Dataset for CDS BCL-2-like of organism Chelydra serpentina

[Download (right click)] [Edit] [Sequences] [Repertoires]

5 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A8C3RME9_BCL2A1-      atggaaagctctgagt------accgtaatgtttactatttagtccaaga
A0A8C3RIU8_BCL2L1-      atgtcgaacactaaca------------------gggaattagtgattga
A0A8C3SV21_BCL2-01      atggctcatcctgggagaagaggctatgataaccgggagatagtgctgaa
A0A8C3T6A5_MCL1-01      atg-------ttggcgttaaag-----------cgcaacgcggtg-----
A0A8C3TAL3_MCL1-01      atg-------ttggcgttaaag-----------cggaacgtggtg-----
                        ***        *                         *    **      

A0A8C3RME9_BCL2A1-      ttatctgaaatacattcttc-----aggaaccacagcttggaccagcccc
A0A8C3RIU8_BCL2L1-      ctttctctcctacaagctttcgcagaggggatacagctggagtcggttcg
A0A8C3SV21_BCL2-01      ttacatccattacaaactgtcacagaggggatatgattggg--ctgccag
A0A8C3T6A5_MCL1-01      ----atcggcctcaacctgt-actgcgg----------ggg--cggcccg
A0A8C3TAL3_MCL1-01      ----atcagcctcaacctgt-actgtgg----------ggg--cggccca
                             *      **  **        **           *   * *    

A0A8C3RME9_BCL2A1-      ---aagcagag------------------------ttgctcatgtcttaa
A0A8C3RIU8_BCL2L1-      ---agggggaggatgagatc-----aggactgagtctgcagaggaggctg
A0A8C3SV21_BCL2-01      tgaaaacagaggaccagtttctccaaatctctctcctcctactgctgctg
A0A8C3T6A5_MCL1-01      ----------gcgctggcgccccccccgccggcctccccgagcggcgcgg
A0A8C3TAL3_MCL1-01      ----------tcgctggcgc------------cctccccgaacggcgtgg
                                                              *    *      

A0A8C3RME9_BCL2A1-      gaaacgctgcatccttt---------------------------------
A0A8C3RIU8_BCL2L1-      agatggcaagcgtccctaatggg---------------------------
A0A8C3SV21_BCL2-01      ggacctcatctgaccctgctgggctgg-----------------------
A0A8C3T6A5_MCL1-01      gaacccctcccgcccccggcgcgcgggaccccggcccttcggcggagggc
A0A8C3TAL3_MCL1-01      gaacccctcccgccccc---------------------------------
                          *   *      *                                    

A0A8C3RME9_BCL2A1-      --------------------------------------------------
A0A8C3RIU8_BCL2L1-      --------------------------------------------------
A0A8C3SV21_BCL2-01      --------------------------------------------------
A0A8C3T6A5_MCL1-01      gcccggccggcgacgctgattggcggagccgcttgggcttccaacggtca
A0A8C3TAL3_MCL1-01      --------------------------------------------------
                                                                          

A0A8C3RME9_BCL2A1-      --------------------------------------------------
A0A8C3RIU8_BCL2L1-      --------------------------------------------------
A0A8C3SV21_BCL2-01      --------------------------------------------------
A0A8C3T6A5_MCL1-01      ctctgaggggccccgggcgctgattggcgaggcgccccgcgcgcggagca
A0A8C3TAL3_MCL1-01      --------------------------------------------------
                                                                          

A0A8C3RME9_BCL2A1-      --------------------------------------------------
A0A8C3RIU8_BCL2L1-      --------------------------------------------------
A0A8C3SV21_BCL2-01      --------------------------------------------------
A0A8C3T6A5_MCL1-01      gctcccccacgaccccccctgcgctggtggccggggggccccggccgggc
A0A8C3TAL3_MCL1-01      --------------------------------------------------
                                                                          

A0A8C3RME9_BCL2A1-      --------------------------------------------------
A0A8C3RIU8_BCL2L1-      --------------------------------------------------
A0A8C3SV21_BCL2-01      --------------------------------------------------
A0A8C3T6A5_MCL1-01      ccgctgtggcggccggaagaggagctggacggctgcgaccccgacgccga
A0A8C3TAL3_MCL1-01      --------------------------------------------------
                                                                          

