Dataset for CDS BCL-2-like of organism Physeter macrocephalus

[Download (right click)] [Edit] [Sequences] [Repertoires]

6 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A2Y9FP79_BCL2A1-      atg----------------------------accgacagcgagt--ttgg
A0A2Y9FIV6_BCL2L1-      atg------------------tctcagagcaatcgggagctggtggttga
A0A2Y9EML1_BCL2-01      atggcgcacgctgggagaacagggtatgataaccgggagatagtgatgaa
A0A2Y9EFA3_BCL2L2-      atggcgaccccagcctcggcccc---agacacacgggctctagtggcaga
A0A2Y9S808_MCL1-01      atg-----------ttcggcctcaagagaaacgcag----taat--cgga
A0A2Y9S808_MCL1-02      atg-----------ttcggcctcaagagaaacgcag----taat--cgga
                        ***                              *         *      

A0A2Y9FP79_BCL2A1-      ctatat---tcacatgctggcccaggactacctgaagtacgtcttg----
A0A2Y9FIV6_BCL2L1-      ctttctctcctacaagctttcccagaa------aggatacagctggagtc
A0A2Y9EML1_BCL2-01      gtacatccactataagctgtcgcagag------gggctacgagtgg----
A0A2Y9EFA3_BCL2L2-      ctttgtaggctataagctgaggcagaa------gggttatgtttgt----
A0A2Y9S808_MCL1-01      ct---caacctctactgtgggggggcc------ggattgggaccgg----
A0A2Y9S808_MCL1-02      ct---caacctctactgtgggggggcc------ggattgggaccgg----
                         *           *   *      *            *            

A0A2Y9FP79_BCL2A1-      ----------------------cagataccacaacctggat---------
A0A2Y9FIV6_BCL2L1-      agtttagtgatgtggacgagaacagaactgaggccccagaa---------
A0A2Y9EML1_BCL2-01      --------gatgccggagacgcgggcgccgcttccccgggggccgccccc
A0A2Y9EFA3_BCL2L2-      --------ggagc---------tgg--------ccccgggg---------
A0A2Y9S808_MCL1-01      --------gtagc----gacagcggcgcctcccctccgggg---------
A0A2Y9S808_MCL1-02      --------gtagc----gacagcggcgcctcccctccgggg---------
                                                *          *  *           

A0A2Y9FP79_BCL2A1-      ----ctgg------------------------------------------
A0A2Y9FIV6_BCL2L1-      -----ggg-----actgaatcagacatggaaaccccc-------------
A0A2Y9EML1_BCL2-01      gcgccgggcatcttctcctcccagcctgggcgcaccc-------------
A0A2Y9EFA3_BCL2L2-      -----agg------------------------------------------
A0A2Y9S808_MCL1-01      -----aggcggcttttggctgcgggaaaggaggccacggccgggcgagag
A0A2Y9S808_MCL1-02      -----aggcggctttt----------------------------------

A0A2Y9FP79_BCL2A1-      --------------------------------------------------
A0A2Y9FIV6_BCL2L1-      ------------------------------------agtgccatcaatgg
A0A2Y9EML1_BCL2-01      -----------------------------------cagcgccgtccagga
A0A2Y9EFA3_BCL2L2-      --------------------------------------------------
A0A2Y9S808_MCL1-01      gtagggggaggggaagccggcgaggtgattggcggaagcgccggcccgag
A0A2Y9S808_MCL1-02      --------------------------------------------------

A0A2Y9FP79_BCL2A1-      --------------------------------------------------
A0A2Y9FIV6_BCL2L1-      caacccg-------------------------------------------
A0A2Y9EML1_BCL2-01      cctccccgccgccgccccagaccgccccc---------------------
A0A2Y9EFA3_BCL2L2-      --------------------------------------------------
A0A2Y9S808_MCL1-01      ccccccggccactctcgcgcccgacgcccggagggtcgcgcggccctcgc
A0A2Y9S808_MCL1-02      --------------------------------------------------

