Dataset for CDS BCL-2-like of organism Oreochromis niloticus

[Download (right click)] [Edit] [Sequences] [Repertoires]

5 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

I3IZK7_BCL2L1-01      ---------------atgt-------------------------------
I3KXG5_MCL1-01        ---------------atgt------------------tctccttaaattg
I3JHR5_MCL1-03        atgaccaactttttgatgtcgaaaaggaaccagtgtaccttcatagacta
I3JHR5_MCL1-02        atgaccaactttttgatgtcgaaaaggaaccagtgtaccttcatagacta
I3JHR5_MCL1-01        atgaccaactttttgatgtcgaaaaggaaccagtgtaccttcatagacta

I3IZK7_BCL2L1-01      --------ctcaaaacagagaactggtg------------cttttctaca
I3KXG5_MCL1-01        ctgtctgtct--gagtggtgtcc---aaacaacgatgtgggctttataga
I3JHR5_MCL1-03        tcttcttcctcaaaatggagtcctggagggaccaat----gcactatgga
I3JHR5_MCL1-02        tcttcttcctcaaaatggagtcctggagggaccaat----gcactatgga
I3JHR5_MCL1-01        tcttcttcctcaaaatggagtcctggagggaccaat----gcactatgga
                              **   *   * *  *                     * *  *

I3IZK7_BCL2L1-01      taaggtataaactctcccag------------------------------
I3KXG5_MCL1-01        taattgggaaaccctct--gtaggaaacc---tggtcttgttagg-----
I3JHR5_MCL1-03        t--cggggaaatcctctccgcagaatgccacaggctcctctaaagactct
I3JHR5_MCL1-02        t--cggggaaatcctctccgcagaatgccacaggctcctctaaagactct
I3JHR5_MCL1-01        t--cggggaaatcctctccgcagaatgccacaggctcctctaaagactct
                      *       ***  ***   *                              

I3IZK7_BCL2L1-01      agaaac-----------------tatcc----------------------
I3KXG5_MCL1-01        agagacggcatc-----------catcccactttggatggagcagctc--
I3JHR5_MCL1-03        agcaacgggattgtgtctaatggtacccccaaacggccgaacaacctcgg
I3JHR5_MCL1-02        agcaacgggattgtgtctaatggtacccccaaacggccgaacaacctcgg
I3JHR5_MCL1-01        agcaacgggattgtgtctaatggtacccccaaacggccgaacaacctcgg
                      **  **                  * **                      

I3IZK7_BCL2L1-01      -----tctcaaccacatagtactcaacgagcctttgaacaggactgatgg
I3KXG5_MCL1-01        --tcatttcta----------------gaa-atct--------------g
I3JHR5_MCL1-03        ggtaacctcaacaaacgggtatacaacaaa-agctatccgggaccgggag
I3JHR5_MCL1-02        ggtaacctcaacaaacgggtatacaacaaa-agctatccgggaccgggag
I3JHR5_MCL1-01        ggtaacctcaacaaacgggtatacaacaaa-agctatccgggaccgggag
                             ** *                 *     *              *

I3IZK7_BCL2L1-01      gggggcgg-----------------cgggg------------------tt
I3KXG5_MCL1-01        gaagacggttcgttgccgagcaccccgga---------------------
I3JHR5_MCL1-03        gaagacggttcgttgccgagcaccccggagtatcatttggacggtgaatc
I3JHR5_MCL1-02        gaagacggttcgttgccgagcaccccggagtatcatttggacggtgaatc
I3JHR5_MCL1-01        gaagacggttcgttgccgagcaccccggagtatcatttggacggtgaatc
                      *  * ***                 ***                      

I3IZK7_BCL2L1-01      ggatgaggaacagcgaatagacac---acacgccaatgggacttttaatg
I3KXG5_MCL1-01        ------------------agaaactaaactcattattcacagtttt-ttg
I3JHR5_MCL1-03        cgacgaggagctggagagagaaacgaaactccttattcacagtttt-ttg
I3JHR5_MCL1-02        cgacgaggagctggagagagaaacgaaactccttattcacagtttt-ttg
I3JHR5_MCL1-01        cgacgaggagctggagagagaaacgaaactccttattcacagtttt-ttg
                                        *** **   ** *   * *   * ****  **

