Dataset for CDS BCL-2 of organism Sander lucioperca

[Download (right click)] [Edit] [Sequences] [Repertoires]

9 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A8C9ZFJ5_BCL2-09      --------------------------------------------------
A0A8C9ZFJ5_BCL2-01      --------------------------------------------------
A0A8C9ZFJ5_BCL2-05      --------------------------------------------------
A0A8C9ZFJ5_BCL2-06      atgtcctcggaagaagggttgagctcaacgatcacagattggcttttcat
A0A8C9ZFJ5_BCL2-02      atgtcctcggaagaagggttgagctcaacgatcacagattggcttttcat
A0A8C9ZFJ5_BCL2-03      atgtcctcggaagaagggttgagctcaacgatcacagattggcttttcat
A0A8C9ZFJ5_BCL2-04      atgtcctcggaagaagggttgagctcaacgatcacagattggcttttcat
A0A8C9ZFJ5_BCL2-07      --------------------------------------------------
A0A8C9ZFJ5_BCL2-08      --------------------------------------------------
                                                                          

A0A8C9ZFJ5_BCL2-09      --------------------------------------------------
A0A8C9ZFJ5_BCL2-01      -------------------------------atgcttcttgtagttgctg
A0A8C9ZFJ5_BCL2-05      -------------------------------atgcttcttgtagttgctg
A0A8C9ZFJ5_BCL2-06      caattcctggtggcttcttctgccattcatcatgcttcttgtagttgctg
A0A8C9ZFJ5_BCL2-02      caattcctggtggcttcttctgccattcatcatgcttcttgtagttgctg
A0A8C9ZFJ5_BCL2-03      caattcctggtggcttcttctgccattcatcatgcttcttgtagttgctg
A0A8C9ZFJ5_BCL2-04      caattcctggtggcttcttctgccattcatcatgcttcttgtagttgctg
A0A8C9ZFJ5_BCL2-07      ----------------------------------------gtaacggtag
A0A8C9ZFJ5_BCL2-08      --------------------------------------------------
                                                                          

A0A8C9ZFJ5_BCL2-09      --------------------------------------------------
A0A8C9ZFJ5_BCL2-01      ccttcatc--gttgcctttgtgttgctgttatacatgatatcgcctctca
A0A8C9ZFJ5_BCL2-05      ccttcatc--gttgcctttgtgttgctgttatacatgatatcgcctctca
A0A8C9ZFJ5_BCL2-06      ccttcatc--gttgcctttgtgttgctgttatacatgatatcgcctctca
A0A8C9ZFJ5_BCL2-02      ccttcatc--gttgcctttgtgttgctgttatacatgatatcgcctctca
A0A8C9ZFJ5_BCL2-03      ccttcatc--gttgcctttgtgttgctgttatacatgatatcgcctctca
A0A8C9ZFJ5_BCL2-04      ccttcatc--gttgcctttgtgttgctgttatacatgatatcgcctctca
A0A8C9ZFJ5_BCL2-07      ctaacgtccagtcattatactgtagct-----------------------
A0A8C9ZFJ5_BCL2-08      tacatttccagtt---------tacct-----------------------
                                                                          

A0A8C9ZFJ5_BCL2-09      --------------------------------------atggcgaa----
A0A8C9ZFJ5_BCL2-01      ttagtcccaaacctctgaaactgaacggggcccacgtcgtggtgacagga
A0A8C9ZFJ5_BCL2-05      ttagtcccaaacctctgaaactgaacggggcccacgtcgtggtgacagga
A0A8C9ZFJ5_BCL2-06      ttagtcccaaacctctgaaactgaacggggcccacgtcgtggtgacagga
A0A8C9ZFJ5_BCL2-02      ttagtcccaaacctctgaaactgaacggggcccacgtcgtggtgacagga
A0A8C9ZFJ5_BCL2-03      ttagtcccaaacctctgaaactgaacggggcccacgtcgtggtgacagga
A0A8C9ZFJ5_BCL2-04      ttagtcccaaacctctgaaactgaacggggcccacgtcgtggtgacagga
A0A8C9ZFJ5_BCL2-07      ------------------------------------tcatagtgacagga
A0A8C9ZFJ5_BCL2-08      -----------------------------------------gtgacagga
                                                                 * **     