A0A2Y9FP79_BCL2A1-      --------------------------------------------------
A0A2Y9FIV6_BCL2L1-      --------------------------------------------------
A0A2Y9EML1_BCL2-01      --------------------------------------------------
A0A2Y9EFA3_BCL2L2-      --------------------------------------------------
A0A2Y9S808_MCL1-01      ccattggcgccgagggccccgacgtcaccgcgacccccaccaggctgctg
A0A2Y9S808_MCL1-02      --------------------------------------------------

A0A2Y9FP79_BCL2A1-      --------------------------------------------------
A0A2Y9FIV6_BCL2L1-      --------------------------------------------------
A0A2Y9EML1_BCL2-01      --------------------------------------------------
A0A2Y9EFA3_BCL2L2-      --------------------------------------------------
A0A2Y9S808_MCL1-01      ttcttcgcgcccacccgccgcgcctcgccgcccgaagagatggaatcctc
A0A2Y9S808_MCL1-02      --------------------------------------------------

A0A2Y9FP79_BCL2A1-      --------------------------------------------------
A0A2Y9FIV6_BCL2L1-      --------------------------------------------------
A0A2Y9EML1_BCL2-01      --------------------------------------------------
A0A2Y9EFA3_BCL2L2-      --------------------------------------------------
A0A2Y9S808_MCL1-01      ggcctccgacgccatcatgtctcccgaagaggagctggacgggtgcgagc
A0A2Y9S808_MCL1-02      --------------------------------------------------

A0A2Y9FP79_BCL2A1-      --------------------------------------------------
A0A2Y9FIV6_BCL2L1-      --------------------------------------------------
A0A2Y9EML1_BCL2-01      --------------------------------------------------
A0A2Y9EFA3_BCL2L2-      --------------------------------------------------
A0A2Y9S808_MCL1-01      cggaacctctagggaagcggccggccgtcctgcctttgctggagttggtc
A0A2Y9S808_MCL1-02      --------------------------------------------------

A0A2Y9FP79_BCL2A1-      --------------------------------------------------
A0A2Y9FIV6_BCL2L1-      --------------------------------------------------
A0A2Y9EML1_BCL2-01      --------------------------------------------------
A0A2Y9EFA3_BCL2L2-      --------------------------------------------------
A0A2Y9S808_MCL1-01      ggcgaggccagtaacagccccggcaaggacggctcactcccctcgacgcc
A0A2Y9S808_MCL1-02      --------------------------------------------------

A0A2Y9FP79_BCL2A1-      --------------------------------------------------
A0A2Y9FIV6_BCL2L1-      --------------------------------------------------
A0A2Y9EML1_BCL2-01      --------------------------------------------------
A0A2Y9EFA3_BCL2L2-      --------------------------------------------------
A0A2Y9S808_MCL1-01      gcccccagcagaggaagaggaggatgagttgtaccggcagtccctggaga
A0A2Y9S808_MCL1-02      --------------------------------------------------

A0A2Y9FP79_BCL2A1-      --------------tccaagcaa--aacatccag-------------ggt
A0A2Y9FIV6_BCL2L1-      --------------tcctggcacctggcagacagccctgcggtgaatgga
A0A2Y9EML1_BCL2-01      --------------gccggggggcctgcgctcagccccgtg---------
A0A2Y9EFA3_BCL2L2-      --------------gcccagcagctgacccgctgcaccaag---------
A0A2Y9S808_MCL1-01      ttatctctcgatacctccaggagcaggcaaccggcaccaagg-acgcgaa
A0A2Y9S808_MCL1-02      -------------------------ggcaaccggcaccaagg-acgcgaa
                                                   *   * *                

A0A2Y9FP79_BCL2A1-      gttacaagac----------------------------------------
A0A2Y9FIV6_BCL2L1-      gccactggccacagcagcagcttggatgcccgggaggtgatccccatggc
A0A2Y9EML1_BCL2-01      ----ccaccc----------------------------------------
A0A2Y9EFA3_BCL2L2-      ----ccatgc----------------------------------------
A0A2Y9S808_MCL1-01      gccactgggc----------------------------------------
A0A2Y9S808_MCL1-02      gccactgggc----------------------------------------
                            *    *                                        

