Dataset for CDS MCL-1 of organism Salmo trutta

[Download (right click)] [Edit] [Sequences] [Repertoires]

6 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A674D165_MCL1-01      atgctgaggttccaaagcgggctgctagcattccccgagttcaagttgta
A0A674D1T7_MCL1-01      -------------------------------tcaccgaa-----------
A0A673VWA7_MCL1-01      atg-----------agtctgtcgaactcgattacacgagccacaactacg
A0A674ELG3_MCL1-03      atg-----------agtctg------tcgtttacacgagccacaactacg
A0A674ELG3_MCL1-01      atg-----------agtctg------tcgtttacacgagccacaactacg
A0A674ELG3_MCL1-02      atg-----------agtctg------tcgtttacacgagccacaactacg
                                                       *   ***            

A0A674D165_MCL1-01      --ctcgaatgttgggtacgttacaatcgcaggtacaaaacattgcattat
A0A674D1T7_MCL1-01      --------------------------------------------------
A0A673VWA7_MCL1-01      atgttgcattttcaaaat---------ggaggatcttcgtacctagctga
A0A674ELG3_MCL1-03      attttgaattttcaaaatggagtcgtcggaggctcttcgtaccctgctgg
A0A674ELG3_MCL1-01      attttgaattttcaaaatggagtcgtcggaggctcttcgtaccctgctgg
A0A674ELG3_MCL1-02      attttgaattttcaaaatggagtcgtcggaggctcttcgtaccctgctgg
                                                                          

A0A674D165_MCL1-01      ctgtgcatcgccaccaggccaagatcattacatcgcgtgccctgagattg
A0A674D1T7_MCL1-01      --------------------------------------------------
A0A673VWA7_MCL1-01      tgatgctaggccgttgtactatttccacggggctggggccatatgtgctg
A0A674ELG3_MCL1-03      ------tacccctttgtgctatttcggcgagactg------tatgtgctg
A0A674ELG3_MCL1-01      ------tacccctttgtgctatttcggcgagactg------tatgtgctg
A0A674ELG3_MCL1-02      ------tacccctttgtgctatttcggcgagactg------tatgtgctg
                                                                          

A0A674D165_MCL1-01      gtaacctcctcaaaacaaagttgaagcatctgaaactgtcagggtctatc
A0A674D1T7_MCL1-01      --------------------------------------------------
A0A673VWA7_MCL1-01      gggcgtcaccgaagtctaaagtggaca------tgggaaatgggactggc
A0A674ELG3_MCL1-03      gggcgtcaccgaagtcaaaagtggatactgacttgggtaatgggactggc
A0A674ELG3_MCL1-01      gggcgtcaccgaagtcaaaagtggatactgacttgggtaatgggactggc
A0A674ELG3_MCL1-02      gggcgtcaccgaagtcaaaagtggatactgacttgggtaatgggactggc
                                                                          

A0A674D165_MCL1-01      gacagcactcctttgttcactaggagaggacccggacatgagtacagctg
A0A674D1T7_MCL1-01      --------------------------------------------------
A0A673VWA7_MCL1-01      gatactccaccacgacccacgacgttagga---------gtgaatgtcgt
A0A674ELG3_MCL1-03      gacaccccaccacgacccacgaagttagga---------gtgaatgtcgt
A0A674ELG3_MCL1-01      gacaccccaccacgacccacgaagttagga---------gtgaatgtcgt
A0A674ELG3_MCL1-02      gacaccccaccacgacccacgaagttagga---------gtgaatgtcgt
                                                                          

A0A674D165_MCL1-01      gggaggcctcgaacccgatagcgccttagctta-cgacaccacaaacttc
A0A674D1T7_MCL1-01      -------------------------tcggctta-cggcgc----------
A0A673VWA7_MCL1-01      gaaaagcaacggcctcgataatcatttgtcagaccgaagcaacaa-----
A0A674ELG3_MCL1-03      gaaaagcaacgtccagggtaatcatatctcagaccgaagcaacga-----
A0A674ELG3_MCL1-01      gaaaagcaacgtccagggtaatcatatctcagaccgaagcaacga-----
A0A674ELG3_MCL1-02      gaaaagcaacgtccagggtaatcatatctcagaccgaagcaacga-----
                                                     *  * **   *          

A0A674D165_MCL1-01      ggtgtactccttccacatacggttgacacacacaaatgtttcatgtgtaa
A0A674D1T7_MCL1-01      --------------------------------------------------
A0A673VWA7_MCL1-01      --------------------tgacgac---------tctttgccgtgcac
A0A674ELG3_MCL1-03      --------------------tgacgactctgacggttctttgccgtgcac
A0A674ELG3_MCL1-01      --------------------tgacgactctgacggttctttgccgtgcac
A0A674ELG3_MCL1-02      --------------------tgacgactctgacggttctttgccgtgcac
                                                                          