A0A8C9ZFJ5_BCL2-09      ----cgagtgtaatcgcaa----cattgtggaaaagtac-----------
A0A8C9ZFJ5_BCL2-01      ggctcaagtgggattgggaaatccattgcagttgagtgctacaagcaagg
A0A8C9ZFJ5_BCL2-05      ggctcaagtgggattgggaaatccattgcagttgagtgctacaagcaagg
A0A8C9ZFJ5_BCL2-06      ggctcaagtgggattgggaaatccattgcagttgagtgctacaagcaagg
A0A8C9ZFJ5_BCL2-02      ggctcaagtgggattgggaaatccattgcagttgagtgctacaagcaagg
A0A8C9ZFJ5_BCL2-03      ggctcaagtgggattgggaaatccattgcagttgagtgctacaagcaagg
A0A8C9ZFJ5_BCL2-04      ggctcaagtgggattgggaaatccattgcagttgagtgctacaagcaagg
A0A8C9ZFJ5_BCL2-07      ggctcaagtgggattgggaaatccattgcagttgagtgctacaagcaagg
A0A8C9ZFJ5_BCL2-08      ggctcaagtgggattgggaaatccattgcagttgagtgctacaagcaagg
                            * ****  ** *  *    *****  *   *** *           

A0A8C9ZFJ5_BCL2-09      --------------------------------------------------
A0A8C9ZFJ5_BCL2-01      agcattcatcactttggtggcacgggatgaggctaaattgcttcaagcaa
A0A8C9ZFJ5_BCL2-05      agcattcatcactttggtggcacgggatgaggctaaattgcttcaagcaa
A0A8C9ZFJ5_BCL2-06      agcattcatcactttggtggcacgggatgagg------------------
A0A8C9ZFJ5_BCL2-02      agcattcatcactttggtggcacgggatgaggctaaattgcttcaagcaa
A0A8C9ZFJ5_BCL2-03      agcattcatcactttggtggcacgggatgaggctaaattgcttcaagcaa
A0A8C9ZFJ5_BCL2-04      agcattcatcactttggtggcacgggatgaggctaaattgcttcaagcaa
A0A8C9ZFJ5_BCL2-07      agcattcatcactttggtggcacgggatgaggctaaattgcttcaagcaa
A0A8C9ZFJ5_BCL2-08      agcattcatcactttggtggcacgggatgaggctaaattgcttcaagcaa
                                                                          

A0A8C9ZFJ5_BCL2-09      ----------------atctgccataaa----------------ctctcc
A0A8C9ZFJ5_BCL2-01      agaaagaggtggagaaatttgccatcaatgacaaacaggtggtgctctgc
A0A8C9ZFJ5_BCL2-05      agaaagaggtggagaaatttgccatcaatgacaaacaggtggtgctctgc
A0A8C9ZFJ5_BCL2-06      ---------------------------------------tggtgctctgc
A0A8C9ZFJ5_BCL2-02      agaaagaggtggagaaatttgccatcaatgacaaacaggtggtgctctgc
A0A8C9ZFJ5_BCL2-03      agaaagaggtggagaaatttgccatcaatgacaaacaggtggtgctctgc
A0A8C9ZFJ5_BCL2-04      agaaagaggtggagaaatttgccatcaatgac------------------
A0A8C9ZFJ5_BCL2-07      agaaagaggtggagaaatttgccatcaatgacaaacaggtggtgctctgc
A0A8C9ZFJ5_BCL2-08      agaaagaggtggagaaatttgccatcaatgacaaacaggtggtgctctgc
                                                                          

A0A8C9ZFJ5_BCL2-09      aaacggggctacgtgtttggatttgatgatgtccgggatgaagatgctgc
A0A8C9ZFJ5_BCL2-01      atatcagtggatgtttccag---tgattatagccaggtggaaagtg-tga
A0A8C9ZFJ5_BCL2-05      atatcagtggatgtttccag---tgattatagccaggtggaaagtg-tga
A0A8C9ZFJ5_BCL2-06      atatcagtggatgtttccag---tgattatagccaggtggaaagtg-tga
A0A8C9ZFJ5_BCL2-02      atatcagtggatgtttccag---tgattatagccaggtggaaagtg-tga
A0A8C9ZFJ5_BCL2-03      atatcagtggatgtttccag---tgattatagccaggtggaaagtg-tga
A0A8C9ZFJ5_BCL2-04      --------------------------------------------------
A0A8C9ZFJ5_BCL2-07      atatcagtggatgtttccag---tgattatagccaggtggaaagtg-tga
A0A8C9ZFJ5_BCL2-08      atatcagtggatgtttccag---tgattatagccaggtggaaagtg-tga
                                                                          

