Dataset for CDS BCL-2-like of organism Chelydra serpentina

[Download (right click)] [Sequences] [Repertoires]

5 sequence(s)

CLUSTAL W (1.8) multiple sequence alignment


A0A8C3T6A5_MCL1-01        atgttggcg------------------ttaaagcgcaacgcggtgatcgg
A0A8C3TAL3_MCL1-01        atgttggcg------------------ttaaagcggaacgtggtgatcag
A0A8C3SV21_BCL2-01        atggctcatcctgggagaagaggctatgataaccgggagatagtgctgaa
A0A8C3RIU8_BCL2L1-01      atgtcgaac------------------actaacagggaattagtgattga
A0A8C3RME9_BCL2A1-01      atggaaagc------------------tct--gagtaccgtaatgtttac
                          ***                               *        ** *   

A0A8C3T6A5_MCL1-01        cctcaacctgtactgcgggggcggcccggcgctggcgccccccccgccgg
A0A8C3TAL3_MCL1-01        cctcaacctgtactgtgggggcggcccatcgctggcgccc----------
A0A8C3SV21_BCL2-01        ttacatccattacaa-----------------------------------
A0A8C3RIU8_BCL2L1-01      ctttctctcctacaa-----------------------------------
A0A8C3RME9_BCL2A1-01      tatttagtccaaga------------------------------------
                                     *                                      

A0A8C3T6A5_MCL1-01        cctccccgagcggcgcgggaacccctcccgcccccggcgcgcgggacccc
A0A8C3TAL3_MCL1-01        --tccccgaacggcgtgggaacccctcccgccccc---------------
A0A8C3SV21_BCL2-01        --------------------------------------------------
A0A8C3RIU8_BCL2L1-01      --------------------------------------------------
A0A8C3RME9_BCL2A1-01      --------------------------------------------------
                                                                            

A0A8C3T6A5_MCL1-01        ggcccttcggcggagggcgcccggccggcgacg-ctgattggcggagccg
A0A8C3TAL3_MCL1-01        --------------------------------------------------
A0A8C3SV21_BCL2-01        ---actgtcacagaggggatatgattgggctgccagtgaaaa--------
A0A8C3RIU8_BCL2L1-01      ---gctttcgcagaggggatacagctggagtcg-gttcgagg--------
A0A8C3RME9_BCL2A1-01      --------------------------------------------------
                                                                            

A0A8C3T6A5_MCL1-01        cttgggcttccaacggtcactctgaggggccccgggcgctgattggcgag
A0A8C3TAL3_MCL1-01        --------------------------------------------------
A0A8C3SV21_BCL2-01        --------------------------------------------------
A0A8C3RIU8_BCL2L1-01      --------------------------------------------------
A0A8C3RME9_BCL2A1-01      --------------------------------------------------
                                                                            

A0A8C3T6A5_MCL1-01        gcgccccgcgcgcggagcagctcccccacgacccccc-ctgcgctggtgg
A0A8C3TAL3_MCL1-01        --------------------------------------------------
A0A8C3SV21_BCL2-01        ---------cagaggaccagtttctccaaatctctctcctcc--tactgc
A0A8C3RIU8_BCL2L1-01      ---------gggaggatgagatc----aggactgagt-ctgc--agagga
A0A8C3RME9_BCL2A1-01      -------------------ttatctgaaatacattcttcagg--aaccac
                                                                            

A0A8C3T6A5_MCL1-01        ccggggggccccggccgggcccgctgtggcggccggaagaggagctggac
A0A8C3TAL3_MCL1-01        --------------------------------------------------
A0A8C3SV21_BCL2-01        tgctgggacctcatctgaccctgctgg---------gctggtgtctctgc
A0A8C3RIU8_BCL2L1-01      ggctgagatggcaagcgtccctaatgg---------gagtccatcctggc
A0A8C3RME9_BCL2A1-01      agcttggaccagcc------ccaagca---------gagttgctcatgtc
                                                                            

A0A8C3T6A5_MCL1-01        ggctgcgaccccgacgccgagaggatgggcccgccggccgctgccgctgg
A0A8C3TAL3_MCL1-01        --------------------------------------------------
A0A8C3SV21_BCL2-01        ctcctgagccccctggctcagctgctgc------------tagt------
A0A8C3RIU8_BCL2L1-01      atccgggtgccagccacatagtgaatggggctgccgggcacagt------
A0A8C3RME9_BCL2A1-01      ttaagaaacgctgcatcct---ttctg-----------------------
                                                                            