A0A674D165_MCL1-01      cctcgaaatcaacaactttatatcacatcaggaaacataccatcaccag-
A0A674D1T7_MCL1-01      cctcaccatc------------------cagggaaggtacctaccc----
A0A673VWA7_MCL1-01      tccccagatg--------------gcgtcagaatgtgggcctgaactatc
A0A674ELG3_MCL1-03      tccacagatg--------------gcgtcagaatgtgggcctgaactatc
A0A674ELG3_MCL1-01      tccacagatg--------------gcgtcagaatgtgggcctgaactatc
A0A674ELG3_MCL1-02      tccacagatg--------------gcgtcagaatgtgggcctgaactatc
                         *     **                   ***        **    *    

A0A674D165_MCL1-01      ---------accgg-------agccctggacaccgacaccaggcaactca
A0A674D1T7_MCL1-01      ----------tccg-------ag----ggacatcaccc----gcaactca
A0A673VWA7_MCL1-01      gaattgtccatcgggcgatgaagtattggaagatgataccagacaactca
A0A674ELG3_MCL1-03      gaattgtccatcgggcgatgaagtattagaacatgatacaagacaactaa
A0A674ELG3_MCL1-01      gaattgtccatcgggcgatgaagtattagaacatgatacaagacaactaa
A0A674ELG3_MCL1-02      gaattgtccatcgggcgatgaagtattagaacatgatacaagacaactaa
                                   * *       **     **             ***** *

A0A674D165_MCL1-01      ttaaatgtgtcctaggacaatgtacgggacttctgaaacctaggtggaac
A0A674D1T7_MCL1-01      ttaaat--------ggacaatgtacgggacttctgaaacctaggtggaac
A0A673VWA7_MCL1-01      ttgagaattttttgggggactacacaggactgtctcaccctcgatggaaa
A0A674ELG3_MCL1-03      ttgaaaacttattgggggactatacaggactgtctccgcctcgttggaag
A0A674ELG3_MCL1-01      ttgaaaacttattgggggactatacaggactgtctccgcctcgttggaag
A0A674ELG3_MCL1-02      ttgaaaacttattgggggactatacaggactgtctccgcctcgttggaag
                        ** *          **  * *  ** *****       *** * ***** 

A0A674D165_MCL1-01      gaaagcaaagctctgtcaacaatgagtagagttgttggtcaattactgga
A0A674D1T7_MCL1-01      gaaagcaaagctctgtcaacaatgagtagagttgttggtcaattactgga
A0A673VWA7_MCL1-01      caaagcaagcctcttacgacgatgaagcgagtggtggaggacgtaatagc
A0A674ELG3_MCL1-03      caaagcaaggctcttacgacgatgacgcgagtggtgaaggatataattgc
A0A674ELG3_MCL1-01      caaagcaaggctcttacgacgatgacgcgagtggtgaaggatataattgc
A0A674ELG3_MCL1-02      caaagcaaggctcttacgacgatgacgcgagtggtgaaggatataattgc
                         *******  ****  * ** ****   **** **     *  ** * * 

A0A674D165_MCL1-01      gaagcacagatacacatacaatggtatgatcaacacactctatgtggatg
A0A674D1T7_MCL1-01      gaagcacagatacacatccaatggtatgatcaacacactctatgtggatg
A0A673VWA7_MCL1-01      aaagcaccgatacgcatacaatggtatggtcgccaaacttgacttggatg
A0A674ELG3_MCL1-03      gaagcaccaatacgcatacaatggtatgatcgccaaacttgaactcgatg
A0A674ELG3_MCL1-01      gaagcaccaatacgcatacaatggtatgatcgccaaacttgaactcgatg
A0A674ELG3_MCL1-02      gaagcaccaatacgcatacaatggtatgatcgccaaacttgaactcgatg
                         ******  **** *** ********** **  ** ***  *  * ****

A0A674D165_MCL1-01      acagaggggatgacgtgaagttcctcagtgcagtagcccatatcatcttt
A0A674D1T7_MCL1-01      acagaggggatgacgtgaagttcctcagtgcagtaacccatatcatcttt
A0A673VWA7_MCL1-01      accgatgcgatgacatgggcgtcatcaattctgtggccaagaccatgttc
A0A674ELG3_MCL1-03      accgaagcgacgacatgagtttcatcaattctgtggccaagaccctgttc
A0A674ELG3_MCL1-01      accgaagcgacgacatgagtttcatcaattctgtggccaagaccctgttc
A0A674ELG3_MCL1-02      accgaagcgacgacatgagtttcatcaattctgtggccaagaccctgttc
                        ** ** * ** *** **    ** *** * * **  ** * * * * ** 

