Dataset for CDS MCL-1 of organism Pan troglodytes

[Download (right click)] [Edit] [Sequences] [Repertoires]

5 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


G2HFR3_MCL1-01          atggacatttgccggctctcagcagcaatgcgtgaatttta---------
A0A2I3RTV4_MCL1-04      ---agtgtt---------------gaaacgtg------------------
A0A2I3RTV4_MCL1-02      ----atgtttggc----ctcaaaagaaacgcggtaatcggactcaacctc
A0A2I3RTV4_MCL1-01      ----atgtttggc----ctcaaaagaaacgcggtaatcggactcaacctc
A0A2I3RTV4_MCL1-03      ----atgtttggc----ctcaaaagaaacgcggtaatcggactcaacctc
                               **               * ** * *                  

G2HFR3_MCL1-01          --------------------------------------------------
A0A2I3RTV4_MCL1-04      --------------------------------------------------
A0A2I3RTV4_MCL1-02      tactgtgggggggccggcttgggggccggcagcggcggcgccacccctcc
A0A2I3RTV4_MCL1-01      tactgtgggggggccggcttgggggccggcagcggcggcgccacccctcc
A0A2I3RTV4_MCL1-03      tactgtgggggggccggcttgggggccggcagcggcggcgccacccctcc
                                                                          

G2HFR3_MCL1-01          --------------------------------------------------
A0A2I3RTV4_MCL1-04      --------------------------------------------------
A0A2I3RTV4_MCL1-02      gggagggcgacttttggctacggagaaggaggcctcggcccggcgagaga
A0A2I3RTV4_MCL1-01      gggagggcgacttttggctacggagaaggaggcctcggcccggcgagaga
A0A2I3RTV4_MCL1-03      gggagggcgactttt-----------------------------------
                                                                          

G2HFR3_MCL1-01          --------------------------------------------------
A0A2I3RTV4_MCL1-04      --------------------------------------------------
A0A2I3RTV4_MCL1-02      tagggggaggggaggccggcgcggtgattggcggaagcgctggcgcaagc
A0A2I3RTV4_MCL1-01      tagggggaggggaggccggcgcggtgattggcggaagcgctggcgcaagc
A0A2I3RTV4_MCL1-03      --------------------------------------------------
                                                                          

G2HFR3_MCL1-01          --------------------------------------------------
A0A2I3RTV4_MCL1-04      --------------------------------------------------
A0A2I3RTV4_MCL1-02      cccccgtccaccctcacgccagactcccggagggtcgcgcggccgccgcc
A0A2I3RTV4_MCL1-01      cccccgtccaccctcacgccagactcccggagggtcgcgcggccgccgcc
A0A2I3RTV4_MCL1-03      --------------------------------------------------
                                                                          

G2HFR3_MCL1-01          --------------------------------------------------
A0A2I3RTV4_MCL1-04      --------------------------------------------------
A0A2I3RTV4_MCL1-02      cattggcgccgaggtccccgacgtcaccgcgacccccgcgaggctgcttt
A0A2I3RTV4_MCL1-01      cattggcgccgaggtccccgacgtcaccgcgacccccgcgaggctgcttt
A0A2I3RTV4_MCL1-03      --------------------------------------------------
                                                                          

G2HFR3_MCL1-01          --------------------------------------------------
A0A2I3RTV4_MCL1-04      --------------------------------------------------
A0A2I3RTV4_MCL1-02      tcttcgcgcccacccgccgcgcggcgccgcttgaggagatggaagccccg
A0A2I3RTV4_MCL1-01      tcttcgcgcccacccgccgcgcggcgccgcttgaggagatggaagccccg
A0A2I3RTV4_MCL1-03      --------------------------------------------------
                                                                          

G2HFR3_MCL1-01          --------------------------------------------------
A0A2I3RTV4_MCL1-04      --------------------------------------------------
A0A2I3RTV4_MCL1-02      gccgccgacgccatcatgtcgcccgaagaggagctggacgggtacgagcc
A0A2I3RTV4_MCL1-01      gccgccgacgccatcatgtcgcccgaagaggagctggacgggtacgagcc
A0A2I3RTV4_MCL1-03      --------------------------------------------------
                                                                          

