Dataset for CDS BCL-2-like of organism Pongo abelii

[Download (right click)] [Edit] [Sequences] [Repertoires]

6 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


H2NNZ9_BCL2A1-01        atgacagact---gtgaatttgggtatatttacaggctagctcaggacta
A0A2J8VIH3_BCL2L1-      atgt-----ctcagagcaaccgggagc--------tggtggttgactttc
H2NN92_BCL2L10-01       atggttgacc-------agttgcgggagcgcactatcacggccgac----
H2N5Y9_MCL1-01          atgttcggcctcaaaagaaacgcggta-------atcggactcaac---c
H2N5Y9_MCL1-02          atgttcggcctcaaaagaaacgcggta-------atcggactcaac---c
H2N5Y9_MCL1-03          atgttcggcctcaaaagaaacgcggta-------atcggactcaac---c
                        ***              *   * *                          

H2NNZ9_BCL2A1-01        tctgcagtacgtcctacagataccacaacctggatcaggtccaagcaaag
A0A2J8VIH3_BCL2L1-      tctcctacaagcttt-------------cccagaaaggatacagctggag
H2NN92_BCL2L10-01       -ctgctgagggagcg-------------caccgagcggctgctggccgac
H2N5Y9_MCL1-01          tctactgtggggggg-------------c-cggcttgggtgctggcag--
H2N5Y9_MCL1-02          tctactgtggggggg-------------c-cggcttgggtgctggcag--
H2N5Y9_MCL1-03          tctactgtggggggg-------------c-cggcttgggtgctggcag--
                         ** *     *                 *   *    * * *        

H2NNZ9_BCL2A1-01        cgtccagagtactacaa-------aaggttgcgttct-------------
A0A2J8VIH3_BCL2L1-      tcagtttagtgatgtgg--aagagaa------------------------
H2NN92_BCL2L10-01       tacctggggtgctgcgc--ccgggaacccggcaccc--------------
H2N5Y9_MCL1-01          ---cggcggcgccacccctccgggagggcggcttttggctacggagaagg
H2N5Y9_MCL1-02          ---cggcggcgccacccctccgggagggcggcttttggctacggagaagg
H2N5Y9_MCL1-03          ---cggcggcgccacccctccgggagggcggctttt--------------
                                *               *                         

H2NNZ9_BCL2A1-01        --------------------------------------------------
A0A2J8VIH3_BCL2L1-      --------------------------------------------------
H2NN92_BCL2L10-01       --------------------------------------------------
H2N5Y9_MCL1-01          aggcctcggcccggcgagagatagggggaggggaggccggcgcggtgatt
H2N5Y9_MCL1-02          aggcctcggcccggcgagagatagggggaggggaggccggcgcggtgatt
H2N5Y9_MCL1-03          --------------------------------------------------
                                                                          

H2NNZ9_BCL2A1-01        -----cagtccaaaa--------------------------agaagtgga
A0A2J8VIH3_BCL2L1-      -----caggactgaggc---------------------cccaga------
H2NN92_BCL2L10-01       -----cagagccgacgc--------------cgcccacgcccga------
H2N5Y9_MCL1-01          ggcggaagcgccggcgcaagccccccgtctaccctcacgccagactcccg
H2N5Y9_MCL1-02          ggcggaagcgccggcgcaagccccccgtctaccctcacgccagactcccg
H2N5Y9_MCL1-03          --------------------------------------------------
                                                                          

H2NNZ9_BCL2A1-01        aaagaatctgaagccatgcttggacaacgttaatgttgtgtccgtagaca
A0A2J8VIH3_BCL2L1-      ---agggactgaatcggagatggagacccccagtgccatcaatggcaacc
H2NN92_BCL2L10-01       ---ggccgccgtgctgcgctccgcggccgccaggtt-----acggcagct
H2N5Y9_MCL1-01          gagggtcgcgcggccgccgcccattggcgccgaggtccccgacgtcaccg
H2N5Y9_MCL1-02          gagggtcgcgcggccgccgcccattggcgccgaggtccccgacgtcaccg
H2N5Y9_MCL1-03          --------------------------------------------------
                                                                          

H2NNZ9_BCL2A1-01        ctgcc------------------agaacactattcaacca----------
A0A2J8VIH3_BCL2L1-      catcc-------------------tggcacctggcggaca------gccc
H2NN92_BCL2L10-01       ccacc-------ggtccttcttctccgcctacctcggctaccccgggaac
H2N5Y9_MCL1-01          cgacccccgcgaggctgtttttcttcgcgcccacccgccgcgcggcgccg
H2N5Y9_MCL1-02          cgacccccgcgaggctgtttttcttcgcgcccacccgccgcgcggcgccg
H2N5Y9_MCL1-03          --------------------------------------------------
                                                                          