A0A674D165_MCL1-01      caagacgggaccgtcaactggggccgtgttgccagcctgacatcttttgg
A0A674D1T7_MCL1-01      caagacgggaccgtcaactggggccgtgttgccagcctgacatcttttgg
A0A673VWA7_MCL1-01      agtgatgggatcacaaactggggtcgcatcgccagcctggtggcatttgg
A0A674ELG3_MCL1-03      agtgatgggaccaccaactggggtcgcatcgccagcctggtggcatttgg
A0A674ELG3_MCL1-01      agtgatgggaccaccaactggggtcgcatcgccagcctggtggcatttgg
A0A674ELG3_MCL1-02      agtgatgggaccaccaactggggtcgcatcgccagcctggtggcatttgg
                           ** **** *   ******** **  * *********    * *****

A0A674D165_MCL1-01      agctgcggtgtgccagtacttgaaagacaaggggagagacaactgtgtgg
A0A674D1T7_MCL1-01      agctgcggtgtgccagtacttgaaagacaaggggagagacaactgtgtgg
A0A673VWA7_MCL1-01      agcagtggtgagccagcacctgaaggagaggggcaggggacactgcgttg
A0A674ELG3_MCL1-03      agcagtggtgagccagcgcttgaaggagatgggcaggggacactgcattg
A0A674ELG3_MCL1-01      agcagtggtgagccagcgcttgaaggagatgggcaggggacactgcattg
A0A674ELG3_MCL1-02      agcagtggtgagccagcgcttgaaggagatgggcaggggacactgcattg
                        *** * **** *****  * **** ** * *** ** *   ****  * *

A0A674D165_MCL1-01      aggtggcgggagaggagatatcagcgtacctggtcacacaccacaaggac
A0A674D1T7_MCL1-01      aggtggcgggagaggagatatcagcatacctggtcactcaccacaaggac
A0A673VWA7_MCL1-01      agttggtgggccaagagattgccaaatatctcctctctgaccaaagtgac
A0A674ELG3_MCL1-03      agttggtgggccaaaatatcgccacatacctcctctctgaccaaagggac
A0A674ELG3_MCL1-01      agttggtgggccaaaatatcgccacatacctcctctctgaccaaagggac
A0A674ELG3_MCL1-02      agttggtgggccaaaatatcgccacatacctcctctctgaccaaagggac
                        ** *** ***  *  * **  *    ** **  ** *  **** *  ***

A0A674D165_MCL1-01      tggctagtcaaacataactcctggaatgggttcgtggagttctttccagt
A0A674D1T7_MCL1-01      tggctagtcaaacataactcctggaatgggttcgtggagttctatccagt
A0A673VWA7_MCL1-01      tggctgatcaaaaacaatgcttggaatggatttgtagagttctttcatgt
A0A674ELG3_MCL1-03      tggctggtcaaaaacaatgcttggaatggatttgtagagttctttcatgt
A0A674ELG3_MCL1-01      tggctggtcaaaaacaatgcttggaatggatttgtagagttctttcatgt
A0A674ELG3_MCL1-02      tggctggtcaaaaacaatgcttggaatggatttgtagagttctttcatgt
                        *****  ***** * **  * ******** ** ** ******* **  **

A0A674D165_MCL1-01      agcagaaccggagtccagatctaggaacattattatgacccctgttggat
A0A674D1T7_MCL1-01      agcagaaccggagtccagatctaggaacattattattacccttgttggat
A0A673VWA7_MCL1-01      acaagatcctgagtcctcagtaaggaacaccctcctagccattgctggag
A0A674ELG3_MCL1-03      gcaagatccagagtcctcagtaaggaacgccctcatagcctttgctggat
A0A674ELG3_MCL1-01      gcaagatccagagtcctcagtaaggaacgccctcatagcctttgctggat
A0A674ELG3_MCL1-02      gcaagatccagagtcctcagtaaggaacgccctcatagcctttgctggat
                           *** ** ******  *   ******    *  *  **  ** **** 

A0A674D165_MCL1-01      tggctggtattggagcagcaatgaccttgttggttatgtga---------
A0A674D1T7_MCL1-01      tggctggtattggagcagcaatgaccttgttggttatgtga---------
A0A673VWA7_MCL1-01      ttgctgggattggggcaacactcgccatgttcatcaggtga---------
A0A674ELG3_MCL1-03      ttgctgggcttggggcaacgctcgccatgttgatcaggaattcagcagat
A0A674ELG3_MCL1-01      ttgctgggcttggggcaacgctcgccatgttgatcagacagttccctgct
A0A674ELG3_MCL1-02      ttgctgggcttggggcaacgctcgccatgttgatcagaaa---------t
                        * *****  **** *** *  *  ** ****  * *              

A0A674D165_MCL1-01      ------------------------------
A0A674D1T7_MCL1-01      ------------------------------
A0A673VWA7_MCL1-01      ------------------------------
A0A674ELG3_MCL1-03      tag---------------------------
A0A674ELG3_MCL1-01      caaccccaggggtgtgtggtgtgtttgtga
A0A674ELG3_MCL1-02      taa---------------------------
                                                      

© 1998-2020Legal notice