Dataset for CDS BAX-like of Organism Anas platyrhynchos platyrhynchos

[Download (right click)] [Edit] [Sequences] [Repertoires]

3 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


U3ISP2_BOK-01           atgg-----------------aagtgctt---------------------
A0A493TW00_BAK1-01      atggtctggggttgggtttctaatttttttttttttttttcggtctctct
A0A493TW00_BAK1-02      atggtctggggttgggtttctaatttttttttttttttttcggtctctct
                        ****                 ** *  **                     

U3ISP2_BOK-01           -----------------------------------------------cgc
A0A493TW00_BAK1-01      tcttcttttccctcctcctccccggccctgctcgcttccttcccccgcgc
A0A493TW00_BAK1-02      tcttcttttccctcctcctccccggccctgctcgcttccttcccccgcgc
                                                                       ***

U3ISP2_BOK-01           cgatcctcagtcttc---------------------gctgcagaggtga-
A0A493TW00_BAK1-01      cgcgccgctgcgctccggggaggaggcaggaagggagcggcggggatggg
A0A493TW00_BAK1-02      cgcgccgctgcgctccggggaggaggcaggaagggagcggcggggatggg
                        **  ** * *   **                     ** ** * * **  

U3ISP2_BOK-01           ---------tggaggtgttcgacaggtctcccactga-------------
A0A493TW00_BAK1-01      gcagctccccggagggatgcgttagggctccccgggaccccccccggccc
A0A493TW00_BAK1-02      gcagctccccggagggatgcgttagggctccccgggaccccccccggccc
                                  *****  * **  *** *****   **             

U3ISP2_BOK-01           ------------caaggagcttgtgtcccaagcta---------aggctc
A0A493TW00_BAK1-01      ccctggaccccgccgggagccggta----aagctgatcctccccagcatc
A0A493TW00_BAK1-02      ccctggaccccgccgggagccggta----aagctgatcctccccagcatc
                                    *  *****  **     *****          **  **

U3ISP2_BOK-01           tctgc----------agagactacataaattcgaggctggttcgagca--
A0A493TW00_BAK1-01      tctgcgatggcctcagggaacgacggagacccaccgagggcccacggacg
A0A493TW00_BAK1-02      tctgcgatggcctcagggaacgacggagacccaccgagggcccacggacg
                        *****           *  ** **  * *  *   *  **  *  * *  

U3ISP2_BOK-01           ----ggtgtcagctggagcaaacc----cgagtgcaacgctccggtg-cc
A0A493TW00_BAK1-01      ccggggcagcaatgggcgcagactgtcacaagagctcaattcagaagacc
A0A493TW00_BAK1-02      ccggggcagcaatgggcgcagactgtcacaagagctcaattcagaagacc
                            **   **   ** *** **     * ** **     ** *  * **

U3ISP2_BOK-01           tggtg-----ggaagctggccgaggtgtc---------caccatc--ctg
A0A493TW00_BAK1-01      aggtggctcaggaaaccga-ggaggtgtttcggagctacgccttctaccg
A0A493TW00_BAK1-02      aggtggctcaggaaaccga-ggaggtgtttcggagctacgccttctaccg
                         ****     **** * *   *******          * ** **  * *

U3ISP2_BOK-01           ctgcggctgggagat------gagctggaata------cattcgccccaa
A0A493TW00_BAK1-01      ctaccaacaggagagagaagagagcggggaagaagtgcccttggacccgg
A0A493TW00_BAK1-02      ctaccaacaggagagagaagagagcggggaagaagtgcccttggacccgg
                        ** *     *****       **** ** *        * ** * ***  

U3ISP2_BOK-01           cgtctaccggaacatcgcccgccag--ctgaacatctctctgcactcgga
A0A493TW00_BAK1-01      agattgcggagat----ccagcaagacctgggca-------gtaccggga
A0A493TW00_BAK1-02      agattgcggagat----ccagcaagacctgggca-------gtaccggga
                         *  * * *  *     ** ** **  ***  **       * **  ***