A0A8C3RME9_BCL2A1-      --------------------------------------------------
A0A8C3RIU8_BCL2L1-      -----------agtccatcctggcatccgggtgccagccacatag-----
A0A8C3SV21_BCL2-01      ---------------tgtctctgcctcctgagccccctggctcag-----
A0A8C3T6A5_MCL1-01      gaggatgggcccgccggccgctgccgctggcggctccttgcccagcaccc
A0A8C3TAL3_MCL1-01      --------------------------------------------------
                                                                          

A0A8C3RME9_BCL2A1-      --------------------------------------------------
A0A8C3RIU8_BCL2L1-      --------------------------------------------------
A0A8C3SV21_BCL2-01      --------------------------------------------------
A0A8C3T6A5_MCL1-01      cgcccgcggacgacgacgacgacctggacgggctgtaccaggactcgctg
A0A8C3TAL3_MCL1-01      --------------------------------------------------
                                                                          

A0A8C3RME9_BCL2A1-      --------------------------------------------------
A0A8C3RIU8_BCL2L1-      --------------------------------------------------
A0A8C3SV21_BCL2-01      --------------------------------------------------
A0A8C3T6A5_MCL1-01      gagctcatcagccgctacctgcgggaggccgcggagctcgccgggcccgg
A0A8C3TAL3_MCL1-01      --------------------------------------------------
                                                                          

A0A8C3RME9_BCL2A1-      --------------------------------------------------
A0A8C3RIU8_BCL2L1-      -------------tgaatggggctgccgggcacagtaacagccttgaagc
A0A8C3SV21_BCL2-01      -------------------ctgctgcta------gtaatgtgccccttgg
A0A8C3T6A5_MCL1-01      cggcaagaagctctacaagcggctgctg--------agcgggcc-----g
A0A8C3TAL3_MCL1-01      -------------------cggctgctg--------agtgggcc-----a
                                                                          

A0A8C3RME9_BCL2A1-      ------------------------------------------ctgcaaaa
A0A8C3RIU8_BCL2L1-      ccatgaaagggttccggccactggagtgaggca-----ggcgctgagaga
A0A8C3SV21_BCL2-01      tgatgggctgcacccagcaccgcaggctgttcactt--gactctgtgcca
A0A8C3T6A5_MCL1-01      cggggggcgggccccgccgccatggagaaggcgctggagacgctgcggag
A0A8C3TAL3_MCL1-01      cggggggcaggccccgccgccatggaaacggcgctggagatgctgcggag
                                                                  ***     

A0A8C3RME9_BCL2A1-      ggaaaatgaaga-----------------------------gagtctgaa
A0A8C3RIU8_BCL2L1-      ggcaggcgatgagtttga-----att--gaggtatcgaagggctttcagt
A0A8C3SV21_BCL2-01      agccggagatgaattttcccgccgct-------accacagagattttgcc
A0A8C3T6A5_MCL1-01      ggtcggcgacgg-------cgtcattgaaaagcaccagatcgccttccaa
A0A8C3TAL3_MCL1-01      ggtcggcaacgg-------cgtcattgagaagcaccagatcgccttccaa
                         *      * *                              *  *     

A0A8C3RME9_BCL2A1-      accatgtttggacacacttgatattacctctgtagatgctgccagaagaa
A0A8C3RIU8_BCL2L1-      gacctcacttccca-gctccacatcacccctggcacggcat--accagag
A0A8C3SV21_BCL2-01      cagatgtccggcca-gctgcacttgaccccattcacggcca--gggggcg
A0A8C3T6A5_MCL1-01      gggatgcttcggaa-actagac---------atcaagaata--aggagga
A0A8C3TAL3_MCL1-01      gggatggttcggaa-gctagac---------atcaagaatg--aggagga
                            *        *  **  *                          *  

A0A8C3RME9_BCL2A1-      ttttcactcaagtcatggaaa---------aagaatttgctgatggaaac
A0A8C3RIU8_BCL2L1-      ctttgagca-ggtagtgaatg---------aactcttccgggacggagtg
A0A8C3SV21_BCL2-01      ctttgtggc-ggtggtggagg---------agctgttccgagatggagtt
A0A8C3T6A5_MCL1-01      tctgaagtc-agtgactgctgttgcaacccatgttttcagtgatggagta
A0A8C3TAL3_MCL1-01      tctgaagtc-agtgacggctgttgcaacccatgttttcagtgatggagta
                          *        **                 *    **    ** ***   

