Dataset for CDS BCL2L1 of organism Cyprinus carpio

[Download (right click)] [Edit] [Sequences] [Repertoires]

3 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A8C2HNY8_BCL2L1-      -atgtcttactataaccgagaactggtg----------------------
A0A8C1JXA4_BCL2L1-      -atgtcttactataacagagaactggtg----------------------
A0A8C2G339_BCL2L1-      gccattgcaccatccctgagcgtcggcagaagcctgagaaggacgcaagg
                            *   ** **  * ***    **                        

A0A8C2HNY8_BCL2L1-      ----gtgttttttattaaatacaaactctcgcagaggaactacccctaca
A0A8C1JXA4_BCL2L1-      ----gtattttttattaaatataaactctcacagaggaactacccgtaca
A0A8C2G339_BCL2L1-      gtgtgcactgtgttctaagaacaagc-------gagtggatatccagaca
                            *   * * *  ***  * ** *       ***    ** **  ***

A0A8C2HNY8_BCL2L1-      ----accacattgaatttacagaagacacaaatcggactgatgcggcgga
A0A8C1JXA4_BCL2L1-      ----atcacattgaatttacagaagacacacatcggactgatgcggtgga
A0A8C2G339_BCL2L1-      tcggagaacgacgagcaacgacaagacacacatcggactgatgcggcgga
                            *  **   **      * ******** *************** ***

A0A8C2HNY8_BCL2L1-      agggaatgatgatgaggaggcagcaggaacgacgaccctcgttaatggat
A0A8C1JXA4_BCL2L1-      agggaatgatgatgaggaggcagcaggaacaacgaccctcgttaatggct
A0A8C2G339_BCL2L1-      agggaatgatgatgaggaggcagcaggaaggacgaccctcgttaatggct
                        *****************************  ***************** *

A0A8C2HNY8_BCL2L1-      ccctgaacggaacaagtactggttccactgggaccccaccaaggtccccc
A0A8C1JXA4_BCL2L1-      ccctgaacggaacaagtactggttccactgggaccccaccaaggtccccc
A0A8C2G339_BCL2L1-      ccctgaacggaacaagtactggttccactgggaccccaccaaggtccccc
                        **************************************************

A0A8C2HNY8_BCL2L1-      gcttcaaccccccagcgtcagacgaacgggactgggggtctggacgctgt
A0A8C1JXA4_BCL2L1-      acttcagccccccagcgtcagacgaacgggactgggggtcttgatgcagt
A0A8C2G339_BCL2L1-      acttcagccccccagcgtcagacgaacgggactgggggtctggatgcagt
                         ***** ********************************** ** ** **

A0A8C2HNY8_BCL2L1-      aaaggaggcacttcgtgattctgccaacgagtttgagctgcgttattccc
A0A8C1JXA4_BCL2L1-      aaaggaggcgcttcgcgattctgccaacgaatttgagctgcgttattccc
A0A8C2G339_BCL2L1-      aaaggaggcgcttcgcgattctgccaacgaatttgagctgcgttattccc
                        ********* ***** ************** *******************

A0A8C2HNY8_BCL2L1-      aagcattcaacgacctgtccttgcagctccacatcacgcctgccacggcg
A0A8C1JXA4_BCL2L1-      aagcattcaacgacctgtcctcgcagctccacatcacgcctgccacagcg
A0A8C2G339_BCL2L1-      aagcattcaacgacctgtcctcgcagctccacatcacgcctgccacagcg
                        ********************* ************************ ***

A0A8C2HNY8_BCL2L1-      taccagagctttgagagcgtaatggatgaggtgttccgcgacggtgtcaa
A0A8C1JXA4_BCL2L1-      taccagagcttcgagagcgtgatggatgaggtgttccgcgacggcgtcaa
A0A8C2G339_BCL2L1-      taccagagcttcgagagcgtgatggatgaggtgttccgcgacggcgtcaa
                        *********** ******** *********************** *****

A0A8C2HNY8_BCL2L1-      ctggggccgcatcgtgggactgtttgcctttggaggggctctgtgtgttg
A0A8C1JXA4_BCL2L1-      ctggggccgcatcgtgggactgtttgccttcggaggggctctgtgtgttg
A0A8C2G339_BCL2L1-      ctggggccgcatcgtgggactgtttgccttcggaggggctctgtgtgttg
                        ****************************** *******************

A0A8C2HNY8_BCL2L1-      agtgcgtggagaaagagatgagcccactagtgggaagcatcgcggaatgg
A0A8C1JXA4_BCL2L1-      agtgcgtggagaaggagatgagcccgctagtgggaagcatcgcgcattgg
A0A8C2G339_BCL2L1-      agtgcgtggagaaggagatgagcccgctagtgggaagcatcgcggattgg
                        ************* *********** ****************** * ***

A0A8C2HNY8_BCL2L1-      atgatcgtctacctagacaacaaaattcagccctggatccagagccaagg
A0A8C1JXA4_BCL2L1-      atgaccgtctacctagacaacaaaattcagccctggatccagagccaagg
A0A8C2G339_BCL2L1-      atgaccgtctacctagacaacaaaattcagccctggatccagagccaagg
                        **** *********************************************

A0A8C2HNY8_BCL2L1-      aggatgggaacgcttcgcagagatctttggaaaagatgcagcagcagaga
A0A8C1JXA4_BCL2L1-      aggatgggaacgcttcgcggagatctttggaaaagatgcagcggcagaga
A0A8C2G339_BCL2L1-      aggatgggaacgcttcgcggagatctttggaaaagatgcagcggcagaga
                        ****************** *********************** *******

A0A8C2HNY8_BCL2L1-      gcagaaaatcacaagaaaacttcaggaagtggttgctggcgggaataacc
A0A8C1JXA4_BCL2L1-      gcagaaaatcgcaagaaaacttcaagaagtggttgctggctggaatgacc
A0A8C2G339_BCL2L1-      gcagaaaatcgcaagaaaacttcaagaagtggttgctggctggaatgacc
                        ********** ************* *************** ***** ***

A0A8C2HNY8_BCL2L1-      ttgctcacgggtgtcgtggtcgggtcactcattgcacagaaacgcctgtg
A0A8C1JXA4_BCL2L1-      ttgctcacgggtgtcgtggtcgggtcactcattgcacagaaacgcctgtg
A0A8C2G339_BCL2L1-      ttgctcacgggtgtcgtggtcgggtcactcattgcacagaaacgcctgtg
                        **************************************************

A0A8C2HNY8_BCL2L1-      a
A0A8C1JXA4_BCL2L1-      a
A0A8C2G339_BCL2L1-      a
                        *

© 1998-2022Legal notice