgttggataatgatggatgggaaggcttctgtaagttc
I3KXG5_MCL1-01          -------ctggattatcaaaaacaatgcatgggatggctttgtggcgttc
A0A669C7T2_MCL1-03      -------ctggattgtcaaaaacaatgcatgggatggctttgtggagttc
A0A669C7T2_MCL1-01      -------ctggattgtcaaaaacaatgcatgggatggctttgtggagttc
A0A669C7T2_MCL1-02      -------ctggattgtcaaaaacaatgcatgggatggctttgtggagttc
                               **** *        *    * ******  ****        **

I3IZK7_BCL2L1-01        ttcgggcaggatgcggcggctga-----aagccggaggtctcaggagagt
A0A669EYA1_BCL2L10      tcc--------cgcagtgccagagaagtgagccaggactcatccatgaa-
I3KXG5_MCL1-01          gtt--------cg-agtagcaga-ccctgagtcgatagtca-------g-
A0A669C7T2_MCL1-03      ttt--------cg-agtagcaga-ccctgagtccacgacccgggaggtg-
A0A669C7T2_MCL1-01      ttt--------cg-agtagcaga-ccctgagtccacggtca-------g-
A0A669C7T2_MCL1-02      ttt--------cg-agtagcaga-ccctgagtccacggtca-------g-
                                    *  *   * **      ** *      *          

I3IZK7_BCL2L1-01        ttcaagaagtggctgctgg--------------------tggggatgacg
A0A669EYA1_BCL2L10      -----gaaagcgctgtttg----------------ctgccgccggtgtcg
I3KXG5_MCL1-01          -----gaacacactcatgg----------------cctttgctggatttg
A0A669C7T2_MCL1-03      -----gaatggacaaaaggaaaaatgtttcaaattacattatttaattca
A0A669C7T2_MCL1-01      -----gaacacactcatgg----------------cctttgctggatttg
A0A669C7T2_MCL1-02      -----gaacacactcatgg----------------cctttgctggatttg
                             ***    *     *                               

I3IZK7_BCL2L1-01        gtggtgacggg----cgttgtggctggtgc-----------------tct
A0A669EYA1_BCL2L10      gccttgctgggcttaccttcctcttggtgc-----------------gct
I3KXG5_MCL1-01          cttgtattggggcaacactggcactgttga-----------------tca
A0A669C7T2_MCL1-03      cagagat----------ctatttttgctaa------------------aa
A0A669C7T2_MCL1-01      ctggtattggggcaacactggccctgttga-----------------tca
A0A669C7T2_MCL1-02      ctggtattggggcaacactggccctgttgatcaggacaaacactcactca
                                          *     ** *                      

I3IZK7_BCL2L1-01        tatcgcgcaaaaa-------------------------------------
A0A669EYA1_BCL2L10      ag------------------------------------------------
I3KXG5_MCL1-01          gg------------------------------------------------
A0A669C7T2_MCL1-03      gatgccataataaaaaggaaaaag--------------------------
A0A669C7T2_MCL1-01      ggttctgggatgca------------------------------------
A0A669C7T2_MCL1-02      ggtctcaggaagaaatggagagtgtctcgccatggtgatgatccacagca
                                                                          

I3IZK7_BCL2L1-01        --------------------------------------------------
A0A669EYA1_BCL2L10      --------------------------------------------------
I3KXG5_MCL1-01          --------------------------------------------------
A0A669C7T2_MCL1-03      -----acattttttttccttttttgctagtc-------------------
A0A669C7T2_MCL1-01      --------------------------------------------------
A0A669C7T2_MCL1-02      ggcctcccctaatcttctcctgtggctaatgttatctaccacccaggtta
                                                                          

I3IZK7_BCL2L1-01        ----------cgcctgtga----------------------
A0A669EYA1_BCL2L10      -----------------------------------------
I3KXG5_MCL1-01          ----------------tga----------------------
A0A669C7T2_MCL1-03      ----------tttttttaa----------------------
A0A669C7T2_MCL1-01      ----------ttattgtga----------------------
A0A669C7T2_MCL1-02      cccctgtagttaactgtgaagaacacactggtagacaatag
                                                                 

© 1998-2021Legal notice