A0A2Y9FP79_BCL2A1-      -gttgctttctcggtccaaaacgaagttgaaaagcatttgaaaccatgct
A0A2Y9FIV6_BCL2L1-      agcggtgaagcaagcgctgagggaggcaggcgatgagtttgaactgaggt
A0A2Y9EML1_BCL2-01      -gtggttcacctgaccctgcgccaggcgggtgatgacttctctcatcgct
A0A2Y9EFA3_BCL2L2-      -ggg-----------c--------agctggagatgagttcgagactcgct
A0A2Y9S808_MCL1-01      -gggtctggggccgcc--------agccgga-aggcgttagagac---cc
A0A2Y9S808_MCL1-02      -gggtctggggccgcc--------agccgga-aggcgttagagac---cc
                         *                       *  *   *    **           

A0A2Y9FP79_BCL2A1-      tg--------------------gacaatattgatgt-tgtgtccatagac
A0A2Y9FIV6_BCL2L1-      accggcgggcattcagcgacctgacatcccagctccacatcaccccaggg
A0A2Y9EML1_BCL2-01      accgccgcgacttcgccgagatgtccagccagctgcacctgacgcccttc
A0A2Y9EFA3_BCL2L2-      tccggcgcaccttctcggatctggcagctcagctgcatgtgaccccgggt
A0A2Y9S808_MCL1-01      tgcgacggg-----tcggggacggtg-------tgcaacggaaccacgaa
A0A2Y9S808_MCL1-02      tgcgacggg-----tcggggacggtg-------tgcaacggaaccacgaa
                                              *          *                

A0A2Y9FP79_BCL2A1-      accgcca----gaacaatattca---------------------------
A0A2Y9FIV6_BCL2L1-      acggcat----atcagagctttg---------------------------
A0A2Y9EML1_BCL2-01      accgcga----ggggacgctttg---------------------------
A0A2Y9EFA3_BCL2L2-      tcggccc----agcaacgcttc----------------------------
A0A2Y9S808_MCL1-01      acggccttccaaggcatgcttcggaaactggacatcaaaaacgaagacga
A0A2Y9S808_MCL1-02      acggccttccaaggcatgcttcggaaactggacatcaaaaacgaagacga
                         * **              **                             

A0A2Y9FP79_BCL2A1-      --------------accaagtgatggaaagggaatttgaagatggcatcg
A0A2Y9FIV6_BCL2L1-      --------------agcaggtagtgaacgaactcttccgggatggggt--
A0A2Y9EML1_BCL2-01      --------------ccacggtggtggaggagctcttcagggatggggt--
A0A2Y9EFA3_BCL2L2-      ------acccaggtctctgatga------actcttccaa----gggggcc
A0A2Y9S808_MCL1-01      tgtcaaatctttgtctcgagtgatggtccatgttttcagtgacggagtaa
A0A2Y9S808_MCL1-02      tgtcaaatctttgtctcgagtgatggtccatgttttcagtgacggagtaa
                                            *             *        **     

A0A2Y9FP79_BCL2A1-      ttaactggggaaggattgtgaccatatttgcatttgaaggcattctcatc
A0A2Y9FIV6_BCL2L1-      -gaactggggtcgcattgtggcctttttctccttcggtggggcactgtgc
A0A2Y9EML1_BCL2-01      -gaactgggggaggattgtggccttctttgagttcggtggggtcatgtgt
A0A2Y9EFA3_BCL2L2-      ccaactggggccgccttgtggctttctttgtctttggagccgcgctgtgt
A0A2Y9S808_MCL1-01      caaactggggcaggattgtgactctcatttcttttggtgc----ctttgt
A0A2Y9S808_MCL1-02      caaactggggcaggattgtgactctcatttcttttggtgc----ctttgt
                          ********  *  ***** *  *  *    ** *  *      *    

A0A2Y9FP79_BCL2A1-      aagaaacttctaggagggcgaattgccccag--------atgtggacact
A0A2Y9FIV6_BCL2L1-      g----------tggaaagcg--tagacaaggag------atgcaggtatt
A0A2Y9EML1_BCL2-01      g----------tggagagcg--tcaaccgggag------atgtcccccct
A0A2Y9EFA3_BCL2L2-      g----------ctgagagtg--tcaacaaggag------atggagccact
A0A2Y9S808_MCL1-01      ggccaaacacttgaagagta--taaaccaagaaagctgcatcgaaccatt
A0A2Y9S808_MCL1-02      ggccaaacacttgaagagta--taaaccaagaaagctgcatcgaaccatt
                                      *  *    *   *   *        **        *