A0A8C3T6A5_MCL1-01        cggctccttgcccagcaccccgcccgcggacgacgacgacgacctggacg
A0A8C3TAL3_MCL1-01        --------------------------------------------------
A0A8C3SV21_BCL2-01        --------------------------------------------------
A0A8C3RIU8_BCL2L1-01      --------------------------------------------------
A0A8C3RME9_BCL2A1-01      --------------------------------------------------
                                                                            

A0A8C3T6A5_MCL1-01        ggctgtaccaggactcgctggagctcatcagccgctacctgcgggaggcc
A0A8C3TAL3_MCL1-01        --------------------------------------------------
A0A8C3SV21_BCL2-01        --------------------------------------------------
A0A8C3RIU8_BCL2L1-01      --------------------------------------------------
A0A8C3RME9_BCL2A1-01      --------------------------------------------------
                                                                            

A0A8C3T6A5_MCL1-01        gcggagctcgccgggcccggcggcaagaagctctacaagcggctgctgag
A0A8C3TAL3_MCL1-01        ---------------------------------------cggctgctgag
A0A8C3SV21_BCL2-01        --------------------------------------------------
A0A8C3RIU8_BCL2L1-01      --------------------------------------------------
A0A8C3RME9_BCL2A1-01      --------------------------------------------------
                                                                            

A0A8C3T6A5_MCL1-01        cgggccgcggggggcgggccccgccgccatggagaagg------------
A0A8C3TAL3_MCL1-01        tgggccacggggggcaggccccgccgccatggaaacgg------------
A0A8C3SV21_BCL2-01        ------------------aatgtgccccttggtgatgggctgcacccagc
A0A8C3RIU8_BCL2L1-01      ------------------aacagccttgaagcccatgaaagggttccggc
A0A8C3RME9_BCL2A1-01      ------------------caaaaggaaaatgaaga---------------
                                                        *   *               

A0A8C3T6A5_MCL1-01        -----------cgctggagacgctgcggagggtcggcgacggcgtcattg
A0A8C3TAL3_MCL1-01        -----------cgctggagatgctgcggagggtcggcaacggcgtcattg
A0A8C3SV21_BCL2-01        accgcaggctgttcacttgactctgtgccaagccggagatgaattttccc
A0A8C3RIU8_BCL2L1-01      c---actggagtgaggcaggcgctgagagaggcaggcgatgagtttgaat
A0A8C3RME9_BCL2A1-01      ----------------------------------------gagtctgaaa
                                                                  *         

A0A8C3T6A5_MCL1-01        aaaagcaccagatcgccttccaagggatgcttcggaaactagacatcaag
A0A8C3TAL3_MCL1-01        agaagcaccagatcgccttccaagggatggttcggaagctagacatcaag
A0A8C3SV21_BCL2-01        gccgctaccacagagattttgcccagatgtccggccagctgcacttgacc
A0A8C3RIU8_BCL2L1-01      tgaggtatcgaagggctttcagtgacctcacttcccagctccacatcacc
A0A8C3RME9_BCL2A1-01      ccatgtttggacacacttgatattacctctgtagatgctgccagaaga--
                                           *         *              *    *  

A0A8C3T6A5_MCL1-01        aataaggaggatctgaagtcagtgactgctgttgcaacccatgttttcag
A0A8C3TAL3_MCL1-01        aatgaggaggatctgaagtcagtgacggctgttgcaacccatgttttcag
A0A8C3SV21_BCL2-01        ccattcacggccagggggcgctttgtggcggtggtggaggagctgttccg
A0A8C3RIU8_BCL2L1-01      cctggcacggcataccagagctttgagcaggtagtgaatgaactcttccg
A0A8C3RME9_BCL2A1-01      ------------------attttcactcaagtcatggaaaaagaatttgc
                                                *       **        *    **   

A0A8C3T6A5_MCL1-01        tgatgga---gtaacaaactggggtagaattgtgacactcatctcttttg
A0A8C3TAL3_MCL1-01        tgatgga---gtagca---tggggtagaattgtgacactcatctcttttg
A0A8C3SV21_BCL2-01        agatgga---gtta---actggggaaggatcgtggccttctttgaatttg
A0A8C3RIU8_BCL2L1-01      ggacgga---gtga---actgggggcgcattgtggcttttttctcctttg
A0A8C3RME9_BCL2A1-01      tgatggaaacacta---actggggacggattttgacaatatttatgtttg
                           ** ***            *****  * **  ** *  *  *    ****

