Dataset for CDS BCL-2-like of organism Laticauda laticaudata

[Download (right click)] [Edit] [Sequences] [Repertoires]

4 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A8C5S4J3_BCL2-01      atggctc-------------------------------------------
A0A8C5SDG4_BCL2A1-      atggaaa------------------------gctacaat-----------
A0A8C5RX62_BCL2L1-      atgtcga------------------------gcggcaac-----------
A0A8C5WWU9_MCL1-01      atgttcaacaagaagacgatggttctctattgcggcggctcccccggatt
                        ***                                               

A0A8C5S4J3_BCL2-01      -------------------atcct--------------------------
A0A8C5SDG4_BCL2A1-      -------------------ttcct--------------------------
A0A8C5RX62_BCL2L1-      ----------------cggtccct--------------------------
A0A8C5WWU9_MCL1-01      ggcaccagccgcccctcagtcccccggcggcggcggcggcggcggcagcg
                                             **                           

A0A8C5S4J3_BCL2-01      ------------------------------------------gggataag
A0A8C5SDG4_BCL2A1-      --------------------------------------------------
A0A8C5RX62_BCL2L1-      --------------------------------------------ggtggt
A0A8C5WWU9_MCL1-01      agggcggcctggctctccttcccggcggcgttcgaggaggcctgggcggg
                                                                          

A0A8C5S4J3_BCL2-01      agattacagtaaccgggagata---gtgctgaggtacatccattacaagc
A0A8C5SDG4_BCL2A1-      ----------------------------ttatgtgaacac--------ct
A0A8C5RX62_BCL2L1-      ggacttcattgcctacaagctg---gcgcagcggggccac-------agc
A0A8C5WWU9_MCL1-01      ggtctgtgctggcctcccgccggctgcgctgaggggcctcgagcgctgat
                                                        *      *          

A0A8C5S4J3_BCL2-01      tgtcacagaa--------aggat---------------------------
A0A8C5SDG4_BCL2A1-      tggtgcaagattacctgaaatac---------------------------
A0A8C5RX62_BCL2L1-      tggcgcgagatcg-----agggt-----------------------gacg
A0A8C5WWU9_MCL1-01      tggcggagggtcgcgcgcagggcccctctcgctgattgggcccccggacg
                        **                *                               

A0A8C5S4J3_BCL2-01      -----------------at------gactgggttgccagtggaga-----
A0A8C5SDG4_BCL2A1-      -----------------atttgtcaagaggctcagctggcagcggcccca
A0A8C5RX62_BCL2L1-      gcgaggagcg---------------gacagagctgt--ccggcga-----
A0A8C5WWU9_MCL1-01      cggacgcgcgcgcgctgattggccaggcggcactgccgccggcgaccccc
                                                     *    *      * *      

A0A8C5S4J3_BCL2-01      --------------------------------------cagagaaaatgt
A0A8C5SDG4_BCL2A1-      aa------------------------------------caaagtggctga
A0A8C5RX62_BCL2L1-      ------------gatgggcggtagc----agcggtgtcctgaatggtggg
A0A8C5WWU9_MCL1-01      gaagaggagctggatggctgcgagcccgaggcggagaccggagtggag--
                                                              *  *        

A0A8C5S4J3_BCL2-01      ttctcctgctgttgggacctttcctgcccttggaggactggtgc------
A0A8C5SDG4_BCL2A1-      agtccttcgtaaagccggatcttctgctcagaag----------------
A0A8C5RX62_BCL2L1-      agcccctcctggcaccccagccccagcccggtggtcaacggggcagccag
A0A8C5WWU9_MCL1-01      ----ccttccgtcgcctcttcctccgccccgccgtcgcccggggacccg-
                            * *                * ** *                     

A0A8C5S4J3_BCL2-01      -ctctgccttctgctgctgtt----------------------------a
A0A8C5SDG4_BCL2A1-      ------------gaagttgaa----------------------------g
A0A8C5RX62_BCL2L1-      cattcacccggctctgctgga---------------------agagctga
A0A8C5WWU9_MCL1-01      -ctgcgccaggtgacgctgcagctggtggcctcatacctgcgagaggcgg
                                       * **                               

A0A8C5S4J3_BCL2-01      gtaacttggctgccact--------------------------------g
A0A8C5SDG4_BCL2A1-      gcaacctgaggccttac--------------------------------g
A0A8C5RX62_BCL2L1-      gcgac-----ggccccca--------------ggcggcggtgag-----g
A0A8C5WWU9_MCL1-01      ccgaccaggagccctccaagcaggacggctgcggcggcgggaagttcctg
                           **       *                                    *

A0A8C5S4J3_BCL2-01      aagaacatcctgtaccccaagttgtttattccacactatgccaagctggt
A0A8C5SDG4_BCL2A1-      tggactcactggg-------------------------------------
A0A8C5RX62_BCL2L1-      cagacgctgcggg-----------------------------aagctggg
A0A8C5WWU9_MCL1-01      cagggcctgctgggccgc------ttcggtccctgccccgccgaggcgga
                          *        *                                      

