Dataset for CDS BCL-2 of organism Rhinopithecus roxellana

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A2K6R2I5_BCL2-01      atggcgcacgctgggagaacagggtacgataaccgggagatagtgatgaa
A0A2K6R2I5_BCL2-02      atggcgcacgctgggagaacagggtacgataaccgggagatagtgatgaa

A0A2K6R2I5_BCL2-01      gtacatccactataagctgtcgcagaggggctacgagtgggatgcgggag
A0A2K6R2I5_BCL2-02      gtacatccactataagctgtcgcagaggggctacgagtgggatgcgggag

A0A2K6R2I5_BCL2-01      atgtgggcgccgcgacccctggggccgcccccgcaccgggcatcttctcc
A0A2K6R2I5_BCL2-02      atgtgggcgccgcgacccctggggccgcccccgcaccgggcatcttctcc

A0A2K6R2I5_BCL2-01      tcccagcccgggcacacgccccatcccgccgcgtcccgggacccggtcgc
A0A2K6R2I5_BCL2-02      tcccagcccgggcacacgccccatcccgccgcgtcccgggacccggtcgc

A0A2K6R2I5_BCL2-01      caggacctcgccgctgccgaccccggctgcccccgccgccgccgcggggc
A0A2K6R2I5_BCL2-02      caggacctcgccgctgccgaccccggctgcccccgccgccgccgcggggc

A0A2K6R2I5_BCL2-01      ctgcgctcagcccggtgccacctgtggtccacctgaccctccgccaggcc
A0A2K6R2I5_BCL2-02      ctgcgctcagcccggtgccacctgtggtccacctgaccctccgccaggcc

A0A2K6R2I5_BCL2-01      ggtgacgacttctcccgccgctaccgccgcgacttcgccgagatgtccag
A0A2K6R2I5_BCL2-02      ggtgacgacttctcccgccgctaccgccgcgacttcgccgagatgtccag

A0A2K6R2I5_BCL2-01      ccagctgcacctgacgcccttcaccgcgcggggacgctttgccacggtgg
A0A2K6R2I5_BCL2-02      ccagctgcacctgacgcccttcaccgcgcggggacgctttgccacggtgg

A0A2K6R2I5_BCL2-01      tggaggagctcttcagggacggggtgaactgggggaggattgtggccttc
A0A2K6R2I5_BCL2-02      tggaggagctcttcagggacggggtgaactgggggaggattgtggccttc

A0A2K6R2I5_BCL2-01      tttgagttcggtggggtcatgtgtgtggagagcgtcaaccgggagatgtc
A0A2K6R2I5_BCL2-02      tttgagttcggtggggtcatgtgtgtggagagcgtcaaccgggagatgtc

A0A2K6R2I5_BCL2-01      gcccctggtggacaacatcgccctgtggatgactgagtacctgaaccggc
A0A2K6R2I5_BCL2-02      gcccctggtggacaacatcgccctgtggatgactgagtacctgaaccggc

A0A2K6R2I5_BCL2-01      acctgcacacttggatccaggataacggaggctgggatgcctttgtggaa
A0A2K6R2I5_BCL2-02      acctgcacacttggatccaggataacggaggctggcgtac---------a
                        ***********************************  * *         *

A0A2K6R2I5_BCL2-01      ctgtacggccccagcatgcggcctctgtttgatttctcctggctgtctct
A0A2K6R2I5_BCL2-02      atgt---------gcacgtggt-------------------gccgcttca
                         ***         *** * **                    ** *  ** 

A0A2K6R2I5_BCL2-01      gaagactctgctcagtttggccctggtgggagcttgcatcaccctgggtg
A0A2K6R2I5_BCL2-02      g-------------------------------------------------

A0A2K6R2I5_BCL2-01      cctatctgggccacaagtga
A0A2K6R2I5_BCL2-02      -------gggatgtgattga
                               ***     * ***

© 1998-2021Legal notice