Dataset for CDS Unclassified of Organism Callorhinchus milii

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|A0A4W3IZN3_uncBCLWAV-01 Putative BCL2 homolog found in water-living anamniote vertebrates gene OS=[Eukaryota] Callorhinchus milii (length=936 residues).
atgttctgtgtgtttgtgtacaaccccccccgccccaccctcctggtcacgagatgtcaagggaatgcctgtaaagccct
tgtgagatttattggctctatttttaaaaaaaaagcaagttcttttcctgacacattgcagtgtttgtcattgaccgtct
ctgaaacccagatcctgatattaggccaaaggtatttatacagtcctgtcgcctcgatgctcaatgtccaggttattttt
agacccttcagtgagttgtgggtcagttgttcgtgggtccggttgccacacaagcacgagagcgagagagagaagagaga
gcgacaagaggggtcaatgttcttgaggctgttccctgctcaggtgtccgggggtccgtgtgaggaccctgtggtgacgg
aagcccatgtcatgtcgagggattacatcagctttgtgacgggcaggaccacgaaggcagctcccagcccagcctccgca
gcgctccgccacgctggcaccgacctgatggggaaatatcccatcttcttcaagcgctggccacggatcttcagggacgt
ccggctggacaacgcctgcgacttcctgatcaagatcctggacgagcattttcagccggaggagtcctggcagcgcaagc
gactgacctggagtgggatcctctccatctacgtgctggccggacagatggccatttactgccaggagaacgggatgggg
tcggtgctggaggagctcgaggtgagggtgggacagtacgtggaagccaaggtgtgtccggacatcgtagataagggagg
atggtccggcttcgtcgagcgatacactaagaaagagaatgcggagcagtcggtggcccgtgggtgctgcggcacgctgc
tgttgctgagcgctggcttgctcgcttactacgtctacaggaaacgcttgtgctga
© 1998-2023Legal notice