H2NNZ9_BCL2A1-01        -----agtaatggaaaaggagtttgaagatggcat---------------
A0A2J8VIH3_BCL2L1-      cgcggtgaa-tggagccactggccacagcagcagtttggatgcccgggag
H2NN92_BCL2L10-01       cgcgtcgaactggtggcgctgatggcggattccgt---------------
H2N5Y9_MCL1-01          cttgaggagatggaagccccggccgccgacgccatcatgtcgcccgaaga
H2N5Y9_MCL1-02          cttgaggagatggaagccccggccgccgacgccatcatgtcgcccgaaga
H2N5Y9_MCL1-03          --------------------------------------------------
                                                                          

H2NNZ9_BCL2A1-01        --------------------------------------------------
A0A2J8VIH3_BCL2L1-      gtga---------------------tccccatggcagcag-------taa
H2NN92_BCL2L10-01       -------------------------gctctccgacagc---------ccc
H2N5Y9_MCL1-01          ggagctggacgggtacgagccggagcctctcgggaagcggccggctgtcc
H2N5Y9_MCL1-02          ggagctggacgggtacgagccggagcctctcgggaagcggccggctgtcc
H2N5Y9_MCL1-03          --------------------------------------------------
                                                                          

H2NNZ9_BCL2A1-01        --cattaactggggaagaattgtaa-------------------------
A0A2J8VIH3_BCL2L1-      agcaagcgctgagggaggcaggcga--cgagtttgaactgcggtaccggc
H2NN92_BCL2L10-01       agccccacctggggcagagtggtga-------------------------
H2N5Y9_MCL1-01          tgcctctgctggagttggtcggggaatctggtaataacaccagtacggac
H2N5Y9_MCL1-02          tgcctctgctggagttggtcggggaatctggtaataacaccagtacggac
H2N5Y9_MCL1-03          --------------------------------------------------
                                                                          

H2NNZ9_BCL2A1-01        --------------------------------------------------
A0A2J8VIH3_BCL2L1-      ggg-----------------------------------------------
H2NN92_BCL2L10-01       --------------------------------------------------
H2N5Y9_MCL1-01          gggtcactaccctcgacgccgccgccagcagaggaggaggaggacgagtt
H2N5Y9_MCL1-02          gggtcactaccctcgacgccgccgccagcagaggaggaggaggacgagtt
H2N5Y9_MCL1-03          --------------------------------------------------
                                                                          

H2NNZ9_BCL2A1-01        ------------------------ccatatttgcatttgaaggtattctc
A0A2J8VIH3_BCL2L1-      ---cattcagtgacctgacatcccagctccacatcaccccagggacagca
H2NN92_BCL2L10-01       ------------------------cgctcgtgaccttcgcagggacgct-
H2N5Y9_MCL1-01          gtaccggcagtcgctggagattatctctcggtaccttcgggagcaggcc-
H2N5Y9_MCL1-02          gtaccggcagtcgctggagattatctctcggtaccttcgggagcaggcc-
H2N5Y9_MCL1-03          ---------------------------------------------ggcc-
                                                                          

H2NNZ9_BCL2A1-01        atcaagaaacttctac-gacagcaaattgc-----cccggatgtggatac
A0A2J8VIH3_BCL2L1-      tatcagagctttgaacaggtagtgaatgaactcttccgggatggggtaaa
H2NN92_BCL2L10-01       -gctggag--------agagggccgctg--------------gtgaccgc
H2N5Y9_MCL1-01          -accggcgccaaggacacaaagccattggg-----caggtctggggccac
H2N5Y9_MCL1-02          -accggcgccaaggacacaaagccattggg-----caggtctggggccac
H2N5Y9_MCL1-03          -accggcgccaaggacacaaagccattggg-----caggtctggggccac
                             *               *    *               * *     

H2NNZ9_BCL2A1-01        ttacaaggagatttcata-------ttttgttgcggagttcgt----cat
A0A2J8VIH3_BCL2L1-      ctggggtcgcattgtggcctttttctccttcggcggggcactgtg--cgt
H2NN92_BCL2L10-01       ccggtggaagaattggggct-----tccagccgcggctaaaggagcagga
H2N5Y9_MCL1-01          ctgcaggaaggctctggaga-----ccttacgacgggttggggat--ggc
H2N5Y9_MCL1-02          ctgcaggaaggctctggaga-----ccttacgacgggttggggat--ggc
H2N5Y9_MCL1-03          ctgcaggaaggctctggaga-----ccttacgacgggttggggat--ggc
                                    *                    ***              

H2NNZ9_BCL2A1-01        gaataacacag---------------------------------------
A0A2J8VIH3_BCL2L1-      ggaaagcgtagacaaggagatgca--------------------------
H2NN92_BCL2L10-01       gggcgacgtcgcc-cgggactgcc--------------------------
H2N5Y9_MCL1-01          gtgcagcgcaaccacgagacggccttccaa--------------------
H2N5Y9_MCL1-02          gtgcagcgcaaccacgagacggccttccaaggcatgcttcggaaactgga
H2N5Y9_MCL1-03          gtgcagcgcaaccacgagacggccttccaaggcatgcttcggaaactgga
                        *     *                                           