A0A8C5S4J3_BCL2-01      gatg--agttttcccg------gagatatcaaagggactttacccaaatg
A0A8C5SDG4_BCL2A1-      ------gattc-----------attccatagaagaagc--tggcaacat-
A0A8C5RX62_BCL2L1-      gacg--agttcgaact------gcgctaccggcgggcctttagcgacctg
A0A8C5WWU9_MCL1-01      gacggcggctcgggccctggagacgttg-cggagggtctgtgacgacatc
                                 *                       *   *  *  * *  * 

A0A8C5S4J3_BCL2-01      tctggacaactgcacttgactcc---------------------agtgac
A0A8C5SDG4_BCL2A1-      --------------------------------------------------
A0A8C5RX62_BCL2L1-      acctcacagctccacatcaccct-----------------gggcacggct
A0A8C5WWU9_MCL1-01      atggagaagcaccagctggccttccaaggaatgctgaggaaagtgcagat
                                                                          

A0A8C5S4J3_BCL2-01      tgccagaa---gtcatttcatgg---------ctgttgtagaagagctgt
A0A8C5SDG4_BCL2A1-      ---------------tttcaatc---------aagtgatggaaaacgaat
A0A8C5RX62_BCL2L1-      taccagag-------cttcgagc---------aagtggtgaacgaacttt
A0A8C5WWU9_MCL1-01      tgacaaagcggatgacttgaagcttatgtcggaagttgcaacgcaacttt
                                        **                **        *    *

A0A8C5S4J3_BCL2-01      tccgagatggagt---aaattggggaaggattgtggcattctttgaattt
A0A8C5SDG4_BCL2A1-      ttgcggatgggaaaattaactggggacgcattctgacgatattcctgttc
A0A8C5RX62_BCL2L1-      tccgggacggggt---gaactgggggcggattgtggcctttttctccttc
A0A8C5WWU9_MCL1-01      tcaacgatggcataacaaactgggggcgaattgtgactctcatttctttt
                        *    ** **       ** *****  * *** ** *  *  *    ** 

A0A8C5S4J3_BCL2-01      ggtggcatgctg--------tgtgtggaaagtgtcagt-cgggagatgtc
A0A8C5SDG4_BCL2A1-      ggtggaatcctggccaaaaaactccaaggacctttggcaaaagaaaactt
A0A8C5RX62_BCL2L1-      gg------aggggccctgtgcgt--ggagagcgtcgac-aaggaaatgcg
A0A8C5WWU9_MCL1-01      ggtgcctttgttgccaaacactt--gaagagcataaat-caggaaa-gcg
                        **                    *      *   *        ** *    

A0A8C5S4J3_BCL2-01      ac-------ctctcgtggacagtattgctgaatggatgactgaatacatg
A0A8C5SDG4_BCL2A1-      gaagcagatctcttatt----tcatcacagactatattgtga-gcaccaa
A0A8C5RX62_BCL2L1-      ggggc-------tggtgggaaggatcgccacctggatggccacgtacctg
A0A8C5WWU9_MCL1-01      gcatcagcactttggcggagattatcacggaggtgctggtgacagagaag
                                    *          **  *        *        *    

A0A8C5S4J3_BCL2-01      aacaggcacctgcataattggatccaggacaatggaggctggg--tacgt
A0A8C5SDG4_BCL2A1-      aggaaa-----------gtggatcagtgagaatggaggatgggacaatgg
A0A8C5RX62_BCL2L1-      acggagcacctggacccctggattcaagacaacggaggctggg--taagt
A0A8C5WWU9_MCL1-01      agagagtggctg-----ctgcatc----acaac----gcctgg--gaggg
                        *                 ** **     * **     *   **   * * 

A0A8C5S4J3_BCL2-01      ggctggttgtgttctttcactg--------tctggggtgggcgtggcctg
A0A8C5SDG4_BCL2A1-      cttt--ataacaaaatttgaggatagaaactcctgggtatccttatccac
A0A8C5RX62_BCL2L1-      ctttggctaaa--cttgcagggtaagggtctccagagagtcttcagc--c
A0A8C5WWU9_MCL1-01      cttt-gttaaattcttccatgtagaggacctggaaggcagcatcag----
                           *   *       *              *     *             

A0A8C5S4J3_BCL2-01      tatgtgggcca----ccagtttgacatccctga-----------------
A0A8C5SDG4_BCL2A1-      tctgaagacaaagatcttggctgttttttcagt-----------------
A0A8C5RX62_BCL2L1-      tttggggtaaaaccctccgtctggcatttctgtcggggggggggagatgc
A0A8C5WWU9_MCL1-01      ---------aaacattctgg-tggctttt-----gcaagcgtggctggcc
                                  *       *  **   *                       

A0A8C5S4J3_BCL2-01      ----------cttagac------------tga
A0A8C5SDG4_BCL2A1-      ----------cttcaatcaatatcactcataa
A0A8C5RX62_BCL2L1-      agggagggcgtgtgg-----------ggttga
A0A8C5WWU9_MCL1-01      taggagcgagcttggcttacttgatccggtga
                                    *                * *

© 1998-2022Legal notice