U3ISP2_BOK-01           gacggtggtgacggacgccttcctggctgtagccg---------------
A0A493TW00_BAK1-01      gcctggtgggaagg-----cgcctggccatcatcggcgatgacattaaca
A0A493TW00_BAK1-02      gcctggtgggaagg-----cgcctggccatcatcggcgatgacattaaca
                        * * *  * ** **       ******  *   **               

U3ISP2_BOK-01           ----------cgcagattttcaccgcaggcataa---cgtgggg-----c
A0A493TW00_BAK1-01      agcggtacgacgctgagtttcgctacatgctgaaatccttgcagctcacc
A0A493TW00_BAK1-02      agcggtacgacgctgagtttcgctacatgctgaaatccttgcagctcacc
                                  *** ** **** *  ** **  **   * **  *     *

U3ISP2_BOK-01           aaggtgg-------------------------tgtctc---tctacgcgg
A0A493TW00_BAK1-01      aaggagaatgcctacgattacttcatcaagattgcctccagcctgtttga
A0A493TW00_BAK1-02      aaggagaatgcctacgattacttcatcaagattgcctccagcctgtttga
                        **** *                          ** ***    **    * 

U3ISP2_BOK-01           tggcggc-------ggggctggcag----------tggactgtg--tgcg
A0A493TW00_BAK1-01      aagcggcattaactggggccgggtgatcgcgctgctgggcttcggctact
A0A493TW00_BAK1-02      aagcggcattaactggggccgggtgatcgcgctgctgggcttcggctact
                          *****       ***** **  *          *** **  *  * * 

U3ISP2_BOK-01           gcac------------------gcacagc----cagccatggtgcacacc
A0A493TW00_BAK1-01      gcatggccatccacgtctaccagcacggcataacaggcttcctccgccgc
A0A493TW00_BAK1-02      gcatggccatccacgtctaccagcacggcataacaggcttcctccgccgc
                        ***                   **** **    *** * *  * * *  *

U3ISP2_BOK-01           atcgttgactgcctgggagagttcgt-ccgcaagaccttggtgacc--tg
A0A493TW00_BAK1-01      atcgcccgctacgtgacagagttcatgctgcgcaaccgcatcgcccagtg
A0A493TW00_BAK1-02      atcgcccgctacgtgacagagttcatgctgcgcaaccgcatcgcccagtg
                        ****    ** * **  ******* * * **   ***     * **  **

U3ISP2_BOK-01           gctgaaaaggcgaggaggctgggcagacatcacgaagtgtgttgtgaata
A0A493TW00_BAK1-01      gatcgcccagcagggaggatgggt-ggctgcactcgatctg--gacaatg
A0A493TW00_BAK1-02      gatcgcccagcagggaggatgggt-ggctgcactcgatctg--gacaatg
                        * *      **  ***** ****  * *  ***    * **  *  *** 

U3ISP2_BOK-01           ctgaccccagccttcgctcccactggc--tcgtggctgctgtttgcagct
A0A493TW00_BAK1-01      tttacatgaa-----gtacatgctggcggtggtggcc-ctggtgatgg--
A0A493TW00_BAK1-02      tttacatgaa-----gtacatgctggcggtggtggcc-ctggtgatgg--
                         * **   *      *  *   *****  * *****  *** *    *  

U3ISP2_BOK-01           ttgggcacttcctcaaggcgat-----------cttcttcgtgctgctgc
A0A493TW00_BAK1-01      tggggcatttagtggtgactataaggcttgaaactgtgactggcc-ctgt
A0A493TW00_BAK1-02      tggggcatttagtggta-----------cgacgcttcttcaggcc-----
                        * ***** **  *                    **    *  **      

U3ISP2_BOK-01           ctgagagatga
A0A493TW00_BAK1-01      ctga-------
A0A493TW00_BAK1-02      ctga-------
                        ****       

© 1998-2020Legal notice