H2NNZ9_BCL2A1-01        --------------------------------------------------
A0A2J8VIH3_BCL2L1-      --------------------------------------------------
H2NN92_BCL2L10-01       --------------------------------------------------
H2N5Y9_MCL1-01          --------------------------------------------------
H2N5Y9_MCL1-02          catcaaaaacgaagacgatgtgaaatcgttgtctcgagtgatggtccatg
H2N5Y9_MCL1-03          catcaaaaacgaagacgatgtgaaatcgttgtctcgagtgatggtccatg
                                                                          

H2NNZ9_BCL2A1-01        --------------------------------------------------
A0A2J8VIH3_BCL2L1-      -----ggtattggtgagtcggattgcagc---------------------
H2NN92_BCL2L10-01       -----agcgcc---------------------------------------
H2N5Y9_MCL1-01          --------------------------------------------------
H2N5Y9_MCL1-02          ttttcagcgacggcgtaacaaactggggcaggattgtgactctcatttct
H2N5Y9_MCL1-03          ttttcagcgacggcgtaacaaactggggcaggattgtgactctcatttct
                                                                          

H2NNZ9_BCL2A1-01        --------------------------------------------------
A0A2J8VIH3_BCL2L1-      ttggatggccacttacctgaat----------------------------
H2NN92_BCL2L10-01       --tggtggcctt---gctgagctcgcgg----------------------
H2N5Y9_MCL1-01          --------------------------------------------------
H2N5Y9_MCL1-02          tttggtgcctttgtggctaaacacttgaagaccataaaccaagaaagctg
H2N5Y9_MCL1-03          tttggtgcctttgtggctaaacacttgaagaccataaaccaagaaagctg
                                                                          

H2NNZ9_BCL2A1-01        --------------------------------------------------
A0A2J8VIH3_BCL2L1-      -------------------------------gaccacctagagc------
H2NN92_BCL2L10-01       ----------------------------------ctcgtggggcagcacc
H2N5Y9_MCL1-01          --------------------------------------------------
H2N5Y9_MCL1-02          catcgaaccattagcagaaagtatcacagacgttctcgtaaggacaaaac
H2N5Y9_MCL1-03          catcgaaccattagcagaaagtatcacagacgttctcgtaaggacaaaac
                                                                          

H2NNZ9_BCL2A1-01        gaggatggataaagcaaaacggaggctggg--------------------
A0A2J8VIH3_BCL2L1-      ---cttggatccaggagaacggcggctgggatacttttgtggaactctat
H2NN92_BCL2L10-01       gcgcctggctgcaggctcagggcggctgggatggcttttgtcacttcttc
H2N5Y9_MCL1-01          ----------------------------ggatgggtttgtggagttcttc
H2N5Y9_MCL1-02          gggactggctagttaaacaaagaggctgggatgggtttgtggagttcttc
H2N5Y9_MCL1-03          gggactggctagttaaacaaagaggctgggatgggtttgtggagttcttc
                                                    **                    

H2NNZ9_BCL2A1-01        -----------------------------------ggaaatggcaca---
A0A2J8VIH3_BCL2L1-      -------gggaac---aatgcagcagctgagagccgaaagggccaggaac
H2NN92_BCL2L10-01       -------aggaccccccttccgctggctttttggagaaaacagc------
H2N5Y9_MCL1-01          catgtagaggacc-----------------tagaaggaggcatcagaaat
H2N5Y9_MCL1-02          catgtagaggacc-----------------tagaaggaggcatcagaaat
H2N5Y9_MCL1-03          catgtagaggacc-----------------tagaaggaggcatcagaaat
                                                           * *     *      

H2NNZ9_BCL2A1-01        ------atcacacgcctatgctggtagagtcagtggcccacaaga-----
A0A2J8VIH3_BCL2L1-      gcttcaaccgctggttcctgacgggcatgactgtggccggcgtggttctg
H2NN92_BCL2L10-01       -t----ggtccaggcttttct--g-------tcatgcttg-ttaa--caa
H2N5Y9_MCL1-01          gt----gctgctggcttttgcagg-------tgttgctggagtag--gag
H2N5Y9_MCL1-02          gt----gctgctggcttttgcagg-------tgttgctggagtag--gag
H2N5Y9_MCL1-03          gt----gctgctggcttttgcagg-------tgttgctggagtag--gag
                                  *  *    *    *           **             

H2NNZ9_BCL2A1-01        -----------------agaggaaaatggctttgtaa
A0A2J8VIH3_BCL2L1-      ctgggctcactcttcagtcggaa----------atga
H2NN92_BCL2L10-01       cagccttcatttatct--ctggacacgattattatga
H2N5Y9_MCL1-01          ctggtttggcatatctaataagatagccttactgtaa
H2N5Y9_MCL1-02          ctggtttggcatatctaataagatag-----------
H2N5Y9_MCL1-03          ctggtttggcatatctaataagatag-----------
                                              *              

© 1998-2022Legal notice