Dataset for CDS MCL-1 of organism Pan troglodytes

[Download (right click)] [Edit] [Sequences] [Repertoires]

3 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


G2HFR3_MCL1-01          atg---------------------------------gacattt-------
A0A2I3RTV4_MCL1-03      atgtttggcctcaaaagaaacgcggtaatcggactcaacctctactgtgg
A0A2I3RTV4_MCL1-01      atgtttggcctcaaaagaaacgcggtaatcggactcaacctctactgtgg
                        ***                                  ** * *       

G2HFR3_MCL1-01          ----gccggctc--------tcagcagcaatgc---------------gt
A0A2I3RTV4_MCL1-03      gggggccggcttgggggccggcagcggcggcgccacccctccgggagggc
A0A2I3RTV4_MCL1-01      gggggccggcttgggggccggcagcggcggcgccacccctccgggagggc
                            *******          **** **   **               * 

G2HFR3_MCL1-01          gaatttt-------------------------------------------
A0A2I3RTV4_MCL1-03      gactttt-------------------------------------------
A0A2I3RTV4_MCL1-01      gacttttggctacggagaaggaggcctcggcccggcgagagataggggga
                        ** ****                                           

G2HFR3_MCL1-01          --------------------------------------------------
A0A2I3RTV4_MCL1-03      --------------------------------------------------
A0A2I3RTV4_MCL1-01      ggggaggccggcgcggtgattggcggaagcgctggcgcaagccccccgtc
                                                                          

G2HFR3_MCL1-01          --------------------------------------------------
A0A2I3RTV4_MCL1-03      --------------------------------------------------
A0A2I3RTV4_MCL1-01      caccctcacgccagactcccggagggtcgcgcggccgccgcccattggcg
                                                                          

G2HFR3_MCL1-01          --------------------------------------------------
A0A2I3RTV4_MCL1-03      --------------------------------------------------
A0A2I3RTV4_MCL1-01      ccgaggtccccgacgtcaccgcgacccccgcgaggctgcttttcttcgcg
                                                                          

G2HFR3_MCL1-01          --------------------------------------------------
A0A2I3RTV4_MCL1-03      --------------------------------------------------
A0A2I3RTV4_MCL1-01      cccacccgccgcgcggcgccgcttgaggagatggaagccccggccgccga
                                                                          

G2HFR3_MCL1-01          --------------------------------------------------
A0A2I3RTV4_MCL1-03      --------------------------------------------------
A0A2I3RTV4_MCL1-01      cgccatcatgtcgcccgaagaggagctggacgggtacgagccggagcctc
                                                                          

G2HFR3_MCL1-01          --------------------------------------------------
A0A2I3RTV4_MCL1-03      --------------------------------------------------
A0A2I3RTV4_MCL1-01      tcgggaagcggccggctgtcctgcctctgctggagttggtcggggaatct
                                                                          

G2HFR3_MCL1-01          --------------------------------------------------
A0A2I3RTV4_MCL1-03      --------------------------------------------------
A0A2I3RTV4_MCL1-01      ggtaataacaccagtacggacgggtcactaccctcgacgccgccgccagc
                                                                          

G2HFR3_MCL1-01          --------------------------------------------------
A0A2I3RTV4_MCL1-03      --------------------------------------------------
A0A2I3RTV4_MCL1-01      agaggaggaggaggacgagttgtaccggcagtccctggagattatctctc
                                                                          

G2HFR3_MCL1-01          -----------------------------------------acattgtgc
A0A2I3RTV4_MCL1-03      ----------------ggccaccggcgccaaggacacaaagccaatgggc
A0A2I3RTV4_MCL1-01      ggtaccttcgggagcaggccaccggcgccaaggacacaaagccaatgggc
                                                                  ** ** **

G2HFR3_MCL1-01          a-------------------------tctggatatatacccaccacctga
A0A2I3RTV4_MCL1-03      aggtctggggccaccagcaggaaggcgctggagaccttacgacgggttgg
A0A2I3RTV4_MCL1-01      aggtctggggccaccagcaggaaggcgctggagaccttacgacgggttgg
                        *                          ***** *  *  * **    ** 

G2HFR3_MCL1-01          gtgtaccattca---------------------------catgtt-----
A0A2I3RTV4_MCL1-03      ggatggcgtgcagcgcaaccatgagacggccttccaaggcatgcttcgga
A0A2I3RTV4_MCL1-01      ggatggcgtgcagcgcaaccatgagacggccttccaaggcatgcttcgga
                        *  *  * * **                           **** *     

G2HFR3_MCL1-01          -actggacatcaaaaacgaagacgatgtgaaatcgttgtctcgagtgatg
A0A2I3RTV4_MCL1-03      aactggacatcaaaaacgaagacgatgtgaaatcgttgtctcgagtgatg
A0A2I3RTV4_MCL1-01      aactggacatcaaaaacgaagacgatgtgaaatcgttgtctcgagtgatg
                         *************************************************

G2HFR3_MCL1-01          atccatgttttcagcgacggcgtaacaaactggggcaggattgtgactct
A0A2I3RTV4_MCL1-03      atccatgttttcagcgacggcgtaacaaactggggcaggattgtgactct
A0A2I3RTV4_MCL1-01      atccatgttttcagcgacggcgtaacaaactggggcaggattgtgactct
                        **************************************************

G2HFR3_MCL1-01          catttcttttggtgcctttgtggctaaacacttgaagaccataaaccaag
A0A2I3RTV4_MCL1-03      catttcttttggtgcctttgtggctaaacacttgaagaccataaaccaag
A0A2I3RTV4_MCL1-01      catttcttttggtgcctttgtggctaaacacttgaagaccataaaccaag
                        **************************************************

G2HFR3_MCL1-01          aaagctgcatcgaaccattagcagaaagtatcacagacgttctcgtaagg
A0A2I3RTV4_MCL1-03      aaagctgcatcgaaccattagcagaaagtatcacagacgttctcgtaagg
A0A2I3RTV4_MCL1-01      aaagctgcatcgaaccattagcagaaagtatcacagacgttctcgtaagg
                        **************************************************

G2HFR3_MCL1-01          acaaaacgggactggctagttaaacaaagaggctgggatgggtttgtgga
A0A2I3RTV4_MCL1-03      acaaaacgggactggctagttaaacaaagaggctgggatgggtttgtgga
A0A2I3RTV4_MCL1-01      acaaaacgggactggctagttaaacaaagaggctgggatgggtttgtgga
                        **************************************************

G2HFR3_MCL1-01          gttcttccatgtagaggacctagaaggtggcatcaggaatgtgctgctgg
A0A2I3RTV4_MCL1-03      gttcttccatgtagaggacctagaaggtggcatcaggaatgtgctgctgg
A0A2I3RTV4_MCL1-01      gttcttccatgtagaggacctagaaggtggcatcaggaatgtgctgctgg
                        **************************************************

G2HFR3_MCL1-01          cttttgcaggtgttgctggagtaggagctggtttggcatatctaataaga
A0A2I3RTV4_MCL1-03      cttttgcaggtgttgctggagtaggagctggtttggcatatctaataaga
A0A2I3RTV4_MCL1-01      cttttgcaggtgttgctggagtaggagctggtttggcatatctaataaga
                        **************************************************

G2HFR3_MCL1-01          tag
A0A2I3RTV4_MCL1-03      tag
A0A2I3RTV4_MCL1-01      tag
                        ***

© 1998-2020Legal notice