A0A8C9ZFJ5_BCL2-09      taataatgggtcaatag------------------ttgtccctccaccga
A0A8C9ZFJ5_BCL2-01      taaaacaggctcaagagaagctgggtccggttgatatgttagtgaactgt
A0A8C9ZFJ5_BCL2-05      taaaacaggctcaagagaagctgggtccggttgatatgttagtgaactgt
A0A8C9ZFJ5_BCL2-06      taaaacaggctcaagagaagctgggtccggttgatatgttagtgaactgt
A0A8C9ZFJ5_BCL2-02      taaaacaggctcaagagaagctgggtccggttgatatgttagtgaactgt
A0A8C9ZFJ5_BCL2-03      taaaacaggctcaagagaagctgggtccggttgatatgttagtgaactgt
A0A8C9ZFJ5_BCL2-04      --aaacaggctcaagagaagctgggtccggttgatatgttagtgaactgt
A0A8C9ZFJ5_BCL2-07      taaaacaggctcaagagaagctgggtccggttgatatgttagtgaactgt
A0A8C9ZFJ5_BCL2-08      taaaacaggctcaagagaagctgggtccggttgatatgttagtgaactgt
                          * *  ** **** **                   ***   *  ** * 

A0A8C9ZFJ5_BCL2-09      gtttggttcgccggtgccgtgaag---------gcagcactgggcc----
A0A8C9ZFJ5_BCL2-01      gctggattagccatttctggaaagtttgaggacgtggaagtggaccgttt
A0A8C9ZFJ5_BCL2-05      gctggattagccatttctggaaagtttgaggacgtggaagtggaccgttt
A0A8C9ZFJ5_BCL2-06      gctggattagccatttctggaaagtttgaggacgtggaagtggaccgttt
A0A8C9ZFJ5_BCL2-02      gctggattagccatttctggaaagtttgaggacgtggaagtggaccgttt
A0A8C9ZFJ5_BCL2-03      gctggattagccatttctggaaagtttgaggacgtggaagtggaccgttt
A0A8C9ZFJ5_BCL2-04      gctggattagccatttctggaaagtttgaggacgtggaagtggaccgttt
A0A8C9ZFJ5_BCL2-07      gctggattagccatttctggaaagtttgaggacgtggaagtggaccgttt
A0A8C9ZFJ5_BCL2-08      gctggattagccatttctggaaagtttgaggacgtggaagtggaccgttt
                        * * * ** ***  * * *  ***         *  * * *** **    

A0A8C9ZFJ5_BCL2-09      --------------------------------------------------
A0A8C9ZFJ5_BCL2-01      ta------------------------agaaactgatggaagtaaactacc
A0A8C9ZFJ5_BCL2-05      ta------------------------agaaactgatggaagtaaactacc
A0A8C9ZFJ5_BCL2-06      ta------------------------------------------------
A0A8C9ZFJ5_BCL2-02      taagtcagaaaggaggttaaattcccagaaactgatggaagtaaactacc
A0A8C9ZFJ5_BCL2-03      ta------------------------agaaactgatggaagtaaactacc
A0A8C9ZFJ5_BCL2-04      ta------------------------agaaactgatggaagtaaactacc
A0A8C9ZFJ5_BCL2-07      ta------------------------agaaactgatggaagtaaactacc
A0A8C9ZFJ5_BCL2-08      ta------------------------agaaactgatggaagtaaactacc
                                                                          

A0A8C9ZFJ5_BCL2-09      -tgacagcg-----------agagcatccctcacctctgcaaacg-----
A0A8C9ZFJ5_BCL2-01      tgggcagcgtttacccgacacgggccgtcataaccaccatgaaggagcga
A0A8C9ZFJ5_BCL2-05      tgggcagcgtttacccgacacgggccgtcataaccaccatgaaggagcga
A0A8C9ZFJ5_BCL2-06      --------------------------------------------------
A0A8C9ZFJ5_BCL2-02      tgggcagcgtttacccgacacgggccgtcataaccaccatgaaggagcga
A0A8C9ZFJ5_BCL2-03      tgggcagcgtttacccgacacgggccgtcataaccaccatgaaggagcga
A0A8C9ZFJ5_BCL2-04      tgggcagcgtttacccgacacgggccgtcataaccaccatgaaggagcga
A0A8C9ZFJ5_BCL2-07      tgggcagcgtttacccgacacgggccgtcataaccaccatgaaggagcga
A0A8C9ZFJ5_BCL2-08      tgggcagcgtttacccgacacgggccgtcataaccaccatgaaggagcga
                                                                          