A0A8C3RME9_BCL2A1-      actaactggggacggattttgacaatatttatgtttggaggaattctttc
A0A8C3RIU8_BCL2L1-      a---actgggggcgcattgtggcttttttctcctttggagga------gc
A0A8C3SV21_BCL2-01      a---actggggaaggatcgtggccttctttgaatttggtggc------gt
A0A8C3T6A5_MCL1-01      acaaactggggtagaattgtgacactcatctcttttggtgcctttgttgc
A0A8C3TAL3_MCL1-01      gca---tggggtagaattgtgacactcatctcttttggtgcctttgttgc
                              *****  * **  ** *  *  *    ***** *          

A0A8C3RME9_BCL2A1-      taagaggcttcaagaacacagagttcagcttacagggga---------ta
A0A8C3RIU8_BCL2L1-      -cctgtgcgtggagagtgtcga---------caaggagatgcaggtgttg
A0A8C3SV21_BCL2-01      -gatgtgcgtggagagcgtcaa---------tcgggagatgtcgcctctt
A0A8C3T6A5_MCL1-01      -aaaacacctgaagagcataaa---------ccaggaga------cttgc
A0A8C3TAL3_MCL1-01      -aaaacacctgaagagcataaa---------ccaggaga------cttgc
                               * *  ***      *            ** **           

A0A8C3RME9_BCL2A1-      ataaagagcagatttcttatttcatcacgga-gtacat--tataaacaac
A0A8C3RIU8_BCL2L1-      gttggacgc--attgcctcatggatgacc-acttacctg-actgaccacc
A0A8C3SV21_BCL2-01      gtggacagc--attgctgtgtggatgaccga-gtacctg-aacagacacc
A0A8C3T6A5_MCL1-01      atcaacaca--ctagcagggatcatcacagatgtgcttgtcacagacaa-
A0A8C3TAL3_MCL1-01      atcaacaca--ctagcagggattatcacagatgtgattgtcccaggcaa-
                         *          *  *       ** **  *  *   *        **  

A0A8C3RME9_BCL2A1-      aaagctgagtggatagaggcaaatggaggttgggtaagtttcagtgctgt
A0A8C3RIU8_BCL2L1-      tagat-ccctggatccaagagaatggcggttgggagcgctt---tgtgga
A0A8C3SV21_BCL2-01      tacac-aactggatccaggacaacggaggctgggatgcctt---tgtgga
A0A8C3T6A5_MCL1-01      -acga-gattggctagttaaccaaagaggctgggagggatt---tgttga
A0A8C3TAL3_MCL1-01      -acga-gattggctagttaaccaaagaggctgggagggatt---tgttga
                         *       *** *        *  * ** ****     **   **  * 

A0A8C3RME9_BCL2A1-      attttataaccatttttcactgctgtctagatcagaagaattttccttaa
A0A8C3RIU8_BCL2L1-      tctctatgggaa--tgacgctgctgccaagagcagg------aaaggcca
A0A8C3SV21_BCL2-01      attgtacggcaa--caaca-tgaggcctttgtttga------tttctcct
A0A8C3T6A5_MCL1-01      attcttccg--------tg-tagaggatctagaagg------tagcatca
A0A8C3TAL3_MCL1-01      attcttccg--------tg-gagaggatctagaagg------tagcatca
                          * *                   *         *               

A0A8C3RME9_BCL2A1-      taaatgttct----tttaactactg-----------tcaaaaagaatcat
A0A8C3RIU8_BCL2L1-      ggagcagttcaacaggtggcttctgaccggggcgactctggcag--gcgt
A0A8C3SV21_BCL2-01      ggatctcttt----gaagactatcc-taagtctggctctggtgggagctt
A0A8C3T6A5_MCL1-01      ggaatgttct----ggtggcttttg-caggctttgctggactgggagcaa
A0A8C3TAL3_MCL1-01      ggaacgttct----ggtggcttttg-caggctttgctggactggaagcaa
                          *    *           **               *      *   *  

A0A8C3RME9_BCL2A1-      caacttagc---cagggctttatcatttgctttatttaa
A0A8C3RIU8_BCL2L1-      --gct---cctgctgggctctctgctgagccgcaagtaa
A0A8C3SV21_BCL2-01      --gcatcacc--cttggcgcttatctgggacataagtga
A0A8C3T6A5_MCL1-01      --gtttggcctacatgatgc--------------gatga
A0A8C3TAL3_MCL1-01      --gtttggcctgcatgatgc--------------aatga
                                *   *  *                    * *

© 1998-2022Legal notice