Dataset for CDS BCL2L1 of organism Xenopus laevis

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

Q2TAP5_BCL2L1-01      atggagggcagcagtagagatctggtggagaagtttgttagtaagaaact
Q91828_BCL2L1-01      atggagggcagcagtagagatctggtggagaagtttgttagtaagaaact

Q2TAP5_BCL2L1-01      ttcccagaatgaagcctgcaggaagttctccaataatccccaacccaatg
Q91828_BCL2L1-01      ttcccagaatgaagcctgcaggaagttctccaataat-cccaacccaatg
                      ************************************* ************

Q2TAP5_BCL2L1-01      ccatatctaatggaa-cttctacttcagagcgccccggggaaggggccac
Q91828_BCL2L1-01      ccatatctaatggaaccttctacttcagagcgccccggggaaggggccac
                      *************** **********************************

Q2TAP5_BCL2L1-01      gcagggcattgtggaggaggaagtccttcaagcccttttggaagcaacgg
Q91828_BCL2L1-01      gcagggcattgtggaggaggaagtccttcaagcccttttggaagcaacgg

Q2TAP5_BCL2L1-01      aggagtttgagttgagatatcagcgtgccttcagtgacctgacctcacag
Q91828_BCL2L1-01      aggagtttgagttgagatatcagcgtgccttcagtgacctgacctcacag

Q2TAP5_BCL2L1-01      ctgcacatcacccaggacacggcccagcagagcttccagcaagttatggg
Q91828_BCL2L1-01      ctgcacatcacccaggacacggcccagcagagcttccagcaagttatggg

Q2TAP5_BCL2L1-01      agagttgttcagggatgggacaaactgggggagaattgtggctttcttct
Q91828_BCL2L1-01      agagttgttcagggatgggacaaactgggggagaattgtggctttcttct

Q2TAP5_BCL2L1-01      catttgggcgggccctatgtgtggagagtgcaaacaaggagatgactgat
Q91828_BCL2L1-01      catttgggcgggccctatgtgtggagagtgcaaacaaggagatgactgat

Q2TAP5_BCL2L1-01      ctgctacccagaattgtccagtggatggtgaattatctagagcacacact
Q91828_BCL2L1-01      ctgctacccagaattgtccagtggatggtgaattatctagagcacacact

Q2TAP5_BCL2L1-01      gcagccctggatgcaggagaatggaggctgggaagcttttgtcggcctgt
Q91828_BCL2L1-01      gcagccctggatgcaggagaatggaggctgggaagcttttgtcggcctgt

Q2TAP5_BCL2L1-01      atggaaagaatgccgcagcccagagcagagaaagccaggaacgatttggc
Q91828_BCL2L1-01      atggaaagaatgccgcagcccagagcagagaaagccaggaacgatttggc

Q2TAP5_BCL2L1-01      aggttgctgactatagtgattctgactggtgttttcgcattggtctgcta
Q91828_BCL2L1-01      aggttgctgactatagtgatgctgactggtgttttcgcattggtctgcta
                      ******************** *****************************

Q2TAP5_BCL2L1-01      catgaggcgccgatag
Q91828_BCL2L1-01      catgaggcgccgatag

© 1998-2020Legal notice