A0A8C9ZFJ5_BCL2-09      -----------------------gctcccccagtccgacccgaccg----
A0A8C9ZFJ5_BCL2-01      agaatgggccgcattatgtttgtgtcctcccaagcaggccagatcggcct
A0A8C9ZFJ5_BCL2-05      agaatgggccgcattatgtttgtgtcctcccaagcaggccagatcggcct
A0A8C9ZFJ5_BCL2-06      --------------------------------------------------
A0A8C9ZFJ5_BCL2-02      agaatgggccgcattatgtttgtgtcctcccaagcaggccagatcggcct
A0A8C9ZFJ5_BCL2-03      agaatgggccgcattatgtttgtgtcctcccaagcaggccagatcggcct
A0A8C9ZFJ5_BCL2-04      agaatgggccgcattatgtttgtgtcctcccaagcaggccagatcggcct
A0A8C9ZFJ5_BCL2-07      agaatgggccgcattatgtttgtgtcctcccaagcaggccagatcggcct
A0A8C9ZFJ5_BCL2-08      agaatgggccgcattatgtttgtgtcctcccaagcaggccagatcggcct
                                                                          

A0A8C9ZFJ5_BCL2-09      -------------------ccgccatccacagagttctccgcgaggct--
A0A8C9ZFJ5_BCL2-01      gtttggatacaccgcctactccccatcca-agtttgctctgcgtggctta
A0A8C9ZFJ5_BCL2-05      gtttggatacaccgcctactccccatcca-agtttgctctgcgtggctta
A0A8C9ZFJ5_BCL2-06      --------------------------------------------------
A0A8C9ZFJ5_BCL2-02      gtttggatacaccgcctactccccatcca-agtttgctctgcgtggctta
A0A8C9ZFJ5_BCL2-03      gtttggatacaccgcctactccccatcca-agtttgctctgcgtggctta
A0A8C9ZFJ5_BCL2-04      gtttggatacaccgcctactccccatcca-agtttgctctgcgtggctta
A0A8C9ZFJ5_BCL2-07      gtttggatacaccgcctactccccatcca-agtttgctctgcgtggctta
A0A8C9ZFJ5_BCL2-08      gtttggatacaccgcctactccccatcca-agtttgctctgcgtggctta
                                                                          

A0A8C9ZFJ5_BCL2-09      --ggagacg----aacttgagagactataccagccggacttcacggagat
A0A8C9ZFJ5_BCL2-01      gcagagtcgctgcagatggagataa------agccatac--------aat
A0A8C9ZFJ5_BCL2-05      gcagagtcgctgcagatggagataa------agccatac--------aat
A0A8C9ZFJ5_BCL2-06      --------------------------------------------------
A0A8C9ZFJ5_BCL2-02      gcagagtcgctgcagatggagataa------agccatac--------aat
A0A8C9ZFJ5_BCL2-03      gcagagtcgctgcagatggagataa------agccatac--------aat
A0A8C9ZFJ5_BCL2-04      gcagagtcgctgcagatggagataa------agccatac--------aat
A0A8C9ZFJ5_BCL2-07      gcagagtcgctgcagatggagataa------agccatac--------aat
A0A8C9ZFJ5_BCL2-08      gcagagtcgctgcagatggagataa------agccatac--------aat
                                                                          

A0A8C9ZFJ5_BCL2-09      gtcgcggcaactgtatctcacctccaccacggcgcaaag--gagattcgc
A0A8C9ZFJ5_BCL2-01      atctatgtgactgtggcctacccccctgacactgagactccaggattagc
A0A8C9ZFJ5_BCL2-05      atctatgtgactgtggcctacccccctgacactgagactccaggattagc
A0A8C9ZFJ5_BCL2-06      --------------------------------------------------
A0A8C9ZFJ5_BCL2-02      atctatgtgactgtggcctacccccctgacactgagactccaggattagc
A0A8C9ZFJ5_BCL2-03      atctatgtgactgtggcctacccccctgacactgagactccaggattagc
A0A8C9ZFJ5_BCL2-04      atctatgtgactgtggcctacccccctgacactgagactccaggattagc
A0A8C9ZFJ5_BCL2-07      atctatgtgactgtggcctacccccctgacactgagactccaggattagc
A0A8C9ZFJ5_BCL2-08      atctatgtgactgtggcctacccccctgacactgagactccaggattagc
                                                                          