A0A8C3T6A5_MCL1-01        gtgcctttgttgcaaaacacctgaagagcataaaccaggagac-------
A0A8C3TAL3_MCL1-01        gtgcctttgttgcaaaacacctgaagagcataaaccaggagac-------
A0A8C3SV21_BCL2-01        gtggcgtgatg------tgcgtggagagcgtcaatcgggagatgtcgc--
A0A8C3RIU8_BCL2L1-01      gaggagccctg------tgcgtggagagtgtcgacaaggagatgcagg--
A0A8C3RME9_BCL2A1-01      gaggaattctt------tctaagaggcttcaagaacacagagttcagctt
                          * *      *            *  *       *                

A0A8C3T6A5_MCL1-01        ---------ttgcatcaacacactagcagggatcatcacagatgtgcttg
A0A8C3TAL3_MCL1-01        ---------ttgcatcaacacactagcagggattatcacagatgtgattg
A0A8C3SV21_BCL2-01        -------ctcttgtggac-agcattgctgtgtggatgaccgagtacctga
A0A8C3RIU8_BCL2L1-01      -------tgttggttgga-cgcattgcctcatggatgaccacttacctga
A0A8C3RME9_BCL2A1-01      acaggggataataaagag-cagatttcttatttcatcacggagtacatta
                                                 *  *       ** **        *  

A0A8C3T6A5_MCL1-01        tcacagacaaacgagattggctagttaaccaaagaggctgggagggattt
A0A8C3TAL3_MCL1-01        tcccaggcaaacgagattggctagttaaccaaagaggctgggagggattt
A0A8C3SV21_BCL2-01        acagacacctacacaactggatccaggacaacggaggctgggatgccttt
A0A8C3RIU8_BCL2L1-01      ctgaccacctagatccctggatccaagagaatggcggttgggagcgcttt
A0A8C3RME9_BCL2A1-01      taaacaacaaagctgagtggatagaggcaaatggaggttgggtaagtttc
                                 *  *      *** *        *  * ** ****     ** 

A0A8C3T6A5_MCL1-01        gttgaattcttccgtgtagagga--tctagaaggtagcatcaggaatgtt
A0A8C3TAL3_MCL1-01        gttgaattcttccgtggagagga--tctagaaggtagcatcaggaacgtt
A0A8C3SV21_BCL2-01        gtggaattgtacggcaacaa-----c-atgaggcctttgtttgatttctc
A0A8C3RIU8_BCL2L1-01      gtggatctctatgggaatga-----cgctgctgccaagagcaggaaaggc
A0A8C3RME9_BCL2A1-01      agtgctgtattttataaccatttttcactgctgtctagatcagaagaatt
                             *   * *         *         *  *         *       

A0A8C3T6A5_MCL1-01        ctggtggcttttgcaggctttgctggactgggagcaagtttggcctacat
A0A8C3TAL3_MCL1-01        ctggtggcttttgcaggctttgctggactggaagcaagtttggcctgcat
A0A8C3SV21_BCL2-01        ctggatctctttgaagactatcctaagt--ctggctctggtgggagcttg
A0A8C3RIU8_BCL2L1-01      caggagcagttcaacaggtggcttctgaccggggcgactctggcaggcgt
A0A8C3RME9_BCL2A1-01      -----ttccttaataaatgttcttttaactactgtcaaaaagaatcatca
                                   **            *         *       *        

A0A8C3T6A5_MCL1-01        g------------------------atgcgatga
A0A8C3TAL3_MCL1-01        g------------------------atgcaatga
A0A8C3SV21_BCL2-01        catcacccttggcgcttatctgggacataagtga
A0A8C3RIU8_BCL2L1-01      gctcctgctgggctctctgctgagccgcaagtaa
A0A8C3RME9_BCL2A1-01      acttagccagggctttatcatttgctttatttaa
                                                         * *

© 1998-2023Centre National de la Recherche Scientifique logoInstitut national de la sante et de la recherche médicale logoUniversité de Lyon logoLegal notice