Dataset for CDS BCL2L1 of organism Gadus morhua

[Download (right click)] [Edit] [Sequences] [Repertoires]

3 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A8C5FC81_BCL2L1-      atggcgcaactggaccccgcccgccccttggtttcccagaaccgcgagct
A0A8C5B4N8_BCL2L1-      atga-gc-attgacacaagcatgtcgatcagt-------aacagagaact
D2ITA2_BCL2L1-02        atga-gc-attgacacaagcatgtcgatcagt-------aacagagaact
                        ***  ** * **   *  **  * *  *  **       *** * ** **

A0A8C5FC81_BCL2L1-      ggtgctgttctacatcacgcacaagctggcccagaagaacttccccctca
A0A8C5B4N8_BCL2L1-      ggtgttcttcttcctaagccataaactgtctcagaggaattacaggccta
D2ITA2_BCL2L1-02        ggtgttcttcttcctaagccataaactgtctcagaggaattacaggccta
                        **** * **** * * *  ** ** *** * **** *** * *   *  *

A0A8C5FC81_BCL2L1-      accacctc--acactggcggccacgcccccaaaccggactgaggtgggcg
A0A8C5B4N8_BCL2L1-      ttcccttccagcccgagggggcagat-----gaggggactgatgaggaca
D2ITA2_BCL2L1-02        ttcccttccagcccgagggggcaggt-----gaggggactgatgaggaca
                          * * **   * *  * ** **         *  ******* * ** * 

A0A8C5FC81_BCL2L1-      gggcc-------------gcaccgggccccgcccgcgtccccgcgccgca
A0A8C5B4N8_BCL2L1-      agtccaacaggattggtaataatgggttacggttgaac----------ga
D2ITA2_BCL2L1-02        agtccaacaggattggtaataatgggttacggttgaac----------ga
                         * **               *  ***   **   *              *

A0A8C5FC81_BCL2L1-      cgccaacggcac--gccgaacggcaccaccaccgccgccgccgccacgcc
A0A8C5B4N8_BCL2L1-      cggtaacggcaatggccagttggcgccatcacctactccacaa-------
D2ITA2_BCL2L1-02        cggtaacggcaatggccagttggcgccatcacctactccacaa-------
                        **  *******   ***    *** *** ****  * ** *         

A0A8C5FC81_BCL2L1-      ccccccatcgcccccgcccaccgcgcctccgccccggcgccagtcgtccg
A0A8C5B4N8_BCL2L1-      --------------------------------------------------
D2ITA2_BCL2L1-02        --------------------------------------------------

A0A8C5FC81_BCL2L1-      cggagacggtcgccatggcggcggtgaaggaggcgctgcgggacacggcg
A0A8C5B4N8_BCL2L1-      -----------ggcacggaggctgtgagggcagcgcttctagaatcggtg
D2ITA2_BCL2L1-02        -----------ggcacggaggctgtgagggcagcgcttctagaatcggtg
                                   * ** ** *** **** **  ***** *  **  *** *

A0A8C5FC81_BCL2L1-      ggcgagttcgagctgcgcttcacgcgggccttcagcgacctctcctccca
A0A8C5B4N8_BCL2L1-      gaagagtttgagttgcgctacacgctggccttcagcgacctgtcgtccca
D2ITA2_BCL2L1-02        gaagagtttgagttgcgctacacgctggccttcagcgacctgtcgtccca
                        *  ***** *** ****** ***** *************** ** *****

A0A8C5FC81_BCL2L1-      gctgcacatcacgccggccaccgcctaccagagcttcgagagcgtcatgg
A0A8C5B4N8_BCL2L1-      gctgcccatcacccccgccacggcctacggtagcttcgaaagcgtgatgg
D2ITA2_BCL2L1-02        gctgcccatcacccccgccacggcctacggtagcttcgaaagcgtgatgg
                        ***** ****** ** ***** ******   ******** ***** ****

A0A8C5FC81_BCL2L1-      acgaggtgttccgcgacggcgtcaactggggccgcgtggtgggcctgttt
A0A8C5B4N8_BCL2L1-      acgaggtgttcagggacagcatcaactggggacgcatagtgggcctgttt
D2ITA2_BCL2L1-02        acgaggtgttcagggacagcatcaactggggacgcatagtgggcctgttt
                        *********** * *** ** ********** *** * ************

A0A8C5FC81_BCL2L1-      gcctttggcggcgccctgtgcgtggagtgcgtggagaaggagatgagctc
A0A8C5B4N8_BCL2L1-      gccttcgggggggccctctgcgtggagtgtgtggagaaggagatgagcca
D2ITA2_BCL2L1-02        gccttcgggggggccctctgcgtggagtgtgtggagaaggagatgagcca
                        ***** ** ** ***** *********** ******************  

A0A8C5FC81_BCL2L1-      cctggttgggcgcatcgccgagtggatgacggtgtacctggacgtgcaca
A0A8C5B4N8_BCL2L1-      catggtgccccgcgtggcagagtggatgaccaggtacctggacgaccaca
D2ITA2_BCL2L1-02        catggtgccccgcgtggcagagtggatgaccaggtacctggacgaccaca
                        * ****    *** * ** ***********   ***********  ****

A0A8C5FC81_BCL2L1-      tccagccctggatccaggcgcaggggggatgggagcgtttctccgaggtg
A0A8C5B4N8_BCL2L1-      ttgaccactggatccagagcaacggaggatggaaacactttgctgcggtt
D2ITA2_BCL2L1-02        ttgaccactggatccagagcaacggaggatggaaacactttgctgcggtt
                        *  * * **********    * ** ****** * *  **  * * *** 

A0A8C5FC81_BCL2L1-      tttgggaaggacgcggcggccgagagccggcgttcccaggagagcttcag
A0A8C5B4N8_BCL2L1-      tttggaagcgacgcggcagcgggagcgaggcgtacccgggacagtcacag
D2ITA2_BCL2L1-02        tttggaagcgacgcggcagcgggagcgaggcgtacccgggacagtcacag
                        ***** *  ******** ** *      ***** *** *** **   ***

A0A8C5FC81_BCL2L1-      gaagtggttcctggcggggatgaccctgttcacgggggtcgtggtggggt
A0A8C5B4N8_BCL2L1-      gagatggatgctggtgggcgcggtgctgctgactggggtgctgctcgggg
D2ITA2_BCL2L1-02        gagatggatgctggtgggcgcggcgctgctgactggggtgctgctcgggg
                        **  *** * **** ***   *   *** * ** *****  ** * *** 

A0A8C5FC81_BCL2L1-      cactcttcgcccagaaacgcctctga
A0A8C5B4N8_BCL2L1-      ctctgctcgccaagaaacatgtctag
D2ITA2_BCL2L1-02        ctctgctcgccaagaaacatgtctag
                        * **  ***** ******   ***  

© 1998-2023Legal notice