G2HFR3_MCL1-01          --------------------------------------------------
A0A2I3RTV4_MCL1-04      --------------------------------------------------
A0A2I3RTV4_MCL1-02      ggagcctctcgggaagcggccggctgtcctgcctctgctggagttggtcg
A0A2I3RTV4_MCL1-01      ggagcctctcgggaagcggccggctgtcctgcctctgctggagttggtcg
A0A2I3RTV4_MCL1-03      --------------------------------------------------
                                                                          

G2HFR3_MCL1-01          --------------------------------------------------
A0A2I3RTV4_MCL1-04      --------------------------------------------------
A0A2I3RTV4_MCL1-02      gggaatctggtaataacaccagtacggacgggtcactaccctcgacgccg
A0A2I3RTV4_MCL1-01      gggaatctggtaataacaccagtacggacgggtcactaccctcgacgccg
A0A2I3RTV4_MCL1-03      --------------------------------------------------
                                                                          

G2HFR3_MCL1-01          --------------------------------------------------
A0A2I3RTV4_MCL1-04      --------------------------------------------------
A0A2I3RTV4_MCL1-02      ccgccagcagaggaggaggaggacgagttgtaccggcagtccctggagat
A0A2I3RTV4_MCL1-01      ccgccagcagaggaggaggaggacgagttgtaccggcagtccctggagat
A0A2I3RTV4_MCL1-03      --------------------------------------------------
                                                                          

G2HFR3_MCL1-01          --------------------------------------------------
A0A2I3RTV4_MCL1-04      --------------------------------------------------
A0A2I3RTV4_MCL1-02      tatctctcggtaccttcgggagcaggccaccggcgccaaggacacaaagc
A0A2I3RTV4_MCL1-01      tatctctcggtaccttcgggagcaggccaccggcgccaaggacacaaagc
A0A2I3RTV4_MCL1-03      ------------------------ggccaccggcgccaaggacacaaagc
                                                                          

G2HFR3_MCL1-01          cattgtgca-------------------------tctggatatataccca
A0A2I3RTV4_MCL1-04      --------------------------------------------------
A0A2I3RTV4_MCL1-02      caatgggcaggtctggggccaccagcaggaaggcgctggagaccttacga
A0A2I3RTV4_MCL1-01      caatgggcaggtctggggccaccagcaggaaggcgctggagaccttacga
A0A2I3RTV4_MCL1-03      caatgggcaggtctggggccaccagcaggaaggcgctggagaccttacga
                                                                          

G2HFR3_MCL1-01          ccacctgagtgtaccattca---------------------------cat
A0A2I3RTV4_MCL1-04      -----------------------------------------------cat
A0A2I3RTV4_MCL1-02      cgggttggggatggcgtgcagcgcaaccatgagacggccttccaa-----
A0A2I3RTV4_MCL1-01      cgggttggggatggcgtgcagcgcaaccatgagacggccttccaaggcat
A0A2I3RTV4_MCL1-03      cgggttggggatggcgtgcagcgcaaccatgagacggccttccaaggcat
                                                                          

G2HFR3_MCL1-01          gtt------actggacatcaaaaacgaagacgatgtgaaatcgttgtctc
A0A2I3RTV4_MCL1-04      gcttcggaaactggacatcaaaaacgaagacgatgtgaaatcgttgtctc
A0A2I3RTV4_MCL1-02      --------------------------------------------------
A0A2I3RTV4_MCL1-01      gcttcggaaactggacatcaaaaacgaagacgatgtgaaatcgttgtctc
A0A2I3RTV4_MCL1-03      gcttcggaaactggacatcaaaaacgaagacgatgtgaaatcgttgtctc
                                                                          