I3IZK7_BCL2L1-01      gcacgagtcccgggacccctccggcatccccgcagcggcagcagcagccg
I3KXG5_MCL1-01        ggagactttactggactttctcagcctcaacgaaaggaaacca--aagca
I3JHR5_MCL1-03        ggtgattttactggactttctcagcctcaacgaaaggaaacca--aagca
I3JHR5_MCL1-02        ggtgattttactggactttctcagcctcaacgaaaggaaacca--aagca
I3JHR5_MCL1-01        ggtgattttactggactttctcagcctcaacgaaaggaaacca--aagca
                      *      *  * ****     * ** **  ** *  *  * **  *  * 

I3IZK7_BCL2L1-01      ccatcaacgacggacctcgacgcagtgaaggaggcgctccgggacacggc
I3KXG5_MCL1-01        ctaaaaatgatg--------------aaaagagttgttgcgg--------
I3JHR5_MCL1-03        ctaaaaacgatg--------------aaaagagttgttgcgg--------
I3JHR5_MCL1-02        ctaaaaacgatg--------------aaaagagttgttgcgg--------
I3JHR5_MCL1-01        ctaaaaacgatg--------------aaaagagttgttgcgg--------
                      * *  ** ** *               ** ***  * * ***        

I3IZK7_BCL2L1-01      caatgagttcgagctgc---gatacgctcgtgccttcagcgaccttcaca
I3KXG5_MCL1-01        --acgtattagaaaagcacagatatgc------------------ttaca
I3JHR5_MCL1-03        --acgtattagaaaagcacagatacgc------------------ttaca
I3JHR5_MCL1-02        --acgtattagaaaagcacagatacgc------------------ttaca
I3JHR5_MCL1-01        --acgtattagaaaagcacagatacgc------------------ttaca
                        * *  ** **   **   **** **                  * ***

I3IZK7_BCL2L1-01      gccagctgcacatcacgccggccacggcctaccaaagctttgagaa----
I3KXG5_MCL1-01        acggaatgattaataaattgtcattgg---atgaaagagaagaagatatg
I3JHR5_MCL1-03        acggaatgattaataaactgtcattgg---atgaaagacacgaggatatg
I3JHR5_MCL1-02        acggaatgattaataaactgtcattgg---atgaaagacacgaggatatg
I3JHR5_MCL1-01        acggaatgattaataaactgtcattgg---atgaaagacacgaggatatg
                       *    **   *  *    * *   **   *  ****    **  *    

I3IZK7_BCL2L1-01      --------------cgtgatggacgaggtgttccgggacggc---gtcaa
I3KXG5_MCL1-01        tcatt---------tgtagcgaagagcctctttggagaccacacgaccaa
I3JHR5_MCL1-03        tcatttgtcggtgctgtagcgaagagcctctttgcagaccacacgaccaa
I3JHR5_MCL1-02        tcatttgtcggtgctgtagcgaagagcctctttgcagaccacacgaccaa
I3JHR5_MCL1-01        tcatttgtcggtgctgtagcgaagagcctctttgcagaccacacgaccaa
                                     **   * *     * **    ***  *     ***

I3IZK7_BCL2L1-01      ctggggccgcatcgtagggctttttgcgttcggcggggcactgtgtgttg
I3KXG5_MCL1-01        ctggggtcgtattgtcagctttgtggccttcggggcagtggtgt---ctc
I3JHR5_MCL1-03        ctggggtcgtattgtcagctttgtggccttcggagcagtggtgt---ctc
I3JHR5_MCL1-02        ctggggtcgtattgtcagctttgtggccttcggagcagtggtgt---ctc
I3JHR5_MCL1-01        ctggggtcgtattgtcagctttgtggccttcggagcagtggtgt---ctc
                      ****** ** ** **  *  ** * ** ***** *  *   ***    * 

I3IZK7_BCL2L1-01      agtgcgtcgagaaggagatgag------ccccttggtgggcaggatcgta
I3KXG5_MCL1-01        agcacctgaaggaaaagggcagggacaactgcgtggtgctagtgagtcaa
I3JHR5_MCL1-03        agcacctgaaggaaaagggcagagacaactgcgtggcgctagtgagccaa
I3JHR5_MCL1-02        agcacctgaaggaaaagggcagagacaactgcgtggcgctagtgagccaa
I3JHR5_MCL1-01        agcacctgaaggaaaagggcagagacaactgcgtggcgctagtgagccaa
                      **  * *  ** *  **   **      *  * *** *     **    *