A0A8C9ZFJ5_BCL2-09      cgaggtgatc--gacgaactgttccgggacggggtgaactggggccggat
A0A8C9ZFJ5_BCL2-01      tgaggaaaataagacaaagcctctagagactaaattaa------------
A0A8C9ZFJ5_BCL2-05      tgaggaaaataagacaaagcctctagagactaaattaa------------
A0A8C9ZFJ5_BCL2-06      --------------------------------------------------
A0A8C9ZFJ5_BCL2-02      tgaggaaaataagacaaagcctctagagactaaattaa------------
A0A8C9ZFJ5_BCL2-03      tgaggaaaataagacaaagcctctagagactaaattaa------------
A0A8C9ZFJ5_BCL2-04      tgaggaaaataagacaaagcctctagagactaaattaa------------
A0A8C9ZFJ5_BCL2-07      tgaggaaaataagacaaagcctctagagactaaattaa------------
A0A8C9ZFJ5_BCL2-08      tgaggaaaataagacaaagcctctagagactaaattaa------------
                                                                          

A0A8C9ZFJ5_BCL2-09      tatcgctttcttcgagttcgggggcacggtgtgcgtggagtgcgccgcca
A0A8C9ZFJ5_BCL2-01      ------tctctgaaacttctggagtttgtcaacc--agaccaagtagcca
A0A8C9ZFJ5_BCL2-05      ------tctctgaaacttctggagtttgtcaacc--agaccaagtagcca
A0A8C9ZFJ5_BCL2-06      --------------------------------------------------
A0A8C9ZFJ5_BCL2-02      ------tctctgaaacttctggagtttgtcaacc--agaccaagtagcca
A0A8C9ZFJ5_BCL2-03      ------tctctgaaacttctggagtttgtcaacc--agaccaagtagcca
A0A8C9ZFJ5_BCL2-04      ------tctctgaaacttctggagtttgtcaacc--agaccaagtagcca
A0A8C9ZFJ5_BCL2-07      ------tctctgaaacttctggagtttgtcaacc--agaccaagtagcca
A0A8C9ZFJ5_BCL2-08      ------tctctgaaacttctggagtttgtcaacc--agaccaagtagcca
                                                                          

A0A8C9ZFJ5_BCL2-09      aag-------aggagatgacatcacaggtggac---aacatcgccgagtg
A0A8C9ZFJ5_BCL2-01      aaatcattgttcgagatg-cagtgcaggggaactttaacagctctgtggg
A0A8C9ZFJ5_BCL2-05      aaatcattgttcgagatg-ca-----------------------------
A0A8C9ZFJ5_BCL2-06      --------------------------------------------------
A0A8C9ZFJ5_BCL2-02      aaatcattgttcgagatg-cagtgcaggggaactttaacagctctgtggg
A0A8C9ZFJ5_BCL2-03      aaatcattgttcgagatg-cagtgcaggggaactttaacagctctgtggg
A0A8C9ZFJ5_BCL2-04      aaatcattgttcgagatg-cagtgcaggggaactttaacagctctgtggg
A0A8C9ZFJ5_BCL2-07      aaatcattgttcgagatg-cagtgcaggggaactttaacagctctgtggg
A0A8C9ZFJ5_BCL2-08      aaatcattgttcgagatg-cagtgcaggggaactttaacagctctgtggg
                                                                          

A0A8C9ZFJ5_BCL2-09      gatgactgagtatctaaatggacctctaaacagctggatacaa-------
A0A8C9ZFJ5_BCL2-01      acccgatggttacatgctatcagccctcacctgtggaatgtcacctgtta
A0A8C9ZFJ5_BCL2-05      --------------------------------------------------
A0A8C9ZFJ5_BCL2-06      --------------------------------------------------
A0A8C9ZFJ5_BCL2-02      acccgatggttacatgctatcagccctcacctgtggaatgtcacctgtta
A0A8C9ZFJ5_BCL2-03      acccgatggttacatgctatcagccctcacctgtggaatgtcacctgtta
A0A8C9ZFJ5_BCL2-04      acccgatggttacatgctatcagccctcacctgtggaatgtcacctgtta
A0A8C9ZFJ5_BCL2-07      acccgatggttacatgctatcagccctcacctgtggaatgtcacctgtta
A0A8C9ZFJ5_BCL2-08      acccgatggttacatgctatcagccctcacctgtggaatgtcacctgtta
                                                                          