G2HFR3_MCL1-01          gagtgatgatccatgttttcagcgacggcgtaacaaactggggcaggatt
A0A2I3RTV4_MCL1-04      gagtgatgatccatgttttcagcgacggcgtaacaaactggggcaggatt
A0A2I3RTV4_MCL1-02      --------------------------------------------------
A0A2I3RTV4_MCL1-01      gagtgatgatccatgttttcagcgacggcgtaacaaactggggcaggatt
A0A2I3RTV4_MCL1-03      gagtgatgatccatgttttcagcgacggcgtaacaaactggggcaggatt
                                                                          

G2HFR3_MCL1-01          gtgactctcatttcttttggtgcctttgtggctaaacacttgaagaccat
A0A2I3RTV4_MCL1-04      gtgactctcatttcttttggtgcctttgtggctaaacacttgaagaccat
A0A2I3RTV4_MCL1-02      --------------------------------------------------
A0A2I3RTV4_MCL1-01      gtgactctcatttcttttggtgcctttgtggctaaacacttgaagaccat
A0A2I3RTV4_MCL1-03      gtgactctcatttcttttggtgcctttgtggctaaacacttgaagaccat
                                                                          

G2HFR3_MCL1-01          aaaccaagaaagctgcatcgaaccattagcagaaagtatcacagacgttc
A0A2I3RTV4_MCL1-04      aaaccaagaaagctgcatcgaaccattagcagaaagtatcacagacgttc
A0A2I3RTV4_MCL1-02      --------------------------------------------------
A0A2I3RTV4_MCL1-01      aaaccaagaaagctgcatcgaaccattagcagaaagtatcacagacgttc
A0A2I3RTV4_MCL1-03      aaaccaagaaagctgcatcgaaccattagcagaaagtatcacagacgttc
                                                                          

G2HFR3_MCL1-01          tcgtaaggacaaaacgggactggctagttaaacaaagaggctgggatggg
A0A2I3RTV4_MCL1-04      tcgtaaggacaaaacgggactggctagttaaacaaagaggctgggatggg
A0A2I3RTV4_MCL1-02      -------------------------------------------ggatggg
A0A2I3RTV4_MCL1-01      tcgtaaggacaaaacgggactggctagttaaacaaagaggctgggatggg
A0A2I3RTV4_MCL1-03      tcgtaaggacaaaacgggactggctagttaaacaaagaggctgggatggg
                                                                   *******

G2HFR3_MCL1-01          tttgtggagttcttccatgtagaggacctagaaggtggcatcaggaatgt
A0A2I3RTV4_MCL1-04      tttgtggagttcttccatgtagaggacctagaaggtggcatcaggaatgt
A0A2I3RTV4_MCL1-02      tttgtggagttcttccatgtagaggacctagaaggtggcatcaggaatgt
A0A2I3RTV4_MCL1-01      tttgtggagttcttccatgtagaggacctagaaggtggcatcaggaatgt
A0A2I3RTV4_MCL1-03      tttgtggagttcttccatgtagaggacctagaaggtggcatcaggaatgt
                        **************************************************

G2HFR3_MCL1-01          gctgctggcttttgcaggtgttgctggagtaggagctggtttggcatatc
A0A2I3RTV4_MCL1-04      gctgctggcttttgcaggtgttgctggagtaggagctggtttggcatatc
A0A2I3RTV4_MCL1-02      gctgctggcttttgcaggtgttgctggagtaggagctggtttggcatatc
A0A2I3RTV4_MCL1-01      gctgctggcttttgcaggtgttgctggagtaggagctggtttggcatatc
A0A2I3RTV4_MCL1-03      gctgctggcttttgcaggtgttgctggagtaggagctggtttggcatatc
                        **************************************************

G2HFR3_MCL1-01          taataagatag-----------
A0A2I3RTV4_MCL1-04      taataagatag-----------
A0A2I3RTV4_MCL1-02      taataagatagccttactgtaa
A0A2I3RTV4_MCL1-01      taataagatag-----------
A0A2I3RTV4_MCL1-03      taataagatag-----------
                        ***********           

© 1998-2022Legal notice