A0A2Y9FP79_BCL2A1-      tacaaggag-atttcttactttgttg-cagagttcata-accgaaaacac
A0A2Y9FIV6_BCL2L1-      ggtgagtcggattgcagct-tggatggccacttacctg-aatgaccacct
A0A2Y9EML1_BCL2-01      ggtggacaacatcgcc-ctgtggatgactgagtacctg-aaccgacacct
A0A2Y9EFA3_BCL2L2-      tgtgggaca-agtgcaggagtggatggtggcctacctggagacgcgactg
A0A2Y9S808_MCL1-01      agcagaaagcatcacagatgttctcgtaaggaca-----aaacgagactg
A0A2Y9S808_MCL1-02      agcagaaagcatcacagatgttctcgtaaggaca-----aaacgagactg
                                  *   *     *    *             *      **  

A0A2Y9FP79_BCL2A1-      aggagaatggataaggcaaaacggaggctgggaaa-----atggctttgt
A0A2Y9FIV6_BCL2L1-      agagccttggatccaggagaacggcggctgggacactttcgtggaactct
A0A2Y9EML1_BCL2-01      gcacacctggatccaggataacggaggctgggatgcctttgtggagctgt
A0A2Y9EFA3_BCL2L2-      gc-cgactggatccacagcagcgggggctgggcggagttcacagctctat
A0A2Y9S808_MCL1-01      gc-tagtcaaacaaa--------gaggctgggatgggtttgtggacttct
A0A2Y9S808_MCL1-02      gc-tagtcaaacaaa--------gaggctgggatgggtttgtggacttct
                                  *            * *******           *   * *

A0A2Y9FP79_BCL2A1-      aaagaagtttgaacccaaa---------------tctgg-----------
A0A2Y9FIV6_BCL2L1-      acgggaacaatgcagcagccgagagccggaagggccaggagcgcttcaac
A0A2Y9EML1_BCL2-01      at--------ggtcccagcat----gcggcc---cctgtttgatttctcc
A0A2Y9EFA3_BCL2L2-      acggggacggggccctggaggaggcgcggcg---tctgcgggaggggaac
A0A2Y9S808_MCL1-01      tccatgtagaggacctagaag----gcggca---tc--------------
A0A2Y9S808_MCL1-02      tccatgtagaggacctagaag----gcggca---tc--------------

A0A2Y9FP79_BCL2A1-      ---------ctggctgacttttct------ggaagttacaggaaagatct
A0A2Y9FIV6_BCL2L1-      cgctggttcctgacgggcatgactgtcgctggc----------gtggttc
A0A2Y9EML1_BCL2-01      tggctgtctctga-aggcactgctaagtctggccctggt---gggagctt
A0A2Y9EFA3_BCL2L2-      tgggcctcagtga-ggacagtgctgacgggggccgtggcactgggggccc
A0A2Y9S808_MCL1-01      ------------a-gaaatgtgctgct---ggcttttgca--ggtgttgc
A0A2Y9S808_MCL1-02      ------------a-gaaatgtgctgct---ggcttttgca--ggtgttgc
                                              **      **                  

A0A2Y9FP79_BCL2A1-      gtgaaatatta--cgtctcctgaa-----gcagtactattga-
A0A2Y9FIV6_BCL2L1-      tg------ctgggctcgctcttca-----gtcgga--aatga-
A0A2Y9EML1_BCL2-01      gcgtcaccctgggtgcctatctgg-----gccata--agtga-
A0A2Y9EFA3_BCL2L2-      tggtaactgtaggggccttttttg-----ctagca--agtga-
A0A2Y9S808_MCL1-01      cgg----agtaggagctggtttggcgtatctaata--agatag
A0A2Y9S808_MCL1-02      cgg----agtaggagctggtttggcgtatctaata--agatag
                                 *                        *  *   * 

© 1998-2021Legal notice