I3IZK7_BCL2L1-01      gag-----tggatgaccgtctacctagacaaccacattcagccctggat-
I3KXG5_MCL1-01        gagatttctgcat-acttgctgtctgaacagcgaga-------ctggatt
I3JHR5_MCL1-03        gaggtttctgcat-acctgctgtctgaacagcgaga-------ctggatt
I3JHR5_MCL1-02        gaggtttctgcat-acctgctgtctgaacagcgaga-------ctggatt
I3JHR5_MCL1-01        gaggtttctgcat-acctgctgtctgaacagcgaga-------ctggatt
                      ***     ** ** **   **  **  *** * * *       ****** 

I3IZK7_BCL2L1-01      -ccagagccaaggaggatgggagcgcttcgctgaaatc-ttcgggcagga
I3KXG5_MCL1-01        atcaaaaacaatgc--atgggatggctttgtggcgttcgttcgagtagca
I3JHR5_MCL1-03        gtcaaaaacaatgc--atgggatggctttgtggagttctttcgagtagca
I3JHR5_MCL1-02        gtcaaaaacaatgc--atgggatggctttgtggagttctttcgagtagca
I3JHR5_MCL1-01        gtcaaaaacaatgc--atgggatggctttgtggagttctttcgagtagca
                        ** *  *** *   ******  **** *  *   ** **** * ** *

I3IZK7_BCL2L1-01      tgcggcggctgaaagccggaggtct------caggagagtttcaagaagt
I3KXG5_MCL1-01        ------gaccctgagtcgatagtca-------ggaacacactcatgg---
I3JHR5_MCL1-03        ------gaccctgagtccacgacccgggaggtggaatggacaaaaggaaa
I3JHR5_MCL1-02        ------gaccctgagtccacggtca-------ggaacacactcatgg---
I3JHR5_MCL1-01        ------gaccctgagtccacggtca-------ggaacacactcatgg---
                            * *    ** *      *         * *       * *    

I3IZK7_BCL2L1-01      gg-----------ctgctggtggggatgacggtggtgacg-ggcgttgtg
I3KXG5_MCL1-01        -------------cctttgctggatttgcttgtattggggcaacactggc
I3JHR5_MCL1-03        aatgtttcaaattacattatttaattcacagagat----------ctatt
I3JHR5_MCL1-02        -------------cctttgctggatttgctggtattggggcaacactggc
I3JHR5_MCL1-01        -------------cctttgctggatttgctggtattggggcaacactggc
                                       *  *                         *   

I3IZK7_BCL2L1-01      gctggtgc-----------------tcttatcgcgcaaaaa---------
I3KXG5_MCL1-01        actgttga-----------------tcagg--------------------
I3JHR5_MCL1-03        tttgctaa------------------aagatgccataataaaaaggaaaa
I3JHR5_MCL1-02        cctgttgatcaggacaaacactcactcaggtctcaggaagaaatggagag
I3JHR5_MCL1-01        cctgttga-----------------tcaggttctgggatgca--------
                        ** *                                            

I3IZK7_BCL2L1-01      --------------------------------------------------
I3KXG5_MCL1-01        --------------------------------------------------
I3JHR5_MCL1-03        ag-------------------------------acattttttttcctttt
I3JHR5_MCL1-02        tgtctcgccatggtgatgatccacagcaggcctcccctaatcttctcctg
I3JHR5_MCL1-01        --------------------------------------------------

I3IZK7_BCL2L1-01      --------------------------------------cgcctgtga---
I3KXG5_MCL1-01        --------------------------------------------tga---
I3JHR5_MCL1-03        ttgctagtc-----------------------------tttttttaa---
I3JHR5_MCL1-02        tggctaatgttatctaccacccaggttacccctgtagttaactgtgaaga
I3JHR5_MCL1-01        --------------------------------------ttattgtga---
                                                                  * *   

I3IZK7_BCL2L1-01      -------------------
I3KXG5_MCL1-01        -------------------
I3JHR5_MCL1-03        -------------------
I3JHR5_MCL1-02        acacactggtagacaatag
I3JHR5_MCL1-01        -------------------

© 1998-2020Legal notice