A0A8C9ZFJ5_BCL2-09      ----gataacggaggat-------gggctgcctttgtggagctgtatgac
A0A8C9ZFJ5_BCL2-01      cgtccatcacagaaggcctccagcaggctgcctttgtggagctgtatgac
A0A8C9ZFJ5_BCL2-05      --------------------------attgttaccatgggattattt---
A0A8C9ZFJ5_BCL2-06      ------------------------agattgttaccatgggattattt---
A0A8C9ZFJ5_BCL2-02      cgtccatcacagaaggcctccagcagattgttaccatgggattattt---
A0A8C9ZFJ5_BCL2-03      cgtccatcacagaaggcctccagcagattgttaccatgggattattt---
A0A8C9ZFJ5_BCL2-04      cgtccatcacagaaggcctccagcagattgttaccatgggattattt---
A0A8C9ZFJ5_BCL2-07      cgtccatcacagaaggcctccagcagattgttaccatgggattattt---
A0A8C9ZFJ5_BCL2-08      cgtccatcacagaaggcctccagcagattgttaccatgggattattt---
                                                    **      ***   * * *   

A0A8C9ZFJ5_BCL2-09      agacagagggactccctcttcagctgctcctggccctccattaagacggt
A0A8C9ZFJ5_BCL2-01      agacagagggactccctcttcagctgctcctggccctccattaagacggt
A0A8C9ZFJ5_BCL2-05      ---cggaccatcgccctcttc-----tacctgg---ggagttttgacagc
A0A8C9ZFJ5_BCL2-06      ---cggaccatcgccctcttc-----tacctgg---ggagttttgacagc
A0A8C9ZFJ5_BCL2-02      ---cggaccatcgccctcttc-----tacctgg---ggagttttgacagc
A0A8C9ZFJ5_BCL2-03      ---cggaccatcgccctcttc-----tacctgg---ggagttttgacagc
A0A8C9ZFJ5_BCL2-04      ---cggaccatcgccctcttc-----tacctgg---ggagttttgacagc
A0A8C9ZFJ5_BCL2-07      ---cggaccatcgccctcttc-----tacctgg---ggagttttgacagc
A0A8C9ZFJ5_BCL2-08      ---cggaccatcgccctcttc-----tacctgg---ggagttttgacagc
                           * **    * ********       *****       **  *** * 

A0A8C9ZFJ5_BCL2-09      ctttggcctagctgc---actcggggcagctagcctcaccttcggagcat
A0A8C9ZFJ5_BCL2-01      ctttggcctagctgc---actcggggcagctagcctcaccttcggagcat
A0A8C9ZFJ5_BCL2-05      attgtgcgccgctgcatgattcagag-----------------ggagcag
A0A8C9ZFJ5_BCL2-06      attgtgcgccgctgcatgattcagag-----------------ggagcag
A0A8C9ZFJ5_BCL2-02      attgtgcgccgctgcatgattcagag-----------------ggagcag
A0A8C9ZFJ5_BCL2-03      attgtgcgccgctgcatgattcagag-----------------ggagcag
A0A8C9ZFJ5_BCL2-04      attgtgcgccgctgcatgattcagag-----------------ggagcag
A0A8C9ZFJ5_BCL2-07      attgtgcgccgctgcatgattcagag-----------------ggagcag
A0A8C9ZFJ5_BCL2-08      attgtgcgccgctgcatgattcagag-----------------ggagcag
                         **  **   *****   * ** * *                 ****** 

A0A8C9ZFJ5_BCL2-09      ac--------ctgaca--cagaagtga
A0A8C9ZFJ5_BCL2-01      ac--------ctgaca--cagaagtga
A0A8C9ZFJ5_BCL2-05      tcaaaagccgctgacaagagggagtaa
A0A8C9ZFJ5_BCL2-06      tcaaaagccgctgacaagagggagtaa
A0A8C9ZFJ5_BCL2-02      tcaaaagccgctgacaagagggagtaa
A0A8C9ZFJ5_BCL2-03      tcaaaagccgctgacaagagggagtaa
A0A8C9ZFJ5_BCL2-04      tcaaaagccgctgacaagagggagtaa
A0A8C9ZFJ5_BCL2-07      tcaaaagccgctgacaagagggagtaa
A0A8C9ZFJ5_BCL2-08      tcaaaagccgctgacaagagggagtaa
                         *        ******    * *** *

© 